Всемирная организация здравоохранения (ВОЗ / WHO) · Journal articles

Eastern Mediterranean Health Journal [2011; Vol.17, Issue 6]

Всемирная организация здравоохранения
Открыть оригинал документа

Полный текст размещён на сайте публикующей организации. lawenc.com индексирует метаданные и ведёт на официальный источник.

Полный текст

Contents V olum e 17 N um ber 6 June 2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale Volume 17 / No. 6 June / Juin 2011 6 ددع / شرع عباسلا دلجلما وينوي / ناريزح Letter from the Editor ........................................................................................................................................................467 Research articles Climate change and predicted trend of fungal keratitis in Egypt ............................................................................468 Hepatitis B virus infection among staff in three hospitals in Khartoum, Sudan, 2006–07 ....................................474 Rising bacterial resistance to common antibiotics in Al Ain, United Arab Emirates ..............................................479 Epidemiological profile of health-care-associated infections in the central-east area of Tunisia .........................485 Assessment of liver function among nickel-plating workers in Egypt .....................................................................490 Acute kidney injury after cardiac surgery in eastern Saudi Arabia ..........................................................................495 Effect of nutritional intervention on the prevalence of metabolic syndrome and heart disease risk factors in urban Tehran (Tehran Lipid and Glucose Study) ...............................................................................501 Factors associated with breast self-examination among Malaysian women teachers ...........................................509 Evaluating success of no-scalpel vasectomy by ligation and excision with fascial interposition in a large prospective study in Islamic Republic of Iran ..........................................................................................................517 Prevalence and predictors of smoking among adolescent schoolchildren in Monastir, Tunisia ..........................523 Sociocultural contexts of attempting suicide among Iranian youth: a qualitative study .......................................529 Public attitude towards biomedical research at outpatient clinics of King Abdulaziz medical city, Riyadh, Saudi Arabia..................................................................................................................................................536 Role of HFE gene mutations on developing iron overload in β-thalassaemia carriers in Egypt ............................546 Report Social consequences of infected haemophilia cases in the Islamic Republic of Iran ...........................................552 Donors and transfusion service staff at WHO annual blood drive Adequate stocks of safe blood can only be assured by regular donation by voluntary unpaid donors because the prevalence of bloodborne infections is lowest among these donors. Periodic blood drives in workplaces can increase the number of donors Cover 17-6.indd 1 6/5/2011 12:11:51 PM طسوتلما قشرل ةيلماعلا ةحصلا ةمظنلم ةيميلقلإا ةنجللا ءاضعأ نادلبلا ةيملاسلإا ناريإ ةيروهجم . ةيبيللا ةيبرعلا ةييرهمالجا . سنوت . نيرحبلا . ناتسكاب . ةدحتلما ةيبرعلا تاراملإا . ناتسناغفأ . ندرلأا صرم . نانبل . تيوكلا . رطق . ينطسلف . نماُع . قارعلا . لاموصلا . نادوسلا . تيوبيج . ةينميلا ةيروهملجا . ةيروسلا ةيبرعلا ةيروهملجا ةيدوعسلا ةيبرعلا ةكلملما . برغلما Subscriptions and Distribution Enquiries regarding subscriptions and distribution of the print edition of EMHJ should be addressed to: Printing and Marketing of Publications at: email: pam@emro.who.int; tel: (+202) 2276 5000; fax: (+202) 2670 2492 or 2670 2494 Permissions Requests for permission to reproduce or translate articles, whether for sale or non-commercial distribution should be addressed to EMHJ at: emhj@emro.who.int Members of the WHO Regional Committee for the Eastern Mediterranean Afghanistan . Bahrain . Djibouti . Egypt . Islamic Republic of Iran . Iraq . Jordan . Kuwait . Lebanon Libyan Arab Jamahiriya . Morocco . Oman . Pakistan . Palestine . Qatar . Saudi Arabia . Somalia Sudan . Syrian Arab Republic . Tunisia . United Arab Emirates . Republic of Yemen Membres du Comité régional de l’OMS pour la Méditerranée orientale Afghanistan . Arabie saoudite . Bahreïn . Djibouti . Égypte . Émirats arabes unis . République islamique d’Iran Iraq . Jamahiriya arabe libyenne . Jordanie . Koweït . Liban . Maroc . Oman . Pakistan . Palestine . Qatar République arabe syrienne . Somalie . Soudan . Tunisie . République du Yémen Correspondence Editor-in-chief EMHJ WHO Regional Office for the Eastern Mediterranean P.O. Box 7608 Nasr City, Cairo 11371 Egypt Tel: (+202) 2276 5000 Fax: (+202) 2670 2492/(+202) 2670 2494 Email: khayat@emro.who.int/emhj@emro.who.int EASTERN MEDITERRANEAN HEALTH JOURNAL IS the official health journal published by the Eastern Mediterranean Regional Office of the World Health Organization. It is a forum for the presentation and promotion of new policies and initiatives in health services; and for the exchange of ideas, con‑ cepts, epidemiological data, research findings and other information, with special reference to the Eastern Mediterranean Region. It addresses all members of the health profession, medical and other health educational institutes, interested NGOs, WHO Col‑ laborating Centres and individuals within and outside the Region. LA REVUE DE SANTÉ DE LA MÉDITERRANÉE ORIENTALE EST une revue de santé officielle publiée par le Bureau régional de l’Organisation mondiale de la Santé pour la Méditerranée orientale. Elle offre une tribune pour la présentation et la promotion de nouvelles politiques et initiatives dans le domaine des ser‑vices de santé ainsi qu’à l’échange d’idées, de concepts, de données épidémiologiques, de résultats de recherches et d’autres informations, se rapportant plus particulièrement à la Région de la Méditerranée orientale. Elle s’adresse à tous les professionnels de la santé, aux membres des instituts médicaux et autres instituts de formation médico‑sanitaire, aux ONG, Centres collabora‑ teurs de l’OMS et personnes concernés au sein et hors de la Région. EMHJ is a trilingual, peer reviewed, open access journal and the full contents are freely available at its website: http://www/emro.who.int/emhj.htm EMHJ is abstracted/indexed in the Index Medicus and MEDLINE (Medical Literature Analysis and Retrieval Systems on Line) and the ExtraMed‑Full text on CD‑ROM, the Cumulative Index to Nursing and Allied Health Literature (CINAHL), CAB International, Lexis Nexis, Scopus and the Index Medicus for the WHO Eastern Mediterranean Region (IMEMR). ©World Health Organization 2011 All rights reserved Disclaimer The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned. All reasonable precautions have been taken by the World Health Organization to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either express or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall the World Health Organization be liable for damages arising from its use. The named authors alone are responsible for the views expressed in this publication. ISSN 1020‑3397 Cover designed by Diana Tawadros Internal layout designed by Emad Marji and Diana Tawadros Printed by WHO Regional Office for the Eastern Mediterranean ميدقتل برنم ىهو .ةيلماعلا ةحصلا ةمظنمب طسوتلما قشرل ىميلقلإا بتكلما نع ردصت ىتلا ةيمسرلا ةلجلما ىه ةيئابولا تايطعلماو ميهافلماو ءارلآا لدابتلو ،اله جيوترلاو ةيحصلا تامدلخا فى ةديدلجا تاردابلماو تاسايسلا لك لىإ ةهجوم ىهو .طسوتلما قشر ميلقإب اهنم قلعتي ام ةصاخو ،تامولعلما نم كلذ يرغو ثاحبلأا جئاتنو زكارلماو ،ةينعلما ةيموكلحا يرغ تماظنلما اذكو ،ةيميلعتلا دهاعلما رئاسو ةيبطلا تايلكلاو ،ةيحصلا نهلما ءاضعأ .هجراخو ميلقلإا فى ةحصلاب ينمتهلما دارفلأاو ةيلماعلا ةحصلا ةمظنم عم ةنواعتلما طسوتلما قشرل ةيحصلا ةلجلما Cover 17-8.indd 2 8/8/2011 10:11:18 AM Contents La Revue de Santé de la Méditerranée orientale Eastern Mediterranean Health Journal Vol. 17 No. 6 6 ددع شرع عباسلا دلجلما•  2011  • Letter from the Editor ............................................................................................................................................................................................................................................................................................................................... 467 Research articles Climate change and predicted trend of fungal keratitis in Egypt A. Saad-Hussein, H.M. El-Mofty and M.A. Hassanien ....................................................................................................................................................................................................................................................468 Hepatitis B virus infection among staff in three hospitals in Khartoum, Sudan, 2006–07 A.H. Elduma and N.S. Saeed ..............................................................................................................................................................................................................................................................................................................474 Rising bacterial resistance to common antibiotics in Al Ain, United Arab Emirates M.R. Al-Kaabi, W.U-Z. Tariq and A.A. Hassanein .............................................................................................................................................................................................................................................................479 Epidemiological profile of health-care-associated infections in the central-east area of Tunisia K. Ben Salem, S. El Mhamdi, M. Letaief, M. Bchir and M.S. Soltani ......................................................................................................................................................................................................................485 Assessment of liver function among nickel-plating workers in Egypt H.M. El-Shafei .............................................................................................................................................................................................................................................................................................................................................490 Acute kidney injury after cardiac surgery in eastern Saudi Arabia A.M. Alkhunaizi, S.S.A. Shah, U.S. Wesslen, Z.A. Al Sadah and A. Antony ......................................................................................................................................................................................................495 Effect of nutritional intervention on the prevalence of metabolic syndrome and heart disease risk factors in urban Tehran (Tehran Lipid and Glucose Study) A. Ramezankhani, P. Mirmiran and F. Azizi ...........................................................................................................................................................................................................................................................................501 Factors associated with breast self-examination among Malaysian women teachers P. Parsa, M. Kandiah and N. Parsa .................................................................................................................................................................................................................................................................................................509 Evaluating success of no-scalpel vasectomy by ligation and excision with fascial interposition in a large prospective study in Islamic Republic of Iran H.F. Farrokh-Eslamlou, M. Eslami, I. Abdi-Rad and B. Eilkhanizadeh .................................................................................................................................................................................................................517 Prevalence and predictors of smoking among adolescent schoolchildren in Monastir, Tunisia S. El Mhamdi, G. Wolfcarius-Khiari, S. Mhalla, K. Ben Salem and S.M. Soltani ............................................................................................................................................................................................523 Sociocultural contexts of attempting suicide among Iranian youth: a qualitative study M. Keyvanara and A. Haghshenas .................................................................................................................................................................................................................................................................................................529 Public attitude towards biomedical research at outpatient clinics of King Abdulaziz medical city, Riyadh, Saudi Arabia M. Al-Jumah, M.A. Abolfotouh, I.B. Alabdulkareem, H.H. Balkhy, M.I. Al-Jeraisy, A.F. Al-Swaid, E.M. Al-Musaaed and B. Al-Knawy..................................................................536 Role of HFE gene mutations on developing iron overload in β-thalassaemia carriers in Egypt H.A. Madani, R .A. Afify, A.A. Abd El-Aal, N. Salama and N. Ramy ...................................................................................................................................................................................................................546 Report Social consequences of infected haemophilia cases in the Islamic Republic of Iran A.M. Cheraghali, P. Eshghi and H. Abolghasemi ...................................................................................................................................................................................................................................................................552 Book 17-6.indb 3 6/6/2011 9:44:35 AM M. Haytham Khayat MD, FRSH, Editor-in-chief Editorial Board Mohammad Abdur Rab MBBS, DTM&H, MPH&TM, PhD Naeema Al Gasseer MSc, PhD Mohamed M. Ali BSc, MSc, PhD, DTMH Abdulla S. Assaedi MBBS, MPH Mounir Farag MD, DGS, DEmS, DPH Abdul Ghaffar MD, MPH, MHA, PhD Malekafzali Hossein MK, MPH, PhD Jaouad Mahjour MD, MPH Mamunur Rahman Malik MBBS, Dip (Health Economics), MSc, MPhil Kassem Sara MD International Advisory Panel Dr S. Aboulazm. Professor of Orthodontics. Egypt Dr Abdul Rahman Al-Awadi BSc, MD, MPH, Honorary FRCM, Ireland Dr Law, Korea, Honorary FRCS & P, Glasgow, FRCP, Edinbugh. Kuwait Dr Fariba Al-Darazi RN, MSc, PhD. Bahrain Dr M. Al-Nozha, MD, FRCP, FACC, FESC. Professor of Medicine and Consultant Cardiologist. Saudi Arabia Dr Ala’din Alwan MD, FRCP, FFPHM. Iraq Dr F. Azizi. Professor of Internal Medicine and Endocrinology. Islamic Republic of Iran Dr K. Bagchi BSc, MD, PhD. India Professor K. Dawson BA, MD, PhD, FRCP, FRACP, FRCPCH, DObst, RCOG. New Zealand Professor Kaussay Dellagi MD. Tunisia Dr R. Dybkaer MD. Denmark Dr M. Aziz El-Matri. Professor of Medicine. Tunisia Professor F. El-Sabban BSc, MS, PhD. United States of America Dr A.H. El-Shaarawi MSc (Stat), PhD (Stat). Canada Professor N. Fikri-Benbrahim PhD (Pub health) (SocSci). Morocco Professor A.T. Florence BSc (Pharm), PhD, DSc, FRSC, FRPharmS, FRSE. United Kingdom Professor Cheherezade M.K. Ghazi BS (Nursing), MS (Nursing), DPH, MPA. Egypt Professor M.A. Ghoneim MD, MD (Hons). Egypt Dr J.A. Hashmi DTM&H, FRCP. Pakistan Professor J. Jervell MD, PhD. Norway Professor G.J. Johnson MA, MD, BChir, FRCS (C), FRCOphth, DCEH. United Kingdom Dr M. Kassas. Emeritus Professor of Plant Ecology. Egypt Professor M.M. Legnain MBBS, MRCOG, FRCOG. Libyan Arab Jamahiriya Professor El-Sheikh Mahgoub DipBact, PhD, MD, FRCPath. Sudan Professor A.M.A. Mandil MSc (Paediatr), MPH, DrPH. Egypt Professor A.B. Miller MB, FRCP. Canada Professor S.S. Najjar MD. Lebanon Dr Abubaker A. Qirbi BSc, MD (Edin), FRCPC (Can), FRCP FRCPath (UK). Republic of Yemen Professor O.S.E. Rasslan MD, PhD. Egypt Professor W.A. Reinké MBA, PhD. United States of America Professor I.A. Sallam, MD, Dip High Surgery Cairo, Honorary FRCS, PhD (Glasgow), LRCP, MRCS, FRCS (London), ECFMG. Egypt Dr C.Th.S. Sibinga FRCP (Edin), FRCPath. The Netherlands Mr Taoufik Zeribi Eng BSc, MSc. Tunisia Editors Fiona Curlet, Eva Abdin, Alison Bichard, Guy Penet Graphics Suhaib Al Asbahi, Hany Mahrous, Diana Tawadros Administration Nadia Abu-Saleh, Yasmine El Sakhawy Book 17-6.indb 4 6/6/2011 9:44:44 AM طسوتلما قشرل ةيحصلا ةلجلما شرع عباسلا دلجلما سداسلا ددعلا 467 ررحلما نم ةلاسر Letter from the Editor June 14 is the day chosen by the World Health Organization (WHO) to observe World Blood Donor Day. On this day we honour those who regularly give blood, most often voluntarily and without remuneration, in order to save the lives of others, usually strangers. According to 2008 figures, 62 countries reported collecting 100% of their blood supplies from voluntary, unpaid donors.  The theme for World Blood Donor Day 2011 is “More blood. More life.” This theme reinforces the urgent need for more people  all over the world to become life-savers by volunteering to donate blood regularly. It is vital that blood banks keep reserves of whole blood of each type to deal with disasters, emergencies and accidents. It is also important to retain a supply of blood-derived products such as red blood cells, plasma or platelets. Throughout the world, the aim of national and international regulatory authorities and transfusion services is to ensure that only those products of demonstrated quality, safety and efficacy are used. Many countries, however, still have significant difficulties in achieving this aim. This is particularly the case in developing countries, where, while there is a constant requirement for blood prod- ucts, there may be limited funding for quality control. WHO provides technical guidance and quality assurance tools to regulatory authorities, national control laboratories and manufacturers to support the implementation of quality and safety systems for the production and control of blood products worldwide. In this issue of EMHJ, a report from the Islamic Republic of Iran highlights a related social predicament. When litigation ensues fol- lowing transfusion-related virus infection, for example HIV or hepatitis C virus, not only the recipients of the contaminated blood product suffer: the consequences can indirectly affect the whole population. According to the circumstances described in this report, the decision of the court resulted in disproportionate amounts of the health budget (to cover compensation and treatment costs) being diverted to a small proportion of the population; consequently, other sectors of the health care service were left in deficit. This is a dilemma national health services have to take into account. It is also a compelling argument for maintaining an effective quality control system in the blood transfusion service. لك نم مويلا اذه يفف .مدلاب ينعبرتملل يلماعلا مويلاب ءافتحلال ةيلماعلا ةحصلا ةمظنم رايتخا هيلع عقو يذلا مويلا وه وينوي/ناريزح نم نوشرعلاو عبارلا يرشتو .منهوفرعي لا ،نيرخآ ٍسانُأ حاورأ ذاقنإ لجأ نم ،لباقم لابو ةيعاوط ،ةمظتنم تاترف في مهئامدب عبرتلا لىع نوصريح نيذلا كئلوأ ةمظنلما م ِّركت ،ماع .لباقم نود ينعوطتم ينعبرتم نم ٌةي ِّتأتم ،اهُعجم نكمأ يتلا مدلا تادادمإ نم ةئلماب ةئم نأ تغلبأ دق نادلبلا نم ينتسو يننثا نأ لىإ 2008 ماع ماقرأ نم ديزم مماضنا لىإ ة َّحللما ةجالحا ززعي عوضولما اذهف ؛»حاورلأا نم ًاديزم ذقني ،مدلاب عبرتلا نم ديزم« وه 2011 ماعل مدلاب ينعبرتملل يلماعلا مويلا عوضومو مدلا نم يطايتحا نوزخمب مدلا كونب ظفتتح نأ ناكمب ةيهملأا نمف .ماظتناب مدلاب عبرتلل عوطتلا للاخ نم ،حاورلأا يذقنم لىإ لماعلا ءاحنأ عيجم في دارفلأا تاجتنلما نم تادادمإب ظافتحلاا ًاضيأ مهلما نمو .ثداولحاو ةئراطلا تلاالحاو ثراوكلا تاقوأ عم لماعتلا نم اهن ِّكمي ماب ،ةيومد ةليصف لك نم لماكلا .ةيومدلا تاحْيَفصلاو امزلابلاو ءارملحا مدلا تايرك لثم ،مدلا نم ةقتشلما مدلا تاجتنم مادختسا لىع راصتقلاا نماض وه ،لماعلا ءاحنأ ىتش في ،ةيلودلاو ةينطولا مدلا لقن ةزهجأو ةيميظنتلا تاطلسلا هيلإ ىعست يذلا فدلها نإ لالحا وه اذهو .فدلها اذه اهغولب نود لوتح ةيقيقح تابوعص نم نياعي نادلبلا نم ديدعلا لازي لاف ،كلذ مغربو .ةققحلما ةيلاعفلاو ةينومألماو ةدولجا تاذ في ةمظنلما موقتو .ًادودمح ةدولجا ةبقارلم حاتلما ليومتلا نْوَك عم ،مدلا تاجتنم لىع بلطلا ابه لصاوتي ٌنادلب يهو ،ةيمانلا نادلبلا في صوصلخا هجو لىع ةدولجاب فصَّتت مُظُن ذيفنت معدل ،ينعِّنصلماو ةينطولا ةبقارلما تامدخو ةيميظنتلا تاطلسلا لىإ ةدولجا نماض لئاسوو ةَّينقتلا تاداشرلإا ميدقتب ددصلا اذه .لماعلا ءاحنأ فلتمخ في مدلا تاجتنم ةبقارمو جاتنلإ ةينومألماو متي امدنعف .قايسلا اذبه طبترت ةيعماتجا ةلضعم لىع َءوضلا يقلُي ةيملاسلإا ةيناريلإا ةيروهملجا نم ٌريرقت ،طسوتلما قشرل ةيحصلا ةلجلما نم ددعلا اذه فيو صرتقت لا ةاناعلما نإف ،»سي« يدبكلا باهتللاا وأ بستكلما يعانلما زَوَعلا سويرف لثم ،مدلل لقن ةيلمعب ةطبترم ةيسويرف ةباصإ بقع ءاضقلا لىإ ءوجللا ،ريرقتلا اذه في ًلايصفت ةروكذلما تاسبلاملل ًاقفوف .ناكسلا مومع لىع شرابم يرغ ًايرثأت رثؤت دق رملأا اذه تاعبت نإ لب ،ث َّوللما مدلا ى َّقلت نم لىع ذئنيح تلظ ،لياتلابو .ةيرغص ةيناكس ةئف لىإ اههيجوت متو )ةلجاعلماو ضيوعتلا فيلاكت ةيطغتل( ةيحصلا ةينازيلما عم بسانتت لا غلابم دادس ةمكحلما رارق لىع َبَّترت .نابسلحا في ةينطولا ةيحصلا ةزهجلأا هذخأت نأ بيج ًاقزأم لثمي يذلا رملأا وهو ؛ةينازيلما في زجعلا نم نياعت ةيحصلا ةياعرلا ةئيه نم ىرخأ تاعاطق .مدلا لقن ةئيه في ةدولجا ةبقارلم لاّعف ماظن دوجو لىع ظافحلل ةغماد ةجح رملأا اذه لّثمي ماك Book 17-6.indb 467 6/6/2011 9:44:44 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 468 Climate change and predicted trend of fungal keratitis in Egypt A. Saad-Hussein,1 H.M. El-Mofty 2 and M.A. Hassanien 3 ABSTRACT Rising rates of invasive fungal infections may be linked to global climate change. A study was made of the trend of ophthalmic fungal corneal keratitis in the greater Cairo area of Egypt and its association with climate records during the same period. Data on diagnosed cases of fungal keratitis were collected from records of ophthalmic departments of Cairo University hospital and atmospheric temperature and humidity for the greater Cairo area were obtained from online records. Statistical analysis showed a significant increase in the relative frequency of keratomycosis during 1997–2007. The rise correlated significantly with rises in minimum temperature and the maximum atmospheric humidity in the greater Cairo area over the same period (after exclusion of the effect of the maximum atmospheric temperature). The predicted increase in keratomycosis up to the year 2030 corresponds to predicted increases in CO2 emissions and surface temperature from climate change models for Egypt. 1Department of Environmental and Occupational Medicine; 3Department of Air Pollution Research, Division of Environmental Research, National Research Centre, Cairo, Egypt (Correspondence to A. Saad-Hussein: amel_h@hotmail.com). 2Department of Ophthalmology, Faculty of Medicine, University of Cairo, Cairo, Egypt. Received: 08/09/09; accepted: 10/12/09 صرم في تايرطفلاب ةينرقلا باهتللا عقوتلما هاتجلااو يخانلما يرغتلا يننسح دوممح ،يتفلما ةلاه ،ينسح دعس لمأ ةينرقلا باهتلا هاتجا ديدحتل ةساردلا هذه تيرجأ دقو .يلماعلا خانلما ُّريرغتب ةَيِزَتْغُمـلا تايرطُفلاب ىودعلا تلادعم عافترا طبتري نأ نكمي :ةصلالخا باهتلا انهأ لىع ةّص َّخَشُلما تلاالحاب ةصالخا تايطعلما تعُجم دقو .ةترفلا سفنل ةيخانلما تلاجسلاب هطابتراو ،صرم في ىبركلا ةرهاقلا في تايرطفلاب ةرهاقلل ةبوطرلاو يولجا فلاغلا ةرارح تاجرد تعجمو ،ةرهاقلا ةعماج ىفشتسم في )نويعلا بط( دمرلا ماسقأ تلاجس نم تايرطفلاب ةينرق في تايرطفلاب ةينرقلا ىودعب يبسنلا رُتاوتلا في ابه دتعي ةدايز كانه نأ يئاصحلإا ليلحتلا رهظأ دقو .تنترنلإا لىع ةنودلما تلاجسلا نم ىبركلا فلاغلا ةبوطرل ىوتسم صىقأ عمو ،ىرغصلا ةرارلحا تاجرد في تادايزلا عم ًايئاصحإ هب ُّردتعُي وحن لىع ةدايزلا هذه تطبتراو .2007-1997 ماوعلأا ةدايزلا بسانتت نأ نوثحابلا عقوتيو .)يولجا فلاغلل ىوصقلا ةرارلحا تاجرد يرثأت داعبتسا دعب كلذو( ةترفلا سفن في ىبركلا ةرهاقلا في يولجا حطس لىع ةرارلحا ةجردو نوبركلا ديسكأ يئانث زاغ ثاعبنلا ةعقوتلما تادايزلا عم 2030 ماع ىتح تايرطفلاب ةينرقلا ىودع تلااح في ةعقوتلما .صرلم يخانلما يرغتلا جذمان نم ةذوخألما ضرلأا Changement climatique et prévision des tendances pour la kératite mycosique en Égypte RÉSUMÉ Les taux croissants des mycoses invasives pourraient être liés au changement climatique dans le monde. Une étude a été réalisée sur la tendance des kératites mycosiques dans le Grand Caire (Égypte) et sur son association avec les relevés des données climatologiques pendant la même période. Les données provenant des cas diagnostiqués de kératite mycosique ont été recueillies à partir des dossiers médicaux des services d’ophtalmologie de l’hôpital universitaire du Caire, alors que la température atmosphérique et les taux d’humidité pour le Grand Caire ont été obtenus à partir des archives en ligne. Une analyse statistique a révélé une augmentation significative de la fréquence relative des cas de kératomycose entre 1997 et 2007. Cette augmentation était fortement corrélée aux élévations de la température et au taux maximum d’humidité atmosphérique dans le Grand Caire pendant la même période (après avoir exclu l’effet de la température atmosphérique maximale). Les prévisions d’une augmentation des cas de kératomycose jusqu’en 2030 correspondent aux prévisions d’élévation des émissions de CO2 et de la température en surface selon les modèles de prévision du changement climatique pour l’Égypte. Book 17-6.indb 468 6/6/2011 9:44:44 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 469 Introduction Recent increases in the average temper- ature of the atmosphere near the earth’s surface and in the troposphere are be- lieved to contribute to changes in global climate patterns  [1–4]. The warming  that may be occurring as a result of in- creased emissions of greenhouse gases from human activities  [1]  is predicted  to increase the average surface tempera- ture of the earth by 1.4 °C to 5.8 °C by the end of  the 21st century  relative  to  1990 [2]. It is widely recognized that cli- mate change, by altering local weather patterns and by disturbing the ecology of regions, has significant implications for human health [5]. Secondary health  effects of climate change have already been observed, including bacterial and fungal proliferation [6]. A  longitudinal  dermatological study in The Gambia was carried out to determine the effect of seasonal change on the prevalence of fungal skin infection. The greatest effect of climatic change was on the preva- lence of dermatomycoses in children under 10 years old [6]. Fungal keratitis (keratomycosis) is a major causes of infectious keratitis in tropical parts of  the world [7]. Corneal  ulcer has been called the silent epidemic cause of corneal blindness in the devel- oping world. Every year in the develop- ing countries,  there are 1.5  to 2 million  new cases, with a high frequency of fungal disease [8]. Because of the poten- tial for permanent impairment of vision or perforation of the eye, corneal ulcer is considered an ophthalmic emergency. In Egypt, the relatively high inci- dence of keratomycosis is due to the agricultural environment and a tem- perature which favours the abundance of fungi; misdiagnosis or delayed pres- entation  aggravate  the  problem  [9].  During  the  last  10  years  an  increase  has been observed in the number of fungal corneal infection cases in out- patient clinics as well as inpatients of general ophthalmic hospitals in Egypt (El-Mofety, unpublished data). Using a local modification of the Regional Air Pollution Information and Simula- tion (RAINS) model, Hassanien has shown increases in CO 2 emissions over the same period in Egypt, which are predicted to rise up the year 2030 [10]  (Figure 1). Projected increases in an- nual temperature in Egypt using the General Circulation Model are 1 °C [standard deviation (SD) 0.15  °C] by  the year 2030 and 1.4 °C (SD 0.22 °C)  by 2050 [11].  The aim of the current study was to study the trend of ophthalmic fungal corneal keratitis in the greater Cairo area of Egypt over the period 1997–2007 to  evaluate its association with tempera- ture and humidity during this period and to predict the future trend up to the year 2030. Methods Climate study Climate data in the form of annual aver- age, maximum and minimum tempera- ture and humidity records for Cairo, Egypt during the period of the study (1997–2007) were extracted  from the  website: http://arabic.wunderground. com/global/stations/62366.html. The data for this period was confirmed from the records of the Egyptian Meteoro- logical Authority and from 1997 by the weather instruments of the Department of Air Pollution at the National Research Centre. Ophthalmic study The clinical study was conducted in Cairo University hospitals. All patients admitted to the hospital during the period of the study with clinical signs of fungal keratitis or corneal abscess that proved to be fungal by laboratory inves- tigation (culture and sensitivity) were selected. The exclusion criteria were patients with a non-infective keratitis, e.g. autoimmune ulcers or other causes of infectious keratitis. Outpatients were not included. All the participants were asked to complete a medical history questionnaire to exclude a history of ocular trauma or contact lens wear. Full ophthalmologic examination was done for all the included patients. The assessment included visual acuity, Figure 1 Predicted emissions of carbon dioxide (CO2) in Egypt 1990–2030 and data from the Regional Air Pollution Information and Simulation (RAINS) model. Source: Hassanien [10] Book 17-6.indb 469 6/6/2011 9:44:45 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 470 slitlamp examination to evaluate the extent and depth of the corneal ulcer and or abscess and the clinical charac- teristics of the lesion. Evaluation of the anterior segment including the ante- rior chamber of the eye for presence of hypopyon with iritis was also done. Special investigations were carried out by ultrasound to evaluate the poste- rior segment if it could not be seen by ophthalmoscope. Culture and sensitiv- ity were done to identify the infecting organism if possible. Statistical analysis The data were revised and filtered; all patients with incomplete records or not fully diagnosed were excluded from the final statistical analysis. Relative frequen- cy (RF) of the recorded fungal infected cases to total recorded ophthalmic cases admitted to the ophthalmic department, regardless of cause of admission, was calculated as a percentage for each year. Statistical analysis of the collected data was done using SPSS, version 14.0. Pear- son correlation coefficient, backwards and stepwise linear regression models were used. The significance level was considered at P-value < 0.05. Results Figure 2a  illustrates  the  linear  regres- sion of the RF of fungal keratitis with time during the period of the study (1997–2007). The RF of fungal kerati- tis increased steadily from 2.5% in 1997  to 6.2%  in 2007. The R2  value  (0.72)  showed a positive linear relationship be- tween RF and time in years (P < 0.001).  The rates of each of the 2 forms of fungal  keratitis were also significantly positive correlated with time: r = 0.90 for abscess  and r = 0.48 for ulcer (Figure 2b). Table 1 illustrates the backward lin- ear regression model between the RF of fungal keratitis and time over the study period 1997–2007 and the temperature  and humidity. Model 1 showed that there were significant relationships between RF and both time and minimum at- mospheric temperature throughout the period of  the study. Model 2, after  exclusion of the effect of the maximum atmospheric temperature, showed sig- nificant relationships between RF and time, minimum temperature and maxi- mum atmospheric humidity. Figure 2 Trend of relative frequency (RF) of diagnosed cases of fungal abscess and ulcer in Egypt during 1997–2007: (a) for all cases; (b) for abscesses and ulcers Figure 2 (a) Figure 2 (b) Book 17-6.indb 470 6/6/2011 9:44:45 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 471 For prediction of the trend of RF of fungal keratitis, stepwise linear regres- sion was done to exclude the confound- ing effects of atmospheric temperature and  humidity  (Table  2). The  stand- ardized beta coefficient of the relation between the RF of fungal keratitis with the years was 0.38 after exclusion of the  maximum and minimum temperature and the maximum and minimum hu- midity from the relationship. Figure 3 also shows a significant increase in the predicted RF of fungal keratitis in the greater Cairo area up to the year 2030. The rate  is predicted  to  rise from 6.7% in 2010 to 12.4% by the  year 2025 and 14.2% by the year 2030. Discussion Scarring of the cornea as a result of suppurative keratitis is an important preventable cause of blindness. In some developing countries, corneal infections are the second commonest cause of blindness after unoperated cataract [12].  Ulcerative keratitis due to infection with a wide range of organisms has been reported, e.g. viruses, bacteria, fungi or protozoa. There are also regional varia- tions in the predominance of different microbes, reflecting different patient populations and climate effects. In tropi- cal regions of the world fungal keratitis is a common and important cause of corneal morbidity [13]. The present results revealed that the RF of fungal corneal infection a referral hospital in Cairo increased significantly during  the 10-year period of  the study  (1997–2007). This  increase  in RF of  fungal keratitis was significantly cor- related with the increase in the average atmospheric minimum temperature in the same area (greater Cairo) over the same period, but was significantly inversely correlated with maximum humidity throughout the study period. The rate of fungal abscess seemed to be increasing at a faster rate than the ulcer forms of keratitis. However, our study recorded inpatient cases only and corneal abscesses cases are more likely to be admitted for fear of globe perfora- tion or endophthalmitis. Corneal ulcers cases are more likely to be managed on an outpatient basis, unless the patient is monocular or referred from a geograph- ically distant centre or if a complicated ulcer is present. Our results agree with the results of Baharathi et al., who evaluated the influence of climate and geographical variations in microbial keratitis in south India [13]. Their retrospective study of  clinically diagnosed microbial keratitis evaluated a  total of 3183 cases, 34.4%  of which proved to be of fungal origin. The incidence of fungal keratitis was higher between June and September. They concluded that a hot and windy climate makes fungal keratitis more frequent  in  tropical  zones  [13]. The  results of our study were also similar to study in Nigeria, which experiences a climate similar to that of South India. They reported a higher incidence of fungal keratitis during hot and humid seasons [14]. Also, in Hyderabad, India, Gopinathan et al. concluded that fungal keratitis was more frequent due to the hot and humid windy climate in this tropical zone and the agriculture-based occupation of the population [15]. We suggest that due to the increas- ing the population in Egypt and the rising RF of fungal keratitis found in the present study, fungal infections will become an increasing health problem in the country. Heightened awareness of the problem among ophthalmologists Table 1 Backward linear regression of the relative frequency (RF) of diagnosed cases of fungal keratitis with time, atmospheric temperature and humidity Coefficient model Standardized beta coefficient t-value P-value Model 1 Years 0.86 3.593 0.016 Temperature (maximum) 0.22 0.769 0.477 Temperature (minimum) 1.15 2.684 0.044 Humidity (maximum) –0.62 –2.064 0.094 Humidity (minimum) 0.67 1.785 0.134 Model 2 a Years 0.71 5.144 0.003 Temperature (minimum) 0.90 3.339 0.002 Humidity (maximum) –0.44 –2.484 0.016 Humidity (minimum) 0.44 1.977 0.095 aExcluding the effect of the maximum atmospheric temperature. NS = not significant. Table 2 Stepwise linear regression of relative frequency (RF) of fungal keratitis with time after exclusion of confounding effects of atmospheric temperature and humidity Coefficient model Standardized beta coefficient t-value P-value Constant –747.942 –4.779 < 0.001 Years 0.38 4.803 < 0.001 Excluded variables Temperature (maximum) –0.22 –0.976 0.358 Temperature (minimum) –0.32 –1.855 0.101 Humidity (maximum) –0.01 –0.047 0.964 Humidity (minimum) –0.15 –0.736 0.483 Book 17-6.indb 471 6/6/2011 9:44:45 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 472 and medical microbiologists may have contributed to the increasing rec- ognition  of  the  disease  [16].  Fungal  infections are a major problem for im- munocompromised persons, includ- ing HIV patients and people receiving chemotherapy for cancer or patients treated with  corticosteroids  [17,18].  The climate changes noted here sug- gest that fungal growth may become more frequent in domestic and indus- trial buildings in Egypt, as indicated by increases in the RF of fungal keratitis in the present study and increases in the mould concentrations in the houses of asthmatic children in Cairo [Saad- Hussein. unpublished data]. Mycotox- ins may act as immunosuppressants and may be associated with an increase in the prevalence of repeated infections among the inhabitants of buildings with moisture problems [19,20]. Whether fungal infection is ac- quired through contaminated water or through airborne spores is a matter of much debate  [21]. Bioaerosols  are  defined as airborne particles consist- ing of microorganisms (bacteria, vi- ruses, moulds) or metabolites, toxins or fragments from microorganisms. In conditions of higher humidity, higher bioaerosol levels can prevail. Airborne fungal cells can remain viable for much longer periods, even at low relative hu- midity and high or low temperature extremes. The extent of the transport of airborne particulate depends on the sur- face temperature, air temperature, and wind speed, all of which are predicted to change as a result of climate change [21]. Several  studies have  shown  that  under drier conditions, bioaerosols such as fungal spores and endotoxins are likely to be more problematic [22].  This explains our results, as after exclud- ing the confounding impact of the at- mospheric maximum temperature, the significant increase in the RF of fungal infections was shown to be significantly related to the increase in the atmos- pheric minimum temperature and to the decrease in the maximum humid- ity. On application of a stepwise linear regression model in the current study, the RF of fungal keratitis was predicted to double  from 6.2%  in  the year 2007  to 12.4%  in  the year 2025. By  the year  2030, it was expected to be 14.2%. There are some limitations to our study. Although it was conducted in one of the largest referral hospitals in Cairo, our sample represented only a small proportion of the Egyptian population and the rate of fungal corneal infection recorded may therefore be over- or underestimated. Thus, we used the RF of fungal corneal infections as a proxy for the incidence of infections. We also ensured that the recorded atmospheric temperature and humidity during the period of study covered only the same area of Greater Cairo. In conclusion, climate change can- not be neglected as a potential risk fac- tor for the increase in the RF of fungal keratitis in our referral hospital during the period of this study. Further large- scale and national studies to find out the actual incidence of the problem in Egypt and correlate it with climate changes are recommended. Enhanced surveillance and reporting of fungal keratitis will be critical to improve our understanding of the importance of invasive fungal infec- tions, to enable prioritization of research and prevention efforts and to evaluate prevention strategies. Figure 3 Predicted relative frequency (RF) of diagnosed cases of fungal keratitis in Egypt up to the year 2030 Book 17-6.indb 472 6/6/2011 9:44:45 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 473 References Houghton JT, Callander BA, Varney SK, eds. 1. Intergovernmental Panel on Climate Change. Climate change 1992. The supplemen- tary report to the IPCC scientific assessment. Cambridge, Cam- bridge University Press, 1992. National Research Council. 2. Climate change science: an analysis of some key questions. Washington DC, National Academy Press, 2001. National Research Council. 3. Surface temperature reconstructions for the last 2000 years. Washington DC, National Academy Press, 2006. Temperature trends in the lower atmosphere: steps for under-4. standing and reconciling differences. A report by the Climate Change Science Program and the Subcommittee on Global Change Research. Washington DC, Intergovernmental Panel on Climate Change, 2006. Ezzati M et al.; Comparative Risk Assessment Collaborating 5. Group. Selected major risk factors and global and regional burden of disease. Lancet, 2002, 360:1347–1360. Porter MJ. Seasonal change and its effect on the prevalence 6. of infectious skin disease in a Gambian village. Transactions of the Royal Society of Tropical Medicine and Hygiene, 1980, 74:162–168. Agrawal V et al. Current perspectives in infectious keratitis. 7. Indian Journal of Ophthalmology, 1994, 42:171–192. Whitcher JP, Srinivasan M. Corneal ulceration in the develop-8. ing world–a silent epidemic. British Journal of Ophthalmology, 1997, 81:622–623. Al-Hussaini AK, El-Said I, El-Shanwany AR. Topical clotrima-9. zole for the treatment of fungal keratitis in humans. Bulletin of the Ophthalmological Society of Egypt, 1997, 90:813. Hassanien MA. 10. An initial implementation of the RAINS model to assess emission of air pollutants in Egypt. Interim report IR-03- 045. Laxenburg, Austria, International Institute for Applied Systems Analysis, 2003. Agrawala S et al. 11. Development and climate change in Egypt: focus on coastal resources and the Nile. Paris, Organisation for Economic Co-operation and Development, 2004. Leck AK et al. Aetiology of suppurative corneal ulcers in Ghana 12. and south India, and epidemiology of fungal keratitis. British Journal of Ophthalmology, 2002, 86:1211–1215. Bharathi MJ et al. Microbial keratitis in South India: influence 13. of risk factors, climate, and geographical variation. Ophthalmic Epidemiology, 2007, 14:61–69. Gugani HC, Tawlar RS, Njoku OBI. Mycotic keratitis in Nigeria. 14. A study of 21cases. British Journal of Ophthalmology, 1995, 79:1024–1028. Gopinathan U et al. The epidemiological features and labora-15. tory results of fungal keratitis: a 10-year review at a referral eye care center in South India. Cornea, 2002, 21:555–559. Anuradha C, Kirti S. Spectrum of fungal keratitis in north India. 16. Cornea, 2005, 24(1):8–15. Mahoney DP, Spear JE. 17. Health hazards of mold: risk assessment and remediation. Personal safety. Des Plaines, Illinois, American Society of Safety Engineers, 2003. Warnock DW. Trends in the epidemiology of invasive fungal 18. infections. Nippon Ishinkin Gakkai Zasshi, 2007, 48:1–12. Leino M et al. Intranasal exposure to a damp building mould, 19. Stachybotrys chartarum, induces lung inflammation in mice by satratoxin-independent mechanisms. Clinical and Experimen- tal Allergy, 2003, 33:1603–1610. Reijula K, Tuomi T. Mycotoxins of aspergilli: exposure and 20. health effects. Frontiers in Bioscience, 2003, 8:s232–s235. Boxall ABA et al. Impacts of climate change on indirect human 21. exposure to pathogens and chemicals from agriculture. Envi- ronmental Health Perspectives, 2009, 117:508–514. Pillai SD, Ricke SC. Bioaerosols from municipal and animal 22. wastes: background and contemporary issues. Canadian Jour- nal of Microbiology, 2002, 48:681–696. Book 17-6.indb 473 6/6/2011 9:44:46 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 474 Hepatitis B virus infection among staff in three hospitals in Khartoum, Sudan, 2006–07 A.H. Elduma1 and N.S. Saeed1 ABSTRACT This study was conducted to determine the seropositivity of hepatitis B infection, associated risk factors and history of vaccination among staff in 3 teaching hospitals in Khartoum. The study was carried out from March 2006 to March 2007. Participants comprised 245 randomly selected hospital staff; 12 (4.9%) reacted positively for HBsAg, 6 of whom were nurses, 4 domestic staff and 2 laboratory staff. Only 37 participants (15.1%) said that they had attended training courses in biosafety. Just over 50% indicated that they had had needle-stick or sharps injuries during work; 61 (24.9%) indicated that they always followed the bio-safety precautions, 52 (21.4%) said that they always wore gloves during their work while 43 (17.6%) said they never wore them. Only 11 (4.5%) of the participants had received the full vaccination dose for hepatitis B. 1Directorate of Laboratories and Medical Researches, Ministry of Health, Khartoum, Sudan (Correspondence to A.H. Elduma: dumanet@yahoo.com). Received: 10/10/09; accepted: 11/11/09 2007-2006 ،نادوسلاب موطرلخا ةنيدم في تايفشتسم ةثلاث في ةيحصلا ةياعرلا في ينلماعلا ينب »بي« يدبكلا باهتللاا ديعس نمايلس بيجن ،ةمودلا ينسح لداع ينب ميعطتلا قباوسو ،ةلصلا تاذ راطتخلاا لماوعو ،»بي« يدبكلا باهتللاا ىودعل ةيجولويرسلا ةيبايجلإا ديدحتل ةساردلا هذه تيرجأ :ةصلالخا تلمشو .2007 سرام/راذآو 2006 سرام/راذآ ْيَرهش ينب كلذو ،موطرلخا ةنيدم في ةيميلعت تايفشتسم ةثلاث في ةيحصلا ةياعرلا في ينلماعلا ةتسو ،»بي« يدبكلا باهتللاا سويرفل يحطسلا دضتسملل ينيبايجإ )%4.9( مهنم 12 ناكو ؛ًايئاوشع اويرتخا ةيحصلا ةياعرلا في ًلاماع 245 ةساردلا )%15.1( طقف ًلاماع نوثلاثو ةعبس ركذو .برتخلما في ينلماعلا نم مهنم نانثاو ،فرغلا ةمدخ في ينلماعلا نم ٌةعبرأو ،ضيرمتلا في ينلماعلا نم مهنم ةدالحا تلالآا وأ ربلإا زخو ليبق نم تاباصإ لىإ اوضرعت منهأ لىإ %50 نم رثكأ راشأو .ةيجولويبلا ةملاسلاب ةصاخ ةيبيردت تارود اوضرح منهأ نودتري منهإ )%21.4( نوسخمو نانثا لاقو ،ةيجولويبلا ةملاسلا تاطايتحا رارمتساب نوعبتي منهأ لىإ )%24.9( مهنم نوتسو دحاو راشأو ؛لمعلا ءانثأ طقف مهنم ًاصخش شرع دحأ ىقلت دقو .قلاطلإا لىع تازافقلا اودتري لم منهأ )%17.6( مهنم نوعبرأو ةثلاث َرَكَذ مانيب ،لمعلا ءانثأ تازافقلا رارمتساب .»بي« دبكلا باهتللا داضلما حاقللا نم ةلمتكم ةعرج )%4.5( Infection par le virus de l’hépatite B chez les agents de santé de trois hôpitaux à Khartoum (Soudan) entre 2006 et 2007 RÉSUMÉ La présente étude a été conduite pour déterminer la séropositivité pour l’infection par le virus de l’hépatite B dans le personnel de trois hôpitaux universitaires de la ville de Khartoum, les facteurs de risques associés en la matière et leurs antécédents vaccinaux. L’étude a été réalisée de mars 2006 à mars 2007. Les participants comptaient 245 personnels hospitaliers sélectionnés de façon aléatoire ; sur douze cas positifs (4,9 %) pour l’AgHBs, six faisaient partie du personnel infirmier, deux du personnel de laboratoire et quatre étaient des agents d’entretien. Seuls 37 participants (15,1 %) ont déclaré avoir participé à des cours de formation sur la sécurité biologique. À peine plus de 50 % des répondants ont indiqué avoir été blessés par piqûre d’aiguille ou objet tranchant pendant leur travail ; 61 (24,9 %) ont précisé qu’ils prenaient toujours les précautions de sécurité biologique, 52 (21,4 %) déclaraient toujours porter des gants au travail, alors que 43 agents (17,6 %) affirmaient ne jamais en porter. Seuls onze participants (4,5 %) avaient reçu les doses complètes de vaccin contre l’hépatite B. Book 17-6.indb 474 6/6/2011 9:44:46 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 475 Introduction Hepatitis B virus (HBV) is a causative agent of hepatitis infection, which is asymptomatic in most individuals, but it can show features of fulminant, acute, or chronic hepatitis. The acute type pro- duces serious illness and approximately 0.5% of cases are fatal. Chronic infection  is often lifelong, and can lead to liver fail- ure and hepatocellular carcinoma [1]. Transmission of HBV is through the parenteral route, blood transfusion products and sexual intercourse and vertically from infected mothers to ne- onates. The virus is found in body fluids such as urine, saliva, nasopharyngeal fluids, semen and menstrual fluids, and can be transmitted through contact with these fluids [2].  Hepatitis B virus is the most com- monly transmitted bloodborne virus in the health-care setting. Transmission generally occurs from patient to patient or from patients to health-care person- nel via contaminated instruments or accidental needle-stick or sharps in- juries. The virus can be transmitted directly through body fluids to mucous membranes, cutaneous scratches, abra- sions, burns or other lesions. Indirect transmission can occur from surfaces contaminated with blood or body fluids to mucous membranes. HBV has been shown to survive in dried blood on sur- faces at room temperature for at least a week [3]. The risk of HBV  infection  among health-care workers is 3–5 times  higher than in the general population: in particular, surgeons, pathologists, physicians, laboratory staff, domestic staff and nurses have the highest risk of infection  [4]. Research findings have  indicated that 10%–30% of health- care  workers show serologic evidence of past or present HBV infection [5]. Hepatitis B virus infection is com- mon in Sudan in all age groups. In a seroprevalence study carried out in Juba, Southern Sudan, in 1993 on 666 patients attending  Juba Hospital, 26%  were HBsAg positive  [6].  In  another  study among soldiers in 5 urban locali- ties, 78% had evidence of past infection  [7].  In  a  study  conducted  in  eastern  Sudan on people in high-risk groups (prostitutes, long distance truck drivers and soldiers), positivity for HBsAg was 14% [8]. The epidemiology of hepatitis  B was also studied in central Sudan, Gezira area, where HBsAg positivity was 14% [9].  In a  study conducted  in  Omdurman among adults with acute hepatitis,  HBV  infection  was  12.6%  [10].  Similarly,  12.4% of  patients  at- tending a surgical unit were positive for HBsAg [11]. Sudan is considered highly  endemic for HBsAg, with prevalence about 16%–20% in the general popula- tion [12].  As there are no recent and accurate data available in Sudan regarding infec- tion with HBV in healthcare workers. This study was conducted to determine the prevalence of infection among healthcare personnel from what are considered high risk groups working in Khartoum teaching hospitals. In addi- tion, risk factors associated with infec- tion were also studied and the status of hepatitis B vaccination and health-care workers who need to be vaccinated were determined. Methods This study was conducted between March 2006 and March 2007. Three  public hospitals were selected to par- ticipate in this cross-sectional survey to collect data from personnel, Omdur- man, Khartoum and Khartoum North hospitals. Health-care staff (surgeons, nurses, domestic staff, laboratory staff, and dentists) working in these hospi- tals were selected to participate in the study. Sample  size was  calculated at 245  according to the following equation: N = z²pq/d² Where z = 1.96, p = 0.2, q = 0.8, and  d = 0.05. A stratified, simple, random sam- pling technique was used in selection of the study sample. The number of partici- pants from any hospital was determined according to their proportion from the total number of the study. Participation in the study was voluntary, so when a randomly selected participant refused to participate, he/she was substituted by another participant from the list. There were 15 refusals to participate. Person- nel working in the 3 selected hospitals who had a close contact with risk factors of HBV infection were included in this study. Personnel working in administra- tive positions were excluded. The questionnaire used to collect data from study participants was de- signed by the authors. It comprised 3 parts: the first covered basic informa- tion such as age, sex, occupation, work- ing hours per day, etc; the second part covered risk factors for HBV infections and the last part covered the result of HBV infection. Informed consent was obtained from each participant after explaining the objective of the study, why these groups were selected to participate and that participation was voluntary. We also explained the methods used in di- agnosis and informed the participants that any identifying information would not be disclosed in any report or pub- lication. SPSS was used to analyse the data. Tables were engendered describing the relationship between infection and risk factors, e.g. unsafe work area and unsafe procedures and practices. Laboratory work We collected 5 mL of venous blood in a Vacutainer tube from each of the participants. Serum was separated and kept at –20 °C until screening.  Enzyme-linked immunosorbent assay (ELISA) commercial kits (Bi- okit, Spain) were used to detect HBV. Serum samples were added and incu- bated for 1 hour. Plates were washed Book 17-6.indb 475 6/6/2011 9:44:46 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 476 with approximately 350 µL of washing  buffer then conjugate (Biokit, Spain) was added and the plate incubated for 30 minutes. This allowed antigen in the  sample to bind with the goat anti-HBs conjugated to peroxidase in order to form antigen–antibody complex. The  plates were washed again to remove unbound materials, substrate added and colour developed in positive plates (control and positive samples). The reaction was stopped by adding sulphu- ric acid. The colour was read as optical density in order to determine the result of the test [13]. Results A  total of 245 health workers partici- pated in this study, 168 (68.6%) females  and 77 (31.4 %) males. They  included  23 surgeons, 37 laboratory staff, 6 den- tists, 73 nurses and 106 domestic staff. Twelve (4.89%) of  the participants  tested positive for hepatitis B surface antigen (HBsAg): 6 nurses, 4 domestic staff and 2  laboratory  staff  (Table 1).  All 6 nurses positive for HBsAg were from Omdurman hospital, which had 7 (5.5%) positive cases, while 1 of  the  laboratory staff was from Khartoum hospital and the other from Khartoum north (Table 1) Only 37 (15.1%) of the participants  said that they had attended a biosafety training course on how to deal with high risk materials. Overall,  125  (51.0%) participants  indicated that they had a history of needle-stick or sharps injuries during their work; 79 of these declared that they had been exposed to needle-sticks more than 1 time while 46 said that they had been exposed only 1 time in their life. Regarding the application of biosafety precautions (disinfectant spills, wearing protective clothing etc.) during their work, 61  (24.9%)  indicated  that  they  always followed the precautions, and 150 (61.2%) indicated that they some- times applied the precautions. The remaining 34 (13.9%) said that they did  not follow the biosafety precautions. Only 52 (21.4%) of the study sam- ple, including 7 of the 23 surgeons, said  that they always wore gloves during their work  (Table  2). Decontamina- tion of equipment and area of work before and after the work was always carried out by 56 (22.9%) of  the study  participants while 35 (14.2%) said they  did not comply with the precautions at all (Table 2).  Only 11 participants had had the full dose of the hepatitis B vaccination (Table 3). The vast majority, 93.1%, had  no history of vaccination. Discussion Previous findings have indicated that the positivity for HBsAg in Sudan is 16%–20% [12].  In  this  study,  among  245 participants selected from 3 hospi- tals, 12 (4.9%) tested positive.  Participation of healthcare workers varied according to occupation, but the participation of surgeons was low in Khartoum and Omdurman hospitals. The main reason in Khartoum hospital was that the authority refused to allow staff to participate in this study; they stated that they had already started testing doctors for HBV and did not want to repeat the issue. In Omdurman hospital, in contrast, the surgeons them- selves refused to take part in the study but did not provide any justification or reasons for their refusal. The study findings indicated that surgeons were more committed than other categories to a policy of vaccina- tion. Infection with hepatitis B virus was highest in nurses, and they had a very low vaccination uptake (97.2% had not  received any dose of hepatitis B vac- cine). Our findings also indicated that the surveyed hospitals did not have a policy for hepatitis B vaccination. In fact, vaccination for HBV was obtained by the individuals themselves independent of the hospitals. Coverage was very low overall:  only  4.5% of  the  health-care  workers who participated in the study received the full dose. In contrast, 15.8%  of the healthcare workers in an Egyptian study reported receiving the full dose of hepatitis B vaccine [14]. Regarding biosafety precautions, most of the nurses said that they sometimes applied precautions. In a seroprevalence study of viral hepatitis Table 1 Distribution of staff members at 3 hospitals in Khartoum according to occupation, sex and site Variable Hepatitis B +ve (n = 12) Total (n = 245) No. % No % Occupation Dentist 0 0.0 6 2.5 Surgeon 0 0.0 23 9.4 Laboratory staff 2 5.4 37 15.1 Nurse 6 8.2 73 29.8 Domestic staff 4 3.8 106 43.3 Sex Male 5 6.5 77 31.4 Female 7 4.2 168 68.6 Site (hospital) Omdurman 7 5.6 126 51.4 Khartoum North 4 5.0 80 32.7 Khartoum 1 2.6 39 15.9 Book 17-6.indb 476 6/6/2011 9:44:46 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 477 markers in the main hospital in Yemen, health-care workers were tested for HBsAg:  the  rate of  infection was 9.9%  [15].  In another study among hospital  health-care workers in Saudi Arabia, 13% of  the  study  sample  showed pre- vious infection with hepatitis B virus [16].  In  a  separate  study  conducted  among high risk groups in Palestine, the rate of infection among health-care workers was 9.6%  [17].  In  the  above  mentioned studies, the infection rate is high compared with our study. In a study conducted in a services hospital in Lahore, Pakistan, HBsAg positivity was 5%  in health-care workers. This  is  similar  to our findings  [18]. However,  in a study on Moroccan health-care workers,  HBsAg  was  only  1%  [19]  and seroprevalence of HBsAg among health-care workers in a Korean study was 2.4% [20]. In a study to assess occupational exposure to hepatitis infection among Turkish nurses, the positivity rate was 18.7%;  this  is  greater  than  the  8.2%  reported for the nurses in our study [21].  In study conducted to assess knowledge, attitudes and practices of health-care workers regarding needle-stick injuries in Pakistan, 45% of the participants had  had a needle-stick injury in the past. This  is  similar  to our study with 51.0%  of the participants indicating that they had had needle-stick injuries during work [22].  A vaccination policy for HBV should be implemented in health-care work- ers at high risk of contracting hepatitis B virus infection. All precautions and Table 2 Decontamination precautions and wearing gloves during work among staff members at 3 hospitals in Khartoum Variable Use decontamination precautions Wear gloves Total Always Sometimes Never Always Sometimes Never No. % No. % No. % No. % No. % No. % Occupation Surgeon 8 34.8 11 47.8 4 17.4 7 30.4 16 69.6 0 0.0 23 Laboratory staff 13 35.1 18 48.7 6 16.2 18 48.7 17 45.9 2 5.4 37 Dentist 3 50.0 1 16.7 2 33.3 5 83.3 1 16.7 0 0.0 6 Nurse 17 23.3 55 75.3 1 1.4 13 17.8 57 78.1 3 4.1 73 Domestic staff 15 14.2 69 65.1 22 20.7 9 8.5 59 55.7 38 35.8 106 Total 56 22.9 154 62.9 35 14.2 52 21.5 150 61.0 43 17.5 245 Sex Male 24 9.8 44 18.0 9 3.7 19 24.7 47 61.0 11 14.3 77 Female 33 13.5 111 45.3 24 9.8 30 17.9 106 63.1 32 19.0 168 Total 57 23.5 155 63.3 33 13.5 49 20.0 153 62.3 43 17.6 245 Table 3 History of hepatitis B vaccination in staff members at 3 hospitals in Khartoum Variable History of vaccination Total 3 dosesa 2 doses 1 dose Never No. % No. % No. % No. % No. Occupation Surgeon 7 30.5 1 4.3 2 8.7 13 56.5 23 Laboratory staff 1 2.7 1 2.7 1 2.7 34 91.9 37 Dentist 2 33.3 0 0.0 0 0.0 4 66.6 6 Nurse 1 1.4 1 1.4 0 0.0 71 97.2 73 Domestic staff 0 0.0 0 0.0 0 0.0 106 100.0 106 Total 11 4.5 3 1.2 3 1.2 228 93.1 245 Sex Male 4 5.2 0 0.0 1 1.3 72 93.5 77 Female 7 4.2 3 1.8 2 1.2 156 92.8 168 Total 11 4.5 3 1.2 3 1.2 228 93.1 245 aFull dose. Book 17-6.indb 477 6/6/2011 9:44:46 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 478 protection from sharps and needle-stick injuries should be encouraged and en- forced. The health authority in hospitals should adopt a post-exposure testing protocol of the staff at risk of exposure to hepatitis virus. Acknowledgements This study was funded by the World Health Organization Eastern Mediter- ranean Regional Office Research Policy and Cooperation Unit. Our thanks are extended to the Re- search Directorate, Federal Ministry of Health, for their technical support. We are also grateful to Professor Suad Sulaiman for editing and finalizing the manuscript. References Seeger C, Mason WS. Hepatitis B virus biology. 1. Microbiology and Molecular Biology Reviews, 2000, 64(1):51-68. Mahony FJ. Update on diagnosis, management and preven-2. tion of hepatitis B virus infection. Clinical Microbiology Reviews, 1999, 12:351–366. Bond WW et al. Survival of Hepatitis B virus after dry storage for 3. one week. Lancet, 1981, 1:550–551. Mast EE, Alter MJ. Prevalence of hepatitis B virus among health 4. care personnel. In Ellis RW, ed. Hepatitis B vaccine in clinical practice. New York, Marcel Dekker, 1993:295–307. Kunches LM et al. Hepatitis B exposure in emergency medical 5. personnel: prevalence of serologic markers and need for im- munization. American Journal of Medicine 1983, 75:269–272. McCarthey MC et al. Hepatitis B and C serosurvey. 6. Transac- tions of the Royal Society of Tropical medicine & Hygiene, 1994, 88(5):534–536. McCarthey MC et al. HIV-1 and hepatitis B transmission in Su-7. dan. AIDS, 1989, 3:725–729. McCarthey MC et al. Hepatitis B and HIV in Sudan. A serosur-8. vey for Hepatitis B and HIV antibodies among sexually active heterosexuals. American Journal of Tropical Medicine and Hy- giene, 1989, 41(6):721–731. Hyams KC et al. Epidemiology of hepatitis B virus in Gezira re-9. gion Sudan. American Journal of Tropical Medicine and Hygiene, 1989, 40(2):200–206. El Arabi MA et al. Non A–non B hepatitis in Omdurman, Sudan.10. Journal of Medical Virology, 1987, 21:217–222. El Sanousi OM. 11. The risk of HIV and hepatitis B infection to the medical staff during surgery [Thesis No. o/237]. Khartoum, Uni- versity of Khartoum, 1997. Qirbi N, Hal AJ. Epidemiology of hepatitis B virus infection in 12. the Middle East. Eastern Mediterranean Health Journal, 2001, 7(6):1034–1045. Lequin RM. Enzyme immunoassay (EIA)/enzyme-linked immu-13. nosorbent assay (ELISA). Clinical Chemistry, 2005, 51(12):2415– 2418. Talaat M et al. Occupational exposure to needlestick inju-14. ries and hepatitis B vaccination coverage among health care workers in Egypt. American Journal of Infection Control, 2003, 31(8):469–474. Al Huraibi MA et al. Seroprevalence of markers of viral hepa-15. titis in Yemen health care workers. Journal of Medical Virology, 2004, 73(4):562–565. Daw MA et al. Seroepidemiology of hepatitis B virus markers 16. among hospital health care workers. Analysis of certain poten- tial risk factors. Saudi Medical Journal, 2000, 21(12):1157–1160. Jadallah RI et al. Prevalence of hepatitis B virus markers among 17. high risk groups in Palestine. Medical Journal of Islamic World Academy of Sciences, 2005, 15(4):157–160. Rehman K et al. Prevalence of seromarkers of HBV and HCV 18. in health care personnel and apparently healthy blood donors. Journal of the Pakistan Medical Association, 1996, 46(7):152–154 Djeriri K et al. Hepatitis B in Moroccan health care workers. 19. Occupational Medicine, 2008, 58(6):419–424. Shin B et al. Seroprevalence of hepatitis B virus among health 20. care workers in Korea. Journal of Korean Medical Science, 2006, 21:58–62. Kosgeroglu N et al. Occupational exposure to hepatitis infec-21. tion among Turkish nurses. Epidemiology and Infection, 2004, 132(1):27–33. Zafar A et al. Knowledge, attitudes and practices of health 22. care workers regarding needle-stick injuries at a tertiary care hospital in Pakistan. Journal of the Pakistan Medical Association, 2008, 58(2):57–60. Book 17-6.indb 478 6/6/2011 9:44:47 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 479 Rising bacterial resistance to common antibiotics in Al Ain, United Arab Emirates M.R. Al-Kaabi,1 W.U-Z. Tariq 1 and A.A. Hassanein 1 ABSTRACT There is a dearth of local information in Al Ain, United Arab Emirates about antibiotic resistance patterns. In this retrospective study in a tertiary referral hospital, antibiotic susceptibility results were analysed over the 5-year period 2004–08 and compared with a previous study in the same hospital during 1999–2002. Staphylococcus aureus showed a significant decrease in sensitivity to oxacillin from 95.0% in the period 1999– 2002 to 84.4% in 2008. Sensitivity of Acinetobacter spp. to imipenem dropped from 99.0% in 2004 to only 32.5% in 2008. During the same period, almost half of Escherichia coli isolates developed resistance to cefotoxime. Significant reductions in sensitivity to Pseudomonas aeruginosa between 1999 and 2008 were found for almost all the antibiotics tested. Klebsiella spp. did not show any significant change in resistance to any of the tested antibiotics. Serious efforts are needed to reduce the risk of the spread of resistant strains of bacteria. 1Division of Microbiology, Unit of Laboratory Medicine, Tawam Hospital, Al Ain, United Arab Emirates (Correspondence to W.U-Z. Tariq: tariqwz@yahoo.com). Received: 18/08/09; accepted: 03/11/09 ةدحتلما ةيبرعلا تاراملإا ةلود في ينعلا ةرامإ في ةعئاشلا ةيويلحا تاداضملل ميثارلجا ةمواقم دايدزا يننسح وبأ فطاوع ،قراط نامزلا ديحو ،يبعكلا دشار دممح ةيداعتسلاا ةساردلا هذه فيو .ةيويلحا تاداضملل ةمواقلما طمانأ لوح ةدحتلما ةيبرعلا تاراملإا ةلود في ينعلا ةرامإ في ةي ِّلحلما تامولعلما ُرُدْنَت :ةصلالخا ،2008 ىتح 2004 ماع نم تاونس سخم ىدم لىع ةيودلأل ةيويلحا تاداضلما ةيساسح جئاتنل ًلايلتح ةيثلاثلا ةلاحا تايفشتسم دحأ في نوثحابلا ىرجأ في ًايئاصحإ هب ّدتعُي ًاضافخنا ترهظأ دق ةيبهذلا ةيدوقنعلا نأ ينبتو .2002 ىتح 1999 ماع نم ىفشتسلما سفن في تيرجأ ةقباس ةسارد عم ْتَنِروقو نم مينيبيميلإل Acinetobacter ةدكارلا ةيساسح تضفخناو .2008 ماع في %84.4 لىإ 2002-1999 ةترفلا في %95.0 نم ينليساسكولأل اهتيساسح .ةينولوقلا ةيكيشرلإا تادَرفتسُم فصن لياوح في ينتيسكوفيسلل ةمواقم ةترفلا سفن في ترهظو .2008 ماع في طقف %32.5 لىإ 2004 ماع في %99.0 .ًابيرقت اهرابتخا ىرج يتلا ةيويلحا تاداضلما عيملج 2008و 1999 يماع ينب ةيراجنزلا ةفئازلا ةيساسح في ًايئاصحإ هب ّدتعُي ضافخنا َفِشُتكا ماك لْذَب لىإ ٌة َّسام ةجالحا نأ ةساردلا نم َّينبتيو .اهرابتخا ىرج يتلا ةيويلحا تاداضلما نم ٍّيلأ ةمواقلما في ًايئاصحإ هب ّدتعُي يرغت يأ ةليسبلكلا رهظُت لمو .ةيويلحا تاداضملل ةمواقلما ميثارلجا يرارذ راشتنا راطتخا صيلقت نكمي ىتح ةثيثح دوهج Augmentation de la résistance bactérienne aux antibiotiques courants à Al Ain, (Émirats arabes unis) RÉSUMÉ Il existe une pénurie d’informations locales à Al Ain (Émirats arabes unis) concernant les schémas de résistance aux antibiotiques. Dans la présente étude rétrospective conduite dans un hôpital de soins tertiaires, les résultats de sensibilité aux antibiotiques ont été analysés sur une période de 5 ans allant de 2004 à 2008 puis comparés aux résultats de l’étude précédente de 1999 à 2002 dans le même hôpital. La sensibilité de Staphylococcus aureus à l’oxacilline a diminué significativement, passant de 95,0 % entre 1999 et 2002 à 84,4 % en 2008. La sensibilité d’Acinetobacter spp. à l’imipénem a chuté, passant de 99,0 % en 2004 à seulement 32,5 % en 2008. Au cours de la même période, on a constaté un développement d’une résistance à la céfotoxime dans près de la moitié des isolats d’Escherichia coli. Des réductions importantes de la sensibilité de Pseudomonas aeruginosa entre 1999 et 2008 ont été observées pour presque tous les antibiotiques testés. La résistance de Klebsiella spp. aux antibiotiques testés est restée plutôt stable. Des efforts importants sont requis pour réduire le risque de propagation de souches bactériennes résistantes. Book 17-6.indb 479 6/6/2011 9:44:47 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 480 Introduction There is global concern about the grow- ing problem of antimicrobial resistance, especially the appearance and rapid spread of methicillin-resistant Staphylo- coccus aureus (MRSA) in hospitals and the community [1]. The phenomenon  is complex, involving specific micro- bial characteristics, selective pressures of antimicrobial use and demographic and technological changes that enhance the transmission of drug-resistant or- ganisms. Such infections are becoming virtually untreatable and are leading to rising morbidity, mortality and health care costs [2]. In the United Arab Emirates (UAE), as in other countries, there is a grow- ing concern about the indiscriminate prescription of antibiotics and even self- medication for minor ailments for which they many not be required. This can lead to the development of antibiotic- resistant strains of bacteria, thus reduc- ing the effectiveness of certain anti- biotics when they are required for a specific infection [3]. There has been  growing concern in Saudi Arabia too as hospital strains of resistant bacteria are finding their way into the community: steps have been taken to modify local guidelines about the optimum use of antibiotics [4]. As there are variations in  the resistance pattern in different coun- tries, a thorough understanding of the changing local trends provides valuable information to hospitals to help them evaluate and plan for the proper man- agement of clinical cases and to guide antibiotic stewardship programmes. The present study at a tertiary refer- ral hospital in Al Ain Emirate aimed to determine the susceptibility of certain bacterial isolates over the 5-year period 2004–08 and compare the results with a  previous study in the same hospital car- ried out during the period 1999–2002.  There is a dearth of local information in Al Ain and it was hoped that this study would provide valuable information about current patterns of resistance. Methods This retrospective study was carried out in Tawam hospital, Al Ain, over the pe- riod 2004–08. The susceptibility results  of the following bacterial isolates were analysed: Staph. aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella spp., Acinetobacter spp. and Stenotrophomonas maltophilia. The results were compared with a previous study carried out during the period 1999–2002 [5]. The previ- ous study was performed in the same hospital, under similar conditions, but by different workers. In some cases, comparable data were not available for the same antibiotics/strains and the trends in susceptibility were traced dur- ing the present study only. The bacteria were identified by conventional microbiology methods. Initially, between January 2004 and June  2006, the Vitek 1 microbiological culture  analyser (BioMérieux) and the Analytic Profile Index strips (BioMérieux) were used for identifying bacteria. Subse- quently,  the Vitek 2 analyser  replaced  the Vitek 1. Antibiotic susceptibility was tested by the disk diffusion method during  the period  January 2004–June  2006, and then the Vitek 2 was used to  perform antibiotic susceptibility testing for most isolates, while the disk diffusion method was retained for testing in case the Vitek 2 failed to produce satisfactory  results or if retesting of susceptibility for a particular organism was considered necessary. The Vitek 2 provided mini- mum inhibitory concentration values for the tested isolates. The Clinical and Laboratory Standards Institute’s guidelines were used to interpret the antibiotic disk diffusion data [6]. Different antibiotic panels (as deemed appropriate, with the consen- sus of a microbiologist and the treating physicians) were applied for different organisms. The data were saved in a lab- oratory information system (Epicenter, version 4.0) which has  the  facility  to  eliminate patient duplicate specimens (i.e. repeat isolates from the same body site and hospital service) from analysis. The algorithm used for handling repeat isolates was patient-based and only the first isolate per patient was included in the analysis. The calculation of per- centage susceptible did not include isolates with intermediate susceptibility. Cumulative antibiogram reports of the different isolates and antimicrobials for the period of 2004–08 were compared  with the study in 1999–2002. Logistic regression analysis was done using SPSS, version 17.0 to assess  the association between year of sam- pling and the antimicrobial resistance of the tested pathogens to determine whether there were significant changes in the percentage resistance over time. Results Staph. aureus strains showed a steady decrease in sensitivity to oxacillin from 94.0% in 2002 to 84.4% in 2008. Com- paring the average rate of sensitivity over the period 1999–2002 in the previ- ous study (96.0%) with the rate in 2008  showed that the decrease was significant (P < 0.05) (Table 1). P. aeruginosa showed significant de- creases in sensitivity (P < 0.05) between  the  average  rate  for  1999–2002  and  the rate in 2008 to amikacin, cefepime,  ciprofloxacin  (88.9%  to 81.6%),  gen- tamicin, imipenem and piperacillin/ tazobactam (Table 1). Sensitivity to azetreonam decreased significantly between 2004 and 2008 and to ceftazi- dime between 1999–2002 and 2007. Acinetobacter spp. showed a signifi- cant decrease in sensitivity between 2004  and 2008 (P  < 0.05)  to  all  the  tested antibiotics, imipenem, ceftazidime, cip- rofloxacin, gentamicin and piperacillin/ tazobactam (Table 1). E. coli showed a significant de- crease in sensitivity between the av- erage  for 1999–2002  study and 2008  (P  < 0.05)  to  amikacin,  ceftazidime,  ciprofloxacin, gentamicin (Table 1). Data were not available for 1999–2002  Book 17-6.indb 480 6/6/2011 9:44:47 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 481 Table 1 Antibiogram for isolates from a tertiary referral hospital in Al Ain by year Antibiotic Previous study [5] Current study 1999–2002 2004 2005 2006 2007 2008 n % n % n % n % n % n % Staphylococcus aureus Oxacillin 100 96.0 607 94.0 679 94.0 620 92.7 642 91.1 787 84.4a Pseudomonas aeruginosa Amikacin 292 95.5 336 97.3 353 93.8 449 95.3 697 93.7 784 87.9a Azetreonam – – 308 94.8 373 93.3 449 77.7 700 65.7 793 61.1 Cefepime 55 96.4 172 96.1 266 95.1 341 92.4 663 77.9 783 79.6a Ceftazidime 270 90.0 430 94.8 422 95.2 480 91.0 710 79.6 – – Ciprofloxacin 397 88.9 399 92.9 424 92.2 478 90.2 710 81.9 788 81.6a Gentamicin 387 91.2 452 88.9 457 89.5 482 88.8 710 86.3 789 82.4a Imipenem 388 93.8 427 93.9 443 93.9 478 89.9 710 86.0 788 80.4a Piperacillin 170 82.9 198 93.9 343 94.4 416 84.6 710 73.5 788 80.1 Piperacillin/ tazobactam 385 95.3 430 95.5 364 95.9 470 87.2 710 76.2 790 86.3a Acinetobacter spp. Amikacin – – 80 85.0 78 70.5 64 90.6 120 84.2 126 61.2 Amoxicillin/ clavulanate – – 103 43.7 104 35.6 71 28.1 123 12.4 – – Cefotaxime – – 102 31.3 112 29.4 72 31.3 123 9.5 120 8.6 Ceftazidime – – 101 66.3 101 52.4 72 65.3 123 42.3 125 31.6b Ciprofloxacin – – 96 65.6 102 72.5 72 84.5 123 52.9 125 30.1b Gentamicin – – 110 77.2 105 69.5 72 88.9 123 67.5 129 42.4b Imipenem – – 101 99.0 106 94.3 72 91.7 123 61.5 127 32.5b Piperacillin – – 46 52.1 85 52.9 55 67.3 123 44.7 127 25.0 Piperacillin/ tazobactam – – 101 69.3 85 60.0 72 75.0 123 48.8 127 29.6b Trimethoprim/ sulfamethoxazole 57 59.6 93 53.7 72 73.6 123 70.3 127 28.9 Escherichia coli Amikacin 438 99.8 557 95.8 416 93.5 765 82.5 1333 65.9 1424 76.5a Amoxicillin/ clavulanate – – 934 70.3 921 73.2 1002 76.3 1310 66.8 1420 58.3b Ampicillin 1041 31.3 770 36.6 706 35.8 1004 35.9 1360 31.6 1435 27.8 Cefotaxime – – 948 90.9 858 89.3 926 86.5 1360 81.6 1425 76.3 Ceftazidime 1004 91.0 931 92.0 816 91.2 990 86.8 1360 82.7 1420 77.3a Cefuroxime – – 724 84.1 775 88.3 752 83.8 1088 75.4 1354 69.7b Cephalothin – – 731 53.7 788 56.5 828 51.8 1087 44.8 1354 38.3 Ciprofloxacin 1021 80.1 874 77.5 833 78.9 1004 78.1 1360 72.1 1431 65.2a Gentamicin 1023 88.9 973 86.2 924 90.0 1002 87.2 1360 81.8 1433 82.3a Imipenem 1012 100.0 928 99.9 892 99.6 994 100.0 1360 100.0 1434 99.9 Nitrofurantoin – – 735 93.6 786 93.0 803 93.0 1085 92.5 1347 92.6 Piperacillin 599 36.7 396 51.5 725 52.4 827 43.9 1360 33.5 1433 38.1 Piperacillin/ tazobactam 724 97.9 928 91.9 723 91.9 998 94.2 1360 95.6 1433 95.1 Trimethoprim/ sulfamethoxazole 1011 48.9 564 56.3 782 55.9 1001 60.0 1360 53.3 – – Book 17-6.indb 481 6/6/2011 9:44:48 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 482 for other antibiotics; their sensitivities were shown to decrease significantly between 2004 and 2008: amoxicillin/ clavulanate, cefuroxime and cefotoxime (90.9% to 75.9%). E. coli did not show any significant change in resistance to nitrofurantoin, piperacillin/tazobactam, imipenem and trimethoprim/sulfam- ethoxazole over the period 2004–08. Klebsiella spp. did not show any sig- nificant change in resistance to any of the tested antibiotics between 2004 and  2008 (Table 1). There was a drop in sensitivity of Sten. maltophilia to sulfamethoxazole between 2004 and 08 but  this was not  significant (Table 1). The number of extended spectrum of beta-lactabase (ESBL)-producing isolates found increased significantly over  the period 2004–08  (P  <  0.05)  (Figure 1). The increase was evident for both isolates of E. coli  (from 7.0%  to 22.3%) and Klebsiella  spp.  (9.3%  to  16.4%) (Figure 2). Discussion Bacterial resistance to β-lactam anti- biotics first  appeared  in  the 1960s,  as  methicillin began to be used in clinical practice and was identified in 1% of iso- lates [7]. By 1993, serious concern was  being expressed about the emerging problem that Japanese hospitals were experiencing due to MRSA. Nowadays, MRSA, with its serious implications, has appeared all over the world [8]. Accord- ing to an estimate, the rate of MRSA strains have almost doubled in the Unit- ed States of America (USA), during the same period,  from 127 000  in 1999  to  278 000 in 2005. The number of people  dying due to MRSA infections reached 17 000 in 2005, an increase from 11 000  in 1999 [9]. A  similar  trend had also  been observed in the United Kingdom, where MRSA was reported to be a cause of death  in 1652 cases  in 2006,  a  rise  from 51 MRSA-related deaths in 1993, albeit with a subsequent gradual decline in mortality [10]. The data for oxacillin  in the present study showed that the rate of MRSA  increased  from 5.0%  in  the period 1999–2002 [5] to 15.6% in  2008 in the present study. Acinetobacter spp. are also notorious for their ability to develop resistance to all classes of antimicrobials. A. bauman- nii is a hospital-acquired organism and is therefore exposed to a broad range of antibiotics. Most probably these ge- netic determinants have been acquired from other nonfermenter organisms in the environment, as well as common members of the Enterobacteriaceae. β-lactamases and efflux pumps have Table 1 Antibiogram for isolates from a tertiary referral hospital in Al Ain by year (concluded) Antibiotic Previous study [5] Current study 1999–2002 2004 2005 2006 2007 2008 n % n % n % n % n % n % Klebsiella spp. Amikacin – – 213 93.4 190 94.2 282 95.4 371 94.1 397 93.9 Amoxicillin/ clavulanate – – 323 82.3 330 85.7 335 89.2 378 89.1 393 81.3 Cefoxitin – – 324 89.1 313 89.4 328 91.8 378 89.7 395 83.9 Ceftazidime – – 324 90.4 294 90.1 331 91.8 378 90.9 394 84.3 Cefuroxime – – 166 82.7 177 89.6 147 93.2 172 90.1 324 80.0 Cephalothin – – 157 80.2 180 81.6 167 89.2 166 85.5 324 78.4 Ciprofloxacin – – 306 90.5 300 91.3 336 93.7 378 92.9 395 91.0 Gentamicin – – 336 92.5 330 91.8 336 93.1 378 90.5 398 88.7 Imipenem – – 321 100.0 321 99.3 335 100.0 378 100.0 385 99.7 Nitrofurantoin – – 159 40.8 179 40.7 165 30.9 167 21.6 323 19.7 Piperacillin – – 129 63.5 272 66.5 285 20.0 378 3.4 397 39.0 Piperacillin/ tazobactam – – 323 86.6 253 88.5 335 92.8 378 95.8 397 90.2 Trimethoprim/ sulfamethoxazole – – 184 80.4 272 82.3 335 88.6 378 86.4 397 83.9 Stenotrophomonas maltophilia Trimethoprim/ sulfamethoxazole – – 26 100.0 42 95.2 38 97.4 63 95.2 63 88.7 aP < 0.05 versus average data for years 1999–2002. bP < 0.05 versus year 2004. n = number of isolates tested; – = not tested. Book 17-6.indb 482 6/6/2011 9:44:48 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 483 been implicated in the resistance mech- anisms of Acinetobacter strains [11].  Over the years of our study, the sensitiv- ity rates of Acinetobacter spp. to various antibiotics have than more halved and we have been left no good choice of antibiotics. Until recently, carbapenams would have been the choice against Aci- netobacter spp. as our study showed that 99.0% of these organisms were sensitive  to  imipenem  in 2004. By 2008, how- ever, sensitivity had dropped to only 32.5%. Acinetobacter spp. commonly colonize patients in intensive care units, especially those who are intubated or have multiple intravenous lines or monitoring devices, postsurgical drains or urinary catheters. These organisms are found almost exclusively in patients admitted to hospitals. Irrespective of the fact that their role in disease causation is marginal and the cause of mortality and morbidity is due the underlying disease, their rising resistance against antimicro- bial drugs is alarming [12]. E. coli is a ubiquitous organism, which may spread to human beings from animals, mainly poultry. It is be- coming resistant to multiple drugs and the findings from poultry isolates are also reflected in the human isolates of this organism, mainly due to the exten- sive use of antibiotics in farming [12]. A  study in the USA revealed that almost 331 of the 931 E. coli isolates from hu- mans and poultry were resistant to 1 or more commonly used antibiotics [14]. During the same period, almost a  quarter of E. coli isolates have developed resistance to cefotaxime. Moreover the organisms showing drug resistance have been shown to express high levels of virulence factors [15]. The problem of drug resistance in P. aeruginosa are multifold. The organism may accumulate intrinsic drug resistance mechanisms such as overproduction of cephalosporinase AmpC, increased drug efflux, fluo- roquinolone target mutations and deficient production of porin OprD. Moreover, there are exogenous mecha- nisms such as production of secondary β-lactamases and aminoglycoside-mod- ifying enzymes. These retain the ability to generate severe bloodstream infec- tions. Therefore, multidrug-resistant P. aeruginosa may remain fully pathogenic [16]. We  found significant  reductions  in sensitivity to P. aeruginosa between 1999 and 2008  for almost all  the anti- biotics tested. Taking into consideration the local antibiogram data, guidelines have been issued for rational use of antibiotics in the UAE. The overuse of antibiotics is avoided and as far as possible the Year 2004 2005 2006 2007 2008 350 300 250 200 150 100 50 0 N um be r o f i so la te s Klebsiella species Escherichia coli Figure 1 Total number of extended spectrum of beta-lactamase (ESBL)-producing isolates of Escherichia coli and Klebsiella spp. out of total ESBL isolates from a tertiary referral hospital in Al Ain for 2004–08 ES BL is ol at es , % ESBL Klebsiella species ESBL Escherichia coli 2004 2005 2006 2007 2008 25.0 20.0 15.0 10.0 5.0 0.0 Year Figure 2 Percentage of extended spectrum of beta-lactamase (ESBL)-producing isolates of Escherichia coli and Klebsiella spp. from total ESBL isolates from a tertiary referral hospital in Al Ain for 2004–08 most appropriate antibiotic is used for an adequate period and not beyond. The overuse of antibiotic for surgical prophylaxis is also discouraged. Anti- biotics are reserved for those patients who can benefit from them, i.e. those are the shown to be infected with the relevant bacterial pathogen. As far as possible, a narrow spectrum drug is used to cover a particular organism identified. Serious efforts are needed to reduce the risk of development of resistant strains of bacteria in the envi- ronment and in hospitals. Surveillance of resistance should be a key factor to generate data to inform improvements in clinical practice. Book 17-6.indb 483 6/6/2011 9:44:48 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 484 References Okuma K et al. Dissemination of new methicillin-resistant 1. Sta- phylococcus aureus clones in the community. Journal of Clinical Microbiology, 2002, 40:4289–4294. Cohen ML. Epidemiology of drug resistance: implications for a 2. post-antimicrobial era. Science, 1992, 257:1050–1055. Abasaeed A et al. Self-medication with antibiotics by the com-3. munity of Abu Dhabi Emirate, United Arab Emirates. Journal of Infection in Developing Countries, 2009, 3(7):491–497. Shibl A. The problem of antibiotic resistance. 4. Arab Health Magazine, 2007, 12:20–21. Jumaa PA, Neringer R. A survey of antimicrobial resistance in a 5. tertiary referral hospital in the United Arab Emirates. Journal of Chemotherapy (Florence, Italy), 2005, 17:376–379. Performance standards for antimicrobial susceptibility testing: 6. nineteenth informational supplement M100-S19. Wayne, Penn- sylvania, Clinical and Laboratory Standards Institute, 2009. Parker MT, Hewitt JH. Methicillin resistance in 7. Staphylococcus aureus. Lancet, 1970, 295:800–804. Donovan J. Antibiotic resistance in Australia. 8. Health Issues No. 69, December 2001:1–5. Klein E, Smith DL, Laxminarayan R. Hospitalizations and 9. deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999–2005. Emerging Infectious Diseases, 2007, 13:1840–1846. Jarvis WR. Prevention and control of methicillin-resistant 10. Staphy- lococcus aureus: dealing with reality, resistance, and resistance to reality. Clinical Infectious Diseases, 2010, 50(2):218–220. Gootz TD, Marra A. Acinetobacter baumannii: an emerg-11. ing multidrug-resistant threat. Expert Review of Anti-Infective Therapy, 2008, 6:309–325. Silvia Munoz-Price LS, Weinstein RA. 12. Acinetobacter infection. New England Journal of Medicine, 2008, 358:1271–1281. Johnson JR et al. Similarity between human and chicken 13. Escherichia coli isolates in relation to ciprofloxacin resistance status. Journal of Infectious Diseases, 2006, 194:71–78. Johnson JR et al. Antimicrobial drug-resistant Escherichia coli 14. from humans and poultry products, Minnesota and Wisconsin, 2002–2004. Emerging Infectious Diseases, 2007, 13:838–846. Sharma S, Bhat GK, Shenoy S. Virulence factors and drug resist-15. ance in Escherichia coli isolated from extraintestinal infections. Indian Journal of Medical Microbiology, 2007, 25:369–373. Hocquet D et al. 16. Pseudomonas aeruginosa may accumulate drug resistance mechanisms without losing its ability to cause bloodstream infections. Antimicrobial Agents and Chemo– therapy, 2007, 51:3531–3536. Excerpt from a podcast broadcast on the occasion of World Health Day 2011 Dr Mario Raviglione: Drug resistance or antimicrobial drug resistance is a real global threat. First, it kills. We don’t have a precise number but it kills hundreds of thousands of people every year. • Second, it challenges greatly - care and control of infectious diseases that in the past were curable - for some of them • we are now in the pre-antibiotic era, we are back to the 1930s or 40s.  Third, it has not yet been fully realized that drug resistance threatens the achievements of the Millenium Develop-• ment Goals because it kills children, it kills mothers, it kills HIV, TB and malaria patients. Finally, it compromises health security, and may damage economies. • The full podcast can be heard via the link on this page: http://www.who.int/mediacentre/multimedia/podcasts/2011/whd_20110408/en/index.html Book 17-6.indb 484 6/6/2011 9:44:48 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 485 Epidemiological profile of health-care-associated infections in the central-east area of Tunisia K. Ben Salem,1 S. El Mhamdi,1 M. Letaief,1 M. Bchir 1 and M.S. Soltani 1 ABSTRACT This study aimed to estimate the prevalence and risk factors for health-care-associated infection (HAI) in all 9 hospitals of the central-east area of Tunisia in 2005. Of 1373 patients admitted for more than 48 hours, 74 developed HAI, a prevalence of 5.4% (95% CI: 4.2%–6.6%). The prevalence was significantly higher in the intensive care units (18.4%) and neonatal departments (12.7%). There were 79 infections and the most frequent sites of infection were respiratory tract and urinary tract. Microbiological examination was performed for 25 cases of HAI and Pseudomonas aeruginosa was identified in 8 cases. Multiple logistic regression analysis indicated that HAI was linked to diabetes (OR = 2.0), immunosuppression (OR = 3.3), length of stay (OR = 4.5), central venous catheter (OR = 2.5) and peripheral venous catheter (OR = 10.2). We conclude that HAIs are of concern in this area of Tunisia. 1Department of Community Medicine, Faculty of Medicine, Monastir, Tunisia (Correspondence to K. Ben Salem: Kamel.BenSalem@fmm.rnu.tn). Received: 01/03/09; accepted: 29/06/09 سنوت نم ةيقشرلا ىطسولا ةقطنلما في ةيحصلا ةياعرلل ةبكاوُلما ىودعلل يئابولا مسترلما نياطلس سيوسلا دممح ،يرشب دوممح ،فّيطللا رذنم ،يدمحلما ءانس ،لماس نب لماك ةقطنلما في ةدوجولما ةعستلا تايفشتسلما عيجم في ةيحصلا ةياعرلل ةبكاوُلما ىودعلل راطتخلاا لماوع راشتنا ريدقت ةساردلا هذه تفدهتسا :ةصلالخا ٌةعبرأ بيصأ ،ةعاس ينعبرأو نماث نم رثكلأ اهيف اوثكمو تايفشتسلما اولخدأ ًاضيرم 1373 ينب نم هنأ ينبتو .2005 ماع سنوت نم ةيقشرلا ىطسولا لىع لىعأ راشتنلاا لدعم ناكو .)%6.6 - %4.2 :%95 ةقثلا ةلصاف( %5.4 هُردق راشتنا لدعمب ،ةيحصلا ةياعرلل ةبكاوُلما ىودعلاب ًاضيرم نوعبسو رثكأ ناكو ،ىودع 79 كانه ناكو .)%12.7( ةدلاولا يثيدلحا نادلِولا ةياعر ماسقأ فيو )%18.4( ةزّكرلما ةياعرلا تادحو في ًايئاصحإ هب ّدتعُي وحن تلاالحا نم ةلاح 25 ـل يجولويبوركم صحف يرجأ دقو .ةيلوبلا كلاسلماو سيفنتلا زاهلجا اهم ًاراركت ىودعلاب ةباصلإا راركت ثيح نم ينعقوم ةباصلإا طابترا لىع د ِّدعتلما يتسجوللا فّوحتلا ليلتح لديو .اهنم ٍنماث ةيراجنزلا ةفئازلا تفشتكاو ،ةيحصلا ةياعرلل ةبكاوُلما ىودعلاب تبيصأ يتلا ةبسن( ىفشتسلما في ثكلما لوطو ،)3.3 = ةيحجرلأا ةبسن( ةعانلما تْبَكو ،)2.0 =ةيحجرلأا ةبسن( ّيرّكسلاب ةيحصلا ةياعرلل ةبكاوُلما ىودعلاب جتنتساو .)10.2 = ةيحجرلأا ةبسن( يطيمح يديرو راطثِق دوجوو ،)2.5 = ةيحجرلأا ةبسن( يزكرم يديرو راطثِق دوجوو ،)4.5 = ةيحجرلأا .سنوت نم ةقطنلما كلت في مماتهلاا قحتست ةيحصلا ةياعرلل ةبكاوُلما ىودعلا نأ نوثحابلا Profil épidémiologique des infections liées aux procédures de soins dans la région du centre-est de la Tunisie RÉSUMÉ La présente étude visait à estimer la prévalence et les facteurs de risque des infections liées aux procédures de soins dans tous les hôpitaux de la région du centre-est de la Tunisie, comptant neuf établissements, en 2005. Sur un total de 1373 patients séjournant depuis plus de 48 heures à l’hôpital, 74 ont présenté une infection associée aux procédures de soins, correspondant à une prévalence de 5,4 % (IC à 95 % : 4,2 %–6,6 %). La prévalence était nettement plus élevée dans les unités de soins intensifs (18,4 %) et les services de néonatalogie (12,7 %). Au cours de l’étude, 79 infections ont été observées et les sites d’infection les plus fréquents étaient les voies respiratoires et urinaires. Une analyse microbiologique a été réalisée pour 25 cas d’infections liées aux procédures de soins et Pseudomonas aeruginosa a été identifié dans 8 cas. Une analyse de régression logistique multiple a indiqué que les infections associées aux procédures de soins étaient liées aux variables suivantes : diabète (OR = 2,0), immunodépression (OR = 3,3), durée du séjour (OR = 4,5), pose d’un cathéter veineux central (OR = 2,5) ou d’un cathéter veineux périphérique (OR = 10,2). Nous en concluons que les infections liées aux procédures de soins constituent un motif de préoccupation dans cette région de Tunisie. Book 17-6.indb 485 6/6/2011 9:44:49 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 486 Introduction Nosocomial or health-care-associated infection (HAI) is an important cause of patient’s morbidity and mortality [1]. In recent years, it has become more  prominent due to the greater complex- ity of hospital patients’ conditions and to developments in health care, which in some institutions has led to patients becoming more vulnerable to infection. As an adverse outcome of acute hos- pital care, HAI can be used as a quality indicator for the overall assessment of hospital treatment [2].  Surveillance for HAI is an essential part of infection control and has been widely accepted throughout the world as a primary step for prevention. To accomplish this, prevalence surveys can be used to quantify the burden of disease and to help establish priorities [3]. A  study  in Morocco  reported on  the prevalence of hospital-acquired infection  in  a university hospital  [4].  In nearby Tunisia, in order to estab- lish infection control programmes and select priorities, we need to assess the magnitude of HAI in the local context and to identify the major associated factors. In our case, to scope and assess the magnitude of the problem of HAI and to establish control priorities we carried out a prevalence survey of HAI in hospitals in the central-east region of Tunisia as a part of the national preva- lence survey (NOSOTUN05).  Methods Sample All health care facilities in the central- east region of Tunisia were invited to participant in a cross-sectional study. A total of 9 hospitals participated: 4 teaching hospitals, 3 regional hospitals and 2 private clinics. Each department was visited on one day. All inpatients present on the day of the study who had a hospital stay exceeding 48 hours were included (n = 1373 patients). Data were collected continuously over  the 2-month period  January and February 2005.  Data collection A trained public health doctor and a senior technician in hospital hygiene were in charge of data collection in each hospital. The data collection schedule of the investigators was unknown to hospital officials. Three datasheets (hospital, depart- ment and patient) were designed for data collection. Data entry was anony- mous. The hospital and department datasheets were used to collected data on the duration of stay for each pa- tient, department of admission and the specialty (medical or surgical). In the patients’ datasheet we collected data on age and sex; intrinsic risk factors for HAI (malnutrition, diabetes, neutrope- nia, immunosuppression and obesity); extrinsic risk factors (urinary catheter, parenteral nutrition, mechanical ven- tilation, central and peripheral venous catheter); site of infection; antibiotic use; and microorganisms isolated and resistance pattern. In the surgery department, we col- lected information for each patient who underwent surgery about: the degree of urgency; the American Society of Anesthesiology (ASA) physical status score [5]; the Altemeier contamination classification [6]; and the use of antibi- otic prophylaxis. Definitions We adopted the US Centers for Dis- ease Control and Prevention (CDC) definition of HAI [7] as a  localized or  systemic condition resulting from an adverse reaction to the presence of an infectious agent(s) or its toxin(s) when there is no evidence that the infection was present or incubating at the time of admission to the acute care setting. HAIs may be caused by infectious agents from endogenous or exogenous sources. In the current study only clini- cally or microbiologically documented cases were considered as positive for HAI. The following definitions were used: obesity was body mass  index > 30 kg/ m2, malnutrition was body mass index < 17 kg/m2; neutropoenia was < 2000  neutrophils/µL of blood; diabetes was glycemic index > 1.26 g/L; immunosup- pression was CD4 count < 500 mm3. Data analysis Analyses were performed using Epi-info software, version 6.0. The analysis of fac- tors associated with HAI was based on appropriate statistical tests (Student t- test to compare means, non-parametric tests when a normal distribution of data could not be assumed and chi-squared test for the comparison of percent- ages). A P-value < 0.05 was considered  to be statistically significant. Variables with univariate test value ≤ 0.25 were  included in a multivariate stepwise logistic regression to control for the effect of confounding variables. In the final model we identified the factors independently associated with HAI. Results Patients’ demographic and clinical characteristics The overall majority of the study pa- tients (95.5%) were hospitalized  in the  university hospitals. Their mean age was 46.4 (standard deviation 22) years, with  extremes ranging from 1 day to 91 years and the sex ratio was 1.07. The median length of stay between patient admission in each department and the date of the inquiry was 7 days (interquartile range 4–14). Almost three-quarters of all patients (988, 72.0%) presented with 1 or more  intrinsic or extrinsic risk factor for HAI (Table 1). A total of 302 patients underwent a  surgical procedure. Among them, 4.0%  were classified as Altemeier surgical contamination  classes  3  and  4,  4.0%  had ASA physical status score 3+ and Book 17-6.indb 486 6/6/2011 9:44:49 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 487 63.0%  received antibiotic prophylaxis  (Table 2).  Overall prevalence During the survey, 74 of the 1373 patients were diagnosed with HAI, an  overall  prevalence  of  5.4%  (95%  CI:  4.2%–6.6%).  Five  patients  had  more than 1 infection and so the total number of infections was 79: respiratory infections were the most common (45.6%)  followed by urinary  tract infections (16.5%) and surgical site  infections (15.2%).  The median length of hospital stay was significantly higher for infected patients [12.5 days (interquartile range  9–19)]  and  than  for  noninfected  patients [7 days (interquartile range 4–13)] (P < 0.01). Prevalence by department The prevalence of HAI was significantly higher in the intensive care units (8/43, 18.6%) and neonatal care units (11/54,  20.3%) compared with other hospital  departments (P < 0.001). Of the patients  in  intensive  care units,  18/43  (42%)  were under mechanical ventilation, with a high rate of nosocomial pneumonia in this group (4/18, 22.2%) (P < 0.01). Table 1 Risk factors for health care associated infection Risk factor Total patients (n = 1373) Infected patients (n = 74) Uninfected patients (n = 1299) Statistics No. % No. % No. % OR 95% CI Immunosuppression 29 2.1 6 8.1 23 1.8 4.1 1.51–11.2 Malnutrition 72 5.2 8 10.8 64 4.9 2.4 1.10–5.20 Diabetes 304 22.1 26 35.1 278 21.4 1.9 1.13–3.07 Obesity 193 14.1 9 12.2 184 14.2 0.7 0.34–1.54 Neutropenia 8 0.6 3 4.1 5 0.4 7.2 1.38–38.1 Mechanical ventilation 38 2.8 9 12.2 29 2.2 5.4 2.38–12.3 Parenteral nutrition 38 2.8 8 10.8 30 2.3 5.2 2.30–11.9 Urinary catheter 138 10.1 15 20.3 123 9.5 2.3 1.23–4.19 Peripheral venous catheter 597 43.5 60 81.1 537 41.3 2.6 1.58–4.28 Central venous catheter 26 1.9 5 6.8 21 1.6 8.6 3.79–19.6 OR = odds ratio; CI = confidence interval. Table 2 Prevalence of health care associated infection for patients undergoing surgery Surgery characteristics Total surgery patients (n = 302) Infected patients (n = 26) Uninfected patients (n = 276) P-value No. % No. % No. % ASA physical status score 1 214 70.9 16 61.5 198 71.7 0.42 76 25.2 8 30.8 68 24.6 3+ 12 4.0 2 7.7 10 3.6 Endoscopy Yes 192 63.6 13 50.0 179 64.9 0.3 No 110 36.4 13 50.0 97 35.1 Urgency of procedure Elective 248 82.1 2 7.7 246 89.1 0.2 Urgent 54 17.9 24 92.3 30 10.9 Altemeier contamination class 1 136 45.0 12 46.2 124 44.9 0.82 154 51.0 12 46.2 142 51.4 3 and 4 12 4.0 2 7.7 10 3.6 Antibiotic prophylaxis Yes 191 63.2 20 76.9 171 62.0 0.4 No 111 36.8 6 23.1 105 38.0 ASA = American Society of Anesthesiology. Book 17-6.indb 487 6/6/2011 9:44:49 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 488 The prevalence of HAI in surgery departments was 8.6% (26/302) (Table  2). In this group, urinary tract infection  was the most common infection (9/26  cases). The median length of stay in the surgical department was significantly greater for infected patients [18 days (interquartile  range 12–22)]  than  for  noninfected patients [8 days (interquar- tile range 4–15)] (P < 0.01). Microbiology data Microbiology findings were available for only 25 cases of HAI; Gram-negative  bacilli were  identified  in 80% (20/25)  of cases, predominately Pseudomonas aeruginosa  (8/20 cases). Among cases  for which microbiology findings were available, 11 cases of antibiotic resist- ance were detected, 4 in P. aeruginosa. Antibiotics were prescribed for 58 HAI patients, with more than 1 antibiotic  for 30  (52%) of  cases. The  most frequently used antibiotics were β-lactamases (45%), quinolones (15%)  and aminoglycosides (13%).  Risk factor analysis Except for obesity, all the studied risk factors were significantly associated with HAI (P < 0.01) (Table 1).  The variables included in the mul- tivariate analysis model were: diabetes, malnutrition, immunosuppression, neutropenia, urinary catheter, central venous catheter, peripheral venous cath- eter, mechanical ventilation, parenteral nutrition, length of stay and age (di- vided into classes). The model retained 5 variables independently associated with HAI: diabetes (OR = 2.0), immunosup- pression (OR = 3.3), length of stay (OR = 4.5), central venous catheter (OR = 2.5) and peripheral venous catheter (OR  = 10.2) (0.001 < P < 0.03) (Table 3). Discussion Although HAI includes infections contracted in ambulatory care depart- ments, our present study was limited to hospital infections. By using a preva- lence survey with standard methods [8]  and  the CDC definition  of HAI  we are able to compare our study with other prevalence surveys using the same methods and definition. The data col- lection by a public health doctor and a senior technician in hospital hygiene ensured that the survey was conducted in a consistent and correct manner. The study achieved its objectives in terms of determining the prevalence and associ- ate factors of HAI. We found that the prevalence of HAI in this region of Tunisia was 5.4%.  This rate is similar to other studies using the  same methods [9,10]. The highest  risk specialties were intensive care and neonatal care units, where the prevalence of HAI was 18.6% and 12.7% respective- ly. These observations are confirmed by the literature and are the result of several factors related to the patients (such as age, co-morbidities) [11] and the use of  invasive procedures, especially central venous catheters [12]. In our study, multivariate analysis shows that diabetes, length of stay, im- munosuppression and use of central line and peripheral venous catheters were independent risk factors of HAI. Use of a peripheral venous catheter was the most important risk factor (OR = 10.2);  this may be because  less care  is  taken in insertion of these catheters as staff see it as a simple, everyday activ- ity. We also found a linear correlation between the number of risk factors and the rate of HAI. Similar results were reported by another study [13]. The most frequently infected site was the respiratory tract. It has been demonstrated that pneumonia is the most common nosocomial infection, and respiratory infection is especially common in intensive care units because of  the use of artificial  ventilation [14].  These results were confirmed in our study,  in which 42% of  intensive  care  unit patients were under mechanical ventilation, with a high rate of noso- comial pneumonia (22.2%) Among operated patients, and in accordance with the literature, surgical site infections were the most common infections  [15,16]. The ASA physical  status score, which consists of 5 classes [5],  and  the Altemeier contamination  classification, which separates interven- tions depending on the degree of clean- liness  [6], were predictors of  infection  risk in surgical patients. Overall, surgical site infections were in fourth position, which demonstrates the attention given to surgical site asepsis to avoid surgical wound infection. However, less atten- tion was given to other important as- pects such as urinary catheter insertion under aseptic conditions and regular catheter changes. The rate of microorganisms, based on microbiological examination, usu- ally exceeds 60% [17,18].  In our case,  Table 3 Independent risk factors of health care associated infections Risk factor Wald OR (exp β) 95% CI P-value Diabetes 4.34 2.0 1.03–3.02 0.03 Length of stay 24.01 4.5 2.47–8.24 0.01 Immunosuppression 5.14 3.30 1.17–9.27 0.02 Central venous catheter 12.16 2.53 1.50–4.28 0.01 Peripheral venous catheter 27.04 10.20 4.25–24.5 0.001 OR = odds ratio; CI = confidence interval. Book 17-6.indb 488 6/6/2011 9:44:50 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 489 microbiological testing was performed in only one-third of cases of HAI. This low rate of ordering microbiological testing may be related to the type of infection. Diagnosis of respiratory tract infections (the most frequent type of infection inours tudy) is usually done by clinical suspicion and treated without microbiological confirmation. Microbiological testing in HAI cases usually shows that Gram-negative bacilli are the most frequent, especially P. aeru- ginosa [19]. Our study confirmed these  findings, with a predominance of Gram- negative bacilli (80% of cases), and 4 out  of 11 cases of antibiotic resistance related to P. aeruginosa. Other studies have also found high rate of resistant organisms [20,21]. These resistances have multiple  causes, especially the inappropriate use of antimicrobial agents [22,23] and can  be avoided by appropriate antibiotic therapies based on guidelines informed by local epidemiological data. Conclusions Our findings highlight that HAIs are of concern in the central-east area of Tunisia. The prevalence was sig- nificantly higher in the intensive care units and neonatal departments. The most frequent infection sites were respiratory and urinary tract. Risk fac- tors for HAI were diabetes, length of stay, immunosuppression and use of peripheral and central venous catheters. We suggest that prophylactic measures against these infections should be im- plemented through the establishment of a national prevention strategy. Acknowledgements Special thanks are due to the major pub- lic health physicians Besbes Mohamed Hachmi, Bouchahda Mokhtar, Gacem Hbib, Khayach Fathi and the senior technicians in hospital hygiene Ajmi Moufida, Ben Rayana Naziha, Chargui Salwa, Mzoughia Najah for their contri- bution in this study. References Fabbro-Peray P et al. Mortality attributable to nosocomial 1. infection: a cohort of patients with and without nosocomial infection in a French university hospital. Infection Control and Hospital Epidemiology, 2007, 28:265–272. Groeneveld AB. Risk factors for increased mortality from 2. hospital-acquired versus community-acquired infections in febrile medical patients. American Journal of Infection Control, 2009, 37:35–42. Llata E, Gaynes RP, Fridkin S. Measuring the scope and magni-3. tude of hospital-associated infection in the United States: the value of prevalence surveys. Clinical Infectious Diseases, 2009, 48:1434–1440. Jroundi I et al. Prevalence of hospital-acquired infection in a 4. Moroccan university hospital. American Journal of Infection Control, 2007, 35:412–416. Draft guideline for the prevention of surgical site infection, 5. 1998–CDC. Notice. Federal Register, 1998, 63:33168–33192. Garner JS. CDC guideline for prevention of surgical wound 6. infections, 1985. Supersedes guideline for prevention of surgical wound infections published in 1982. (Originally pub- lished in November 1985). Revised. Infection Control, 1986, 7:193–200. Horan TC, Andrus M, Dudeck MA. CDC/NHSN surveillance 7. definition of health care-associated infection and criteria for specific types of infections in the acute care setting. American Journal of Infection Control, 2008, 36:309–332. Smyth ET et al. Hospital Infection Society Prevalence Survey 8. Steering Group. Four country healthcare associated infection prevalence survey 2006: overview of the results. Journal of Hospital Infection, 2008, 69:230–248. Eriksen HM, Iversen BG, Aavitsland P. Prevalence of nosoco-9. mial infections in hospitals in Norway, 2002 and 2003. Journal of Hospital Infection, 2005, 60:40–45. Lahsaeizadeh S, Jafari H, Askarian M. Healthcare-associated 10. infection in Shiraz, Iran 2004–2005. Journal of Hospital Infec- tion, 2008, 69:283–287. Gould IM. Use of active surveillance cultures in intensive care 11. units. Clinical Infectious Diseases, 2009, 48:262–263. Ranasinghe JS, Lee AJ, Birnbach DJ. Infection associated with 12. central venous or epidural catheters: how to reduce it? Current Opinion in Anaesthesiology, 2008, 21:386–390. Paillaud E et al. Relations between undernutrition and noso-13. comial infections in elderly patients. Age and Ageing, 2005, 34:619–625. Augustyn B. Ventilator-associated pneumonia: risk factors and 14. prevention. Critical Care Nurse. 2007, 27(4):32–39. Brown S et al. Prevalence and predictors of surgical site infec-15. tion in Tbilisi, Republic of Georgia. Journal of Hospital Infection, 2007, 66:160–166. De Oliveira AC et al. Surgical site infection in patients submit-16. ted to digestive surgery: risk prediction and the NNIS risk in- dex. American Journal of Infection Control, 2006, 34:201–207. Faria S et al. Prevalence Study Group. The first prevalence sur-17. vey of nosocomial infections in the University Hospital Centre ‘Mother Teresa’ of Tirana, Albania. Journal of Hospital Infection, 2007, 65:244–250. Gould IM. The epidemiology of antibiotic resistance. 18. Interna- tional Journal of Antimicrobial Agents, 2008, 32(Suppl. 1):S2–9. Bassetti M, Repetto E. Le infezioni in medicina : rivista period-19. ica di eziologia, epidemiologia, diagnostica, clinica e terapia delle patologie infettive [Diagnostic and therapeutic manage- ment of Gram-negative infections]. Le Infezioni in Medicina, 2008, 16(Suppl. 2):22–29. Viktorov DV et al. High-level resistance to fluoroquinolones 20. and cephalosporins in Burkholderia pseudomallei and closely related species. Transactions of the Royal Society of Tropical Medicine and Hygiene, 2008, 102(Suppl. 1):S103–110. Lautenbach E et al. Imipenem resistance among pseudomonas 21. aeruginosa isolates: risk factors for infection and impact of re- sistance on clinical and economic outcomes. Infection Control and Hospital Epidemiology, 2006, 27:893–900. Blot S et al. Measuring the impact of multidrug resistance in 22. nosocomial infection. Current Opinion in Infectious Diseases, 2007, 20:391–396. D’Agata EM et al. Modeling antibiotic resistance in hospitals: 23. the impact of minimizing treatment duration. Journal of Theo- retical Biology, 2007, 249:487–499. Book 17-6.indb 489 6/6/2011 9:44:50 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 490 Assessment of liver function among nickel-plating workers in Egypt H.M. El-Shafei1 ABSTRACT Currently no reports are available from Egypt regarding occupational exposure to nickel and its effects on the liver. The aim of this study was to assess the liver function of workers occupationally exposed to nickel. Standard liver function tests were applied to blood samples from 25 nickel-plating workers in Damietta, Egypt and 30 administrative workers as a reference group. Levels of urine nickel, measured by inductively coupling plasma-emission spectroscopy, were significantly higher in nickel-exposed workers compared with the reference group. The levels of alanine aminotransferase and aspartate aminotransferase were significantly higher in nickel-exposed workers. The level of serum albumin was significantly negatively correlated and the levels of serum aminotransferases, and serum gamma-glutamyl-transpeptidase were significantly positively correlated with urine nickel levels. Liver function is compromised in nickel-plating workers compared with non-exposed administrative workers. 1Ministry of Agriculture, Port Said, Egypt (Correspondence to H.M. El-Shafei: hshafei154@yahoo.com). Received: 16/07/09; accepted: 01/09/09 صرم في لكينلا ءلاط في ينلماعلا ينب دبكلا ةفيظو مييقت يعفاشلا دممح دممح ينسح ينب دبكلا ةفيظو مييقت لىإ ةساردلا هذه تفده دقو .دبكلا لىع هيرثأتو لكينلل ّينهلما ضّرعتلا نع صرم في ًايلاح ةحاتم ريراقت دجوت لا :ةصلالخا في نولمعي نيذلا لماعلا نم نيشرعو ةسخم نم ةذوخأم مدلا نم تانيعل ةيرايعلما دبكلا فئاظو تارابتخا تيرجأ دقو .لكينلل ًاينهم ينضّرعلما لماعلا تايوتسم تسيق مث .ةيعجرم دهاوش ةعوممج مهرابتعاب ينيرادلإا ينفظولما نم ينثلاث نم تانيع تذخُأ ماك ،ةيصرلما طايمد ةنيدم في لكينلاب ءلاطلا ينضّرعلما لماعلا في ًايئاصحإ هب ُّردتعُي ٍوحن لىع لىعأ تايوتسلما هذه تناكف ،ضيرحتلا جودزلما يمزلابلا ثاعبنلال يفيطلا يرظنتلاب لوبلا في لكينلا .لكينلل ينضّرعلما لماعلا في ًايئاصحإ هب ُّردتعُي ٍوحن لىع لىعأ تاتبرسلأاو يننلالأا ينمأ ْيَتلقان تايوتسم تناكو .ةيعجرلما ةعومجلماب ًةنراقم لكينلل ليماتولغ-اماغلا ديتبب ةلقان تطَباَرَت ينح في ،لصلما في ينملأا ْيَتلقان تايوتسم عم ًايئاصحإ هب ُّردتعُي ًايبلس ًاطُبارت ليصلما ينموبللأا ىوتسم َطَباَرَتو ةنراقلماب لكينلاب ءلاطلا في ينلماعلا في ةَصَقَتْنُم دبكلا ةفيظو تناك دقف اذكهو .لوبلا في لكينلا تايوتسم عم ًايئاصحإ هب ُّردتعُي ًايبايجإ ًاطُبارت ةيلصلما .لكينلل ينضّرعلما يرغ ينيرادلإا لماعلا عم Bilan de la fonction hépatique chez les travailleurs de l’industrie du placage au nickel en Égypte RÉSUMÉ Actuellement, il n’existe aucun rapport disponible en Égypte concernant l’exposition professionnelle au nickel et ses effets sur le foie. L’objectif de la présente étude était d’évaluer la fonction hépatique des travailleurs exposés professionnellement au nickel. Le bilan habituel de la fonction hépatique a été réalisé à partir d’échantillons de sang prélevés chez 25 travailleurs de l’industrie du placage au nickel à Damiette (Égypte) et chez 30 employés de bureau pour le groupe témoin. Les concentrations urinaires de nickel, mesurées par spectroscopie d’émission de plasma induit par haute fréquence, étaient significativement supérieures chez les travailleurs exposés au nickel que dans le groupe témoin. Les taux d’alanine amino transférase et d’aspartate amino transférase étaient nettement supérieurs chez les travailleurs exposés au nickel. Les résultats pour l’albuminémie étaient négativement et fortement corrélés aux concentrations urinaires de nickel alors que les taux sériques des transaminases et de gamma-glutamyl-transpeptidase étaient positivement et fortement corrélés aux concentrations urinaires de nickel. La fonction hépatique des travailleurs de l’industrie du placage au nickel est compromise par rapport à celle des employés travaillant dans des bureaux. Book 17-6.indb 490 6/6/2011 9:44:50 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 491 Introduction Nickel is a known haematotoxic, immu- notoxic, hepatotoxic, pulmotoxic and nephrotoxic agent  [1–6].  In  the body,  nickel forms a complex with adenosine triphosphate, amino acids, peptides, proteins and deoxyribonucleic acid [4].  Allergic skin reactions to nickel are also common [3]. Nickel salts are considered an industrial health hazard, since many nickel com- pounds reach the human environment. Occupational exposure of several mil- lion workers worldwide has been shown to give rise to elevated levels of nickel in blood, urine and body tissues. Inhala- tion is the primary route of occupa- tional exposure to metals [5], although  workers engaged in nickel-processing factories are exposed to nickel through inhalation, ingestion and dermal con- tact. Previous studies on occupational exposure to nickel during nickel-plating process reported lung damage, allergic skin reactions, renal dysfunction and histopathological changes in the nasal mucous [6]. Nickel causes increased levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and serum gamma-glutamyl-transpeptidase (SGGT) in the liver and serum of animals and humans exposed to nickel salts  [7–9],  indicating  compromised  liver function. Reported urinary nickel levels in humans can vary considerably, even in non-occupationally exposed individuals. Because of this, urine nickel is of most use when interpreted on a group basis. Reported urinary nickel concentrations in non-exposed indi- viduals  range  from  0.2–10  µg Ni/L,  depending on the method of analysis [10,11]. Currently, no reports are avail- able from Egypt regarding occupational exposure to nickel and its effects on liver function. The present study was therefore undertaken to investigate a number of liver function parameters among workers in Egypt exposed to nickel during nickel-plating. Method Sample The study was carried out in April 2009  and involved 55 male workers, who were divided  into 2  groups. The first  group  consisted  of  25  workers  who  were recruited from the nickel-plating industry in Damietta city, Egypt; this group was considered as nickel-exposed workers. They were working in 5 differ- ent workshops for nickel battery sales and repair in the same zone of the city. The second group comprised 30 office  workers with no exposure to nickel and was considered as a reference group. They were working at an office in Damietta city unrelated to the nickel plating workshops. The reference group subjects were matched for age and socioeconomic status (income, area of residence) with the nickel-exposed workers. Demographic information and work history and habits of all subjects were obtained through a questionnaire. Laboratory methods All laboratory equipment was well cleansed by soaking  in 10% nitric acid  for  24  hours  and  rinsing  thoroughly  with deionized water [12]. The  same  cleansing procedure was applied to the polypropylene containers used for ve- nous blood and urine sampling and for storing the serum. Urine test A urine sample was collected from the nickel-exposed workers in metal-free polyethylene bottles at the end of the week at the end of a shift after 6 days working with a normal 8-hour working day and a 48-hour working week. The digested samples were measured for nickel using the method of Andersen et al. [13] and  inductively coupling plas- ma-emission spectroscopy (Plasma400  emission spectrophotometer, Perkin Elmer). The standardization of nickel was done using standard solutions of 0  to 30 mg/L (Buck Scientific). The inter- nal standard of nickel 3 mg/L was added to urine and analysed and the recovery was found to be 98%. Nickel levels were  reported as mg per g creatinine to allow for variations in urine dilution. Urinary nickel was standardized with urinary creatinine concentrations measured by the Jaffe reaction method developed by Husdan et al. [14]. Blood tests Samples of 5 mL whole blood were collected in test-tubes at the end of the working week at the same time as urine sampling. Sample collection followed the guidelines described by Cornelis et al. [15]. Serum was separated by centrifuga- tion at 2500 rpm for 20 min at 25 °C. The collected serum was used to assess liver function using standard methods [16–18]. All  the biochemical  markers were estimated using a random access analyser (RA-50, Bayer). Serum ALT and AST were used to assess hepatic inflammation (kits supplied by Human Gesellschaft für Biochemica und Diagnostica). Alka- line phosphatase (ALP) and SGGT were used to assess chlolestasis (kits supplied by Chema Diagnostica). The determination of serum total bilirubin was used to assess hepatic clearance (kits produced by Diamond Diagnos- tic). The determination of serum total protein and albumin was used to as- sess synthetic function of liver (protein kits produced by Chema Diagnostica; albumin kits by Human Gesellschaft für Biochemica und Diagnostica). For internal quality control human-based control  sera were used (QN.0050CH,  Chema Diagnostica). Statistical analysis Numerical data were expressed as mean and standard deviation (SD). Student t-test was used to compare the mean levels of parameters between the nickel- exposed and reference groups. The chi- squared test was used to compare the abnormal frequencies of liver function tests between groups. Pearson correla- tion coefficient was used to find the Book 17-6.indb 491 6/6/2011 9:44:50 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 492 association between urine nickel levels and liver function indicators. The level of statistical significance was established at 0.05 with a statistical power of 80%. Results Some background parameters of the nickel-exposed and reference groups are presented in Table 1. Due to the match- ing, the mean age of nickel-exposed and reference workers were similar at 41.5 (SD 2.1) and 42.4 (SD 1.9) years  respectively. The nickel workers had been working in the nickel industry for  a mean duration of 13.4 (SD 2.5)  years. The mean level of urine nickel was significantly higher in nickel-exposed workers than the reference group [14.9 (SD  0.3)  versus  3.3  (SD  0.1) mg/g  creatinine respectively] (P < 0.001). The results of liver function tests in nickel-exposed workers and reference workers are presented  in Table 2. The  mean level of ALT was significantly higher in the nickel-exposed workers compared with the reference group [101.2 (SD 6.0) IU/L versus 30.1 (SD  0.6) IU/L respectively] (P < 0.01). The  AST level was also significantly higher [84.4 (SD 5.7)  IU/L versus 21.4 (SD  0.3) respectively] (P < 0.01). The mean  levels of serum ALP, SGGT and serum total bilirubin were higher in the nickel- exposed than the reference workers but the difference was not statistically sig- nificant. Total protein and serum albu- min levels were lower in nickel-exposed workers than the reference group, but not significantly so. Table 3 presents the correlation co- efficients between urine nickel and liver function indicators among the study subjects. Positive significant correlation coefficients were found between the levels of serum ALT, AST and SGGT and urine nickel levels (P < 0.01). The  association between urine nickel and serum albumin was also significant (P < 0.05). The distribution of abnormal fre- quencies of liver function among nickel- exposed workers and the reference group was assessed using mean values and 95th percentiles of AST, ALT, ALP, SGGT and total bilirubin and 5th percentiles for serum total protein and the serum albumin. Table 4 shows the distribution of abnormal frequencies of liver function tests in the study subjects. Discussion Nickel is a widely distributed metal that is industrially applied in many forms. The level of nickel in urine is considered a biomarker of nickel exposure [19]. In  our study the levels of urine nickel were significantly increased in nickel-plating factory workers compared with a refer- ence group of administrative workers. Similar results were found in studies on nickel-plating workers in Finland and India [20,21].  Table 1 Age, duration of exposure and urine nickel level of the nickel-exposed and reference groups Characteristics Reference group workers (n = 30) Nickel-exposed workers (n = 25) Mean SD Mean SD Age (years) 42.4 1.9 41.5 2.1 Duration of nickel exposure (years) 0.0 – 13.4 2.5 Urine nickel level (mg/g creatinine) 3.3 0.1 14.9 0.3* **P < 0.001. SD = standard deviation. Table 2 Serum liver function markers of the nickel-exposed and reference groups Variable Reference group workers (n = 30) Nickel-exposed workers (n = 25) Mean SD Mean SD ALT (IU/L) 30.1 0.6 101.2 6.5** AST (IU/L) 21.4 0.3 84.4 5.7** Total protein (g/dL) 6.38 0.10 5.89 0.11 Albumin (g/dL) 3.65 0.07 2.96 0.05 Total bilirubin (mg/dL) 0.48 0.12 1.11 0.05 ALP (IU/L) 89.6 5.1 109.2 8.4 SGGT (IU/L) 35.9 1.6 68.5 2.2 **P < 0.01. SD = standard deviation; ALT = alanine aminotransferase; AST = aspartate aminotransferase; ALP = alkaline phosphatase; SGGT = serum gamma-glutamyl- transpeptidase. Book 17-6.indb 492 6/6/2011 9:44:50 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 493 raised, but not significantly, compared with a control group [21]. Sidhu et al.  found an increase of ALP and ALT en- zyme activity in rats treated with nickel sulphate [7]. Serum total bilirubin, a marker of hepatic clearance, was also higher in the nickel-exposed workers compared to the reference group, but not sig- nificantly so. The mean levels of liver function tests of the present study were similar to Kalahasthi et al.’s findings for nickel-plating workers in India [21]. The  results also agree with Sunderman et al. who reported a mild transient hyper- bilirubinaemia in workers with acute exposure to nickel compounds [9].  The markers of synthetic function, i.e. serum total protein and albumin, were lower in nickel-exposed workers than the reference group, but these too were not The markers of liver inflammation, i.e. serum ALT and AST levels, were significantly higher in nickel-exposed workers compared with the reference group. These results are in agreement with others, who found that nickel increased ALT enzyme activity in hu- mans  [22]. Animal  studies  also  show  significantly increased activity of se- rum ALT and AST enzymes following nickel treatment, which are indicative of damage to the liver parenchyma [7,8,23,24]. The markers of cholestasis, i.e. levels of serum ALP and SGGT, were higher in nickel-exposed workers compared with the reference group but the differ- ence was not statistically significant. Our results are in agreement with Kalahasthi et al.’s study of nickel-plating workers in which blood levels of SGGT were Table 3 Correlation between liver function markers and urine nickel levels of the nickel-exposed and reference groups Variable Correlation coefficient (r) Urine Ni ALT AST Total protein Albumin Total bilirubin ALP SGGT Urine Ni 1.00 ALT 0.63** 1.00 AST 0.73** 0.65** 1.00 Total protein –0.47 –0.34 –0.72 1.00 Albumin –0.40* –0.36 –0.74 0.75** 1.00 Total bilirubin 0.31 0.59 0.57 –0.32 0.41 1.00 ALP 0.30 0.58* 0.56* –0.31 0.38 0.99 1.00 SGGT 0.47** 0.65** 0.80* –0.49 0.56 0.85 0.83 1.00 *P < 0.05; **P < 0.01 Ni = nickel; ALT = alanine aminotransferase; AST = aspartate aminotransferase; ALP = alkaline phosphatase; SGGT = serum gamma-glutamyl-transpeptidase.. Table 4 Frequency of workers with abnormal liver function tests in the nickel-exposed and reference groups Variable Reference group workers (n = 30) Nickel-exposed workers (n = 25) No. % No. % ALT (IU/L) 3 10.0 5 20.0 AST (IU/L) 3 10.0 5 20.0 Total protein (g/dL) 1 3.3 1 4.0 Albumin (g/dL) 1 3.3 1 4.0 Total bilirubin (mg/dL) 2 6.7 1 4.0 ALP (IU/L) 2 6.7 3 12.0 SGGT (IU/L) 1 3.3 1 4.0 ALT = alanine aminotransferase; AST = aspartate aminotransferase; ALP = alkaline phosphatase; SGGT = serum gamma-glutamyl-transpeptidase. significant. In human and animal studies nickel has been shown to bind to albu- min and to specific alpha-glycoproteins, which may explain its hepatic and renal toxicity [25,26]. Alveolar proteinosis has  been shown in animal studies of inhaled nickel oxide [27]. In summary, we found that liver func- tion was compromised in nickel-plating workers compared with a reference group of workers with no occupational exposure to nickel. Our findings agree with studies of nickel-plating workers in other countries and with data on nickel- induced hepatotoxicity from animal studies. We recommend that workers who may be exposed to toxic levels of nickel should be monitored in a system- atic programme of medical surveillance that is designed to prevent occupational injury and disease. Book 17-6.indb 493 6/6/2011 9:44:51 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 494 References Duda-Chodak A, Baszczyk U. The impact of nickel on human 1. health. Journal of Elementology, 2008, 13:685–696. Das KK, Das SN, DasGupta S. The influence of ascorbic acid 2. on nickel-induced hepatic lipid peroxidation in rats. Journal of Basic and Clinical Physiology and Pharmacology, 2001, 12:187–195. Das KK, Buchner V. Effect of nickel exposure on peripheral 3. tissues: role of oxidative stress in toxicity and possible protec- tion by ascorbic acid. Reviews on Environmental Health, 2007, 22:157–173. Nickel. Chapter 6.10. In: 4. Air quality guidelines for Europe, 2nd ed. Copenhagen, World Health Organization Regional Office for Europe, 2000 Kelleher P, Pacheco K, Newman LS. Inorganic dust pneumo-5. nias: the metal-related parenchymal disorders. Environmental Health Perspectives, 2000, 108(Suppl. 4):685–696. Sunderman F W Jr. Nasal toxicity, carcinogenicity and olfac-6. tory uptake of metals. Annals of Clinical and Laboratory Science, 2001, 31:3–24. Sidhu P et al. Role of zinc in regulating the levels of hepatic ele-7. ments following nickel toxicity in rats. Biological Trace Element Research, 2004, 102:161–172. Sidhu P, Garg ML, Dhawan DK. Protective role of zinc in nickel 8. induced hepatotoxicity in rats. Chemico-Biological Interactions, 2004, 150:199–209. Sunderman FW et al. Acute nickel toxicity in electroplating 9. workers who accidentally ingested a solution of nickel sulfate and nickel chloride. American Journal of Industrial Medicine, 1988, 14:257–266. Sunderman FW et al. Biological monitoring of nickel. 10. Toxicol- ogy and Industrial Health, 1986, 2:17–78. Sunderman FW. Chemistry, analysis, and monitoring. In: Mai-11. bach HI, Menné T, eds. Nickel and the skin: immunology and toxicology. Boca Raton, Florida, CRC Press, 1989:1–9. Pizent A et al. Analysis of reference materials for serum copper 12. and zinc by flame atomic absorption spectrometer. Atomic Spectroscopy, 1996, 17(2):88. Andersen I, Torjussen W, Zachariasen H. Analysis for nickel in 13. plasma and urine by electrothermal atomic absorption spec- trometry, with sample preparation by protein precipitation. Clinical Chemistry, 1978, 24:1198–1202. Husdan H, Rapoport A. Estimation of creatinin in the Jaffe 14. reaction. A comparison of three methods. Clinical Chemistry, 1968, 14:222–238. Cornelis R et al. Sample collection guidelines for trace ele-15. ments in blood and urine. Pure and Applied Chemistry, 1995, 67(8/9):1575–1608. Ješi R et al. Modern functional diagnostics in liver disease. 16. Review article. Archives of Gastroenterohepatology, 2001, 20(1/2):35–38. Moseley RH. Evaluation of abnormal liver function tests. 17. Medi- cal Clinics of North America, 1996, 80:887–906. Morgan DJ et al. Quantitative liver function test: a realizable 18. goal. Canadian Journal of Gastroenterology, 1991, 5:77–85. Oliveira JP, de Siqueira ME, da Silva CS. Urinary nickel as 19. bioindicator of workers’ Ni exposure in a galvanizing plant in Brazil. International Archives of Occupational and Environmental Health, 2000, 73:65–68. Kiilunen M, Aitio A, Tossavainen A. Occupational exposure 20. to nickel salts in electrolytic plating. Annals of Occupational Hygiene, 1997, 41:189–200. Kalahasthi R, Rajmohan H, Rajan B. Assessment of functional 21. integrity of liver among workers exposed to soluble nickel compounds during nickel plating. Indian Journal of Occupa- tional and Environmental Medicine, 2006, 10:78–81. Sunderman FW. Biological monitoring of nickel in humans. 22. Scandinavian Journal of Work, Environment and Health, 1993, 19(Suppl. 1):34–38. Misra M, Rodriguez RE, Kasprzak KS. Nickel induced lipid 23. peroxidation in the rat: correlation with nickel effect on anti- oxidant defense systems. Toxicology, 1990, 64:1–17. Bersényi A et al. Effects of nickel supply on the fattening 24. performance and several biochemical parameters of broiler chickens and rabbits. Acta Veterinaria Hungarica, 2004, 52:185–197. Sunderman FW Jr. A review of the metabolism and toxicol-25. ogy of nickel. Annals of Clinical and Laboratory Science, 1977, 7:377–398. Templeton DM. Interaction of toxic cations with the glomeru-26. lus: binding of Ni to purified glomerular basement membrane. Toxicology, 1987, 43:1–15. Takenaka S et al. Alveolar proteinosis induced in rats by 27. long-term inhalation of nickel oxide. In: Brown SS, Sunderman FW, eds. Progress in nickel toxicology. Proceedings of the 3rd. International Congress on Nickel Metabolism and Toxicology. Oxford, Blackwell, 1985:89–92. Book 17-6.indb 494 6/6/2011 9:44:51 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 495 Acute kidney injury after cardiac surgery in eastern Saudi Arabia A.M. Alkhunaizi,1 S.S.A. Shah,2 U.S. Wesslen,2 Z.A. Al Sadah 3 and A. Antony 4 ABSTRACT Acute kidney injury is a serious complication after cardiac surgery. This study was conducted to determine the frequency of acute kidney injury and the associated risk factors following cardiac surgery at Dhahran health centre in eastern Saudi Arabia. All patients who underwent cardiac surgery between June 2005 and December 2008 were included. Of 293 patients who fulfilled the criteria and were included in the final analysis, 85 (29.0%) developed acute kidney injury. Using multivariate analysis, the factors significantly associated with acute kidney injury were age, diabetes, preoperative chronic kidney disease and emergent surgery. Mortality associated with acute kidney injury was 10.5% overall and 42.9% when dialysis was required. Acute kidney injury following cardiac surgery is a serious problem among patients in eastern Saudi Arabia. Measures to prevent this complication are essential. 1Internal Medicine Services Division; 2Surgical Services Division; 3Nursing Services Department; 4Epidemiology Services Unit, Preventive Medicine Services Division, Dhahran Health Centre, Dhahran, Saudi Arabia (Correspondence to A.M. Alkhunaizi: ahmed.khunaizi@aramco.com). Received: 15/9/09; accepted: 25/11/09 ةيدوعسلا ةيبرعلا ةكلملما نم ةيقشرلا ةقطنلما في بلقلا ةحارج دعب ةيلكلا في ةدالحا ةباصلإا نيوتنأ جارلمأ ،ةداسلا يولع بنيز ،نلسيو نفس فلوأ ،هاش راكهاش ديس ،يزينلخا روصنم دحمأ لماوعو ةباصلإا هذه رُتاوت ديدحتل ةساردلا هذه تيرجأ دقو .بلقلا ةحارلج ةيرطلخا تافعاضلما ىدحإ ةيلكلا في ةدالحا ةباصلإا دعت :ةصلالخا في نوثحابلا جردأ دقو .ةيدوعسلا ةيبرعلا ةكلملما نم ةيقشرلا ةقطنلما في يحصلا نارهظلا زكرم في ،بلقلا في ةحارج ءارجإ دعب اله ةبحاصلما راطتخلاا ًاضيرم 293 فىوتسا دقو .2008 برمسيد/لولأا نوناكو 2005 وينوي/ناريزح ْيَرهش ينب بلقلا في ةحارج مله تيرجأ نيذلا ضىرلما عيجم ةساردلا د ِّدعتلما ليلحتلا يرجُأ امدنعو .ةيلكلا في ةداح ةباصإ اوبيصأ دق )%29.0( ًاضيرم 85 نأ ينبتو ،اله يئاهنلا ليلحتلا في اوجردأو ةساردلا يرياعم مهنم ،ةحارجلل قباسلا نمزلما يولكلا ضرلماو ،ّيرّكسلاو ،رمعلا يه ةيلكلا في ةدالحا ةباصلإاب اهطابتراب ًايئاصحإ ُّردتعُي يتلا لماوعلا نأ ينبت تا ِّيرغتلما لىعو .لاَي ِّدلا لىإ ةجاتحلما تلاالحا في %42.9و ،تلاالحا لمُمج في %10.5 ةيلكلا في ةدالحا ةباصلإاب ةطبترلما تايفولا ل َّدعم ناكو .ةئراطلا ةحارلجاو نمو .ةيدوعسلا ةيبرعلا ةكلملما نم ةيقشرلا ةقطنلما في ضىرلما ينب ةيرطخ ةلكشم برتعت بلقلا ةحارلج ةيلاتلاو ةيلكلا في ةدالحا ةباصلإا نإف ،اذه .ةفعاضلما هذه نم ةياقولل يربادتلا ذاتخا يروضرلا Lésion rénale aiguë après chirurgie cardiaque dans l’est de l’Arabie saoudite RÉSUMÉ Une atteinte rénale aiguë représente une complication grave après une chirurgie cardiaque. La présente étude a été conduite afin de déterminer la fréquence des atteintes rénales aiguës et les facteurs de risque associés après une chirurgie cardiaque à l’hôpital de Dhahran dans l’est de l’Arabie saoudite. Tous les patients ayant eu une cardiochirurgie entre juin 2005 et décembre 2008 ont été inclus dans l’étude. Sur 293 patients répondant aux critères et inclus dans l’analyse finale, 85 (29,0 %) souffraient d’une atteinte rénale aiguë. Les facteurs fortement associés à une atteinte rénale aiguë, dégagés aux moyens d’une analyse multivariée, étaient l’âge, un diabète, une maladie rénale chronique préopératoire et une chirurgie d’urgence. Le taux de mortalité associé à une atteinte rénale aiguë était de 10,5 % toutes catégories confondues et de 42,9 % en cas de dialyse. Les atteintes rénales aiguës après une chirurgie cardiaque constituent un problème grave chez les patients dans l’est de l’Arabie saoudite. Des mesures destinées à prévenir cette complication sont essentielles. Book 17-6.indb 495 6/6/2011 9:44:51 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 496 Introduction Acute kidney injury (AKI) is a serious complication following cardiac surgery affecting up to 30% of patients [1–3]. It  is associated with a high morbidity and mortality, especially when renal replace- ment  therapy  is  required [4–6]. Some  studies have documented that even a small decline in glomerular filtration rate may have a detrimental impact on patients’ outcome [7]. The prevalence and risk factors of AKI among the Saudi population are not known. Most of the earlier stud- ies from developed countries that ad- dressed AKI after cardiac surgery used a rather gross definition of AKI, such as an increase of serum creatinine level ≥ 50%  above baseline or the need for renal replacement therapy. In this study in a major hospital in eastern Saudi Arabia we looked at the incidence of AKI fol- lowing cardiac surgery using the stricter definition of the Acute Kidney Injury Network (AKIN) [8,9] and evaluated  some of the risk factors associated with the development of AKI. Risk stratifi- cation prior to cardiac surgery should predict the development of AKI with the hope of preventing the condition and/or modifying its course. Methods Study design A case–control  study was carried out  on 325 patients who underwent open- heart surgery at Dhahran health centre in eastern Saudi Arabia between June 2005  and December  2008. The data  were collected using the anaesthesia services division’s database and the com- puterized patient database at Dhahran health centre. The database was created to record information about all patients who underwent open-heart surgery, including: type of surgery, number of grafts used, cardiopulmonary bypass time and aortic crossclamp time. The great majority of patients studied were Saudi citizens drawn from different tribes in Saudi Arabia. Exclusion criteria were: death within 24 hours postopera- tively, incomplete patient data, preex- isting renal failure requiring dialysis, a baseline serum creatinine ≥ 4 mg/dL or reoperation: 32 patients did not meet  the criteria and were excluded from the analysis, leaving 293 patients who were  included in the final analysis. Definitions The primary outcome was the development of AKI during the first postoperative week. All patients had their serum creatinine level measured preoperatively. Acute kidney injury was defined as an increase in serum creati- nine of ≥ 0.3 mg/dL above baseline that  persisted for more than 48 hours. Serum creatinine was checked on admission to the surgical intensive care unit and repeated at least every 24 hours. Serum  creatinine was measured by enzymatic assay (Viros 5.1/FS, Ortho-Clinical Diagnostics). Chronic kidney disease was defined as a chronic elevation of serum creatinine ≥ 1.5 mg/dL preop- eratively. Left ventricular dysfunction (LVD) was defined as an ejection frac- tion of ≤ 40%, assessed preoperatively  by echocardiography, radiocontrast ventriculography or radio nucleotide ventriculography. Chronic obstructive pulmonary disease (COPD) was de- fined as functional disability and/or hospitalization, chronic bronchodilator therapy or nicotine  smoking of  ≥ 20  packs-years. Patients were considered to have diabetes mellitus if they were using insulin and/or oral hypoglycaemic agents at the time of surgery. Operative mortality was defined as death during the index hospitalization. The following variables were stud- ied: age, sex, presence of diabetes mel- litus, presence of chronic kidney disease, presence of underlying LVD, presence of COPD, type of cardiac surgery [coro- nary artery bypass graft (CABG), valve surgery, combined CABG and valve procedures and other procedures such as ventricular aneurysm repair, pericar- diectomy, etc.] and whether the surgery  was performed electively or as an emer- gent procedure. Surgery was performed either off-pump or on cardiopulmonary bypass according to our institutional standards. Statistical analysis The association between baseline and intraoperative variables, and the development of AKI were assessed by logistic regression. Variables that were significantly associated with the devel- opment of AKI were also included in a multivariate logistic model. Means were expressed as ± 1 standard deviation (SD). Odds ratios (OR) were expressed together with 95% confidence  interval  (CI) and associated P-values. A P-value of < 0.05 was considered significant. The  statistical software SPSS,  version 15.0,  was used for the statistical analyses. Results Background characteristics of the cohort The great majority of  the 293 patients  were Saudi citizens (269, 91.8%) with  a mean age of 59 (SD 15) years, range 14–80 years. There were 224 (76.5%)  male patients [mean age 58.4 (SD 12.0) years, range 14–80 years] and 69  females  (23.5%) [mean age 63.0 (SD  9.8) years,  range 43–81 years] (Table  1). The clinical characteristics of the patients showed that 192 (65.5%) had  diabetes mellitus and 43 (14.7%) had  LVD. A total of 18 patients (6.1%) had  underlying chronic kidney disease and 83 (28.3%) had underlying COPD. The operative characteristics of the sample showed that the great majority (272, 92.8%) were elective cases for heart  surgery; only 21 (7.2%) were emergent  cases (Table 1). Most (266, 90.8%) had  coronary artery bypass grafting and 27  (9.2%) had other surgeries. There were  282 patients (96.2%) who had surgery  performed on pump, while 11 (3.8%)  Book 17-6.indb 496 6/6/2011 9:44:51 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 497 had the surgery done off-pump. The mean cardiopulmonary bypass time was 109 (SD 152) min and the mean aortic  crossclamp time was 66 (SD 46) min. Variables associated with acute kidney injury AKI was diagnosed in 85 patients (29.0%)  out  of  the  entire  cohort.  Among the different variables age, presence of diabetes mellitus, LVD and chronic kidney disease were found to be associated with a high risk of developing AKI (Table 1). In addition, AKI was more common among patients who underwent emergent surgery and or had a prolonged bypass time. The mean age of patients who developed AKI was 63 years compared with 58 years in the rest of the group. Using multivariate analysis, age (OR = 1.68, 95% CI: 1.30–2.20), pres- ence of diabetes mellitus (OR = 0.47,  95% CI:  0.24–0.91),  chronic  kidney  disease (OR = 0.15, 95% CI: 0.05–0.50)  and emergent surgery (OR = 0.21, 95%  CI: 0.07–0.61) were independently as- sociated with the development of AKI (Table 2). There was a  linear associa- tion between age and risk of developing AKI (Figure 1). Seven patients (2.4%)  required renal replacement therapy, either as haemodialysis or continuous renal replacement therapy. A total of 9 patients died, corre- sponding to an overall mortality rate of Table 1 Baseline and intraoperative variables associated with acute kidney injury after cardiac surgery Variable Acute kidney injury No acute kidney injury Crude OR (95% CI) P-value No. % No. % Age group (years) < 50 7 12.3 50 87.7 50–59 24 25.8 69 74.2 2.48 (0.92–6.92) 0.047 60–69 23 32.4 48 67.6 3.42 (1.25–9.73) 0.008 70+ 31 43.1 41 56.9 5.40 (2.00–15.1) < 0.001 Sex Male 66 29.5 158 70.5 1.10 (0.60–2.00) 0.758 Female 19 27.5 50 72.5 Bypass surgery On-pump 83 29.4 199 70.6 1.88 (0.40–8.87) 0.427 Off-pump 2 18.2 9 81.8 Bypass surgery duration (min) < 100 42 24.7 128 75.3 > 100 41 36.6 71 63.4 1.76 (1.10–3.00) 0.032 Aortic crossclamp duration (min) < 50 27 26.5 75 73.5 > 50 56 31.1 124 68.9 1.25 (0.7–2.2) 0.411 Case urgency Elective 72 26.5 200 73.5 Emergent 13 61.9 8 38.1 4.51 (1.80–11.3) < 0.001 Left ventricular dysfunction Yes 18 41.9 25 58.1 1.95 (1.00–3.80) 0.048 No 67 27.0 181 73.0 Diabetes mellitus Yes 65 33.9 127 66.1 1.95 (1.10–3.50) 0.022 No 20 20.8 76 79.2 Chronic kidney disease Yes 14 77.8 4 22.2 9.76 (3.10–30.6) < 0.001 No 71 26.4 198 73.6 Chronic obstructive pulmonary disease Yes 21 25.3 62 74.7 1.29 (0.70–2.30) 0.379 No 64 30.5 146 69.5 OR = odds ratio; CI = confidence interval. Book 17-6.indb 497 6/6/2011 9:44:52 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 498 3.1%. Among patients who developed  AKI, mortality was 9/85 (10.5%). Mor- tality among patients who had renal replacement therapy was even higher at 3/7 (42.9%). Discussion Dhahran health centre is one of the main hospitals in Saudi Arabia’s Eastern province, providing primary and/or ter- tiary care  to around 400 000  individu- als. The cardiac surgery programme, established  in 2005,  is  a new addition  to the services of the health centre. This study was performed to evaluate the development of AKI after cardiac sur- gery, to identify the risk factors that lead to AKI among our patient population and to compare this with international standards. Although the best measure of renal function is glomerular filtration rate, this is not practical to perform in the context of AKI. There are currently no sensitive and specific markers to de- tect renal injury in clinical practice, and serum creatinine remains the most used indicator of renal injury. The reported incidence of AKI after cardiac surgery varies in the literature, with  a  range  of  1%–30%,  depending  on the definition of AKI. Chertow et al. analysed data from 42 773 patients who  underwent cardiac surgery and found an overall incidence of AKI requiring dialysis of 1.1%. The  incidence of AKI  requiring dialysis in patients who had valvular and combined CABG/valvular surgery was higher  at  1.7% and 3.3%  respectively  [6]. Most  of  the  earlier  studies that addressed AKI used a loose definition, such as a rise in serum cre- atinine of 1.0 mg/dL or greater above  baseline, a 50% increase in serum creati- nine or the need for renal replacement therapy  [1–3,5,6,10–22]. Unlike our  study, these studies most likely excluded patients who had a lesser degree of renal dysfunction. There is emerging evidence that a minor increase in serum creatinine is associated with adverse outcomes [12,23–25].  In our  study we  chose  a  rather strict criterion for AKI with a cutoff increase in serum creatinine of ≥ 0.3 mg/dL above baseline, in accord- ance with the recommendations of the AKIN [8,9]. This explains the relatively  high incidence of AKI in our population (29.0%) compared with other  studies  [1–3,5,6,10–22]. There  is, however,  a  genetic variation in the susceptibility of individuals to renal injury [26,27]. Some  investigators have found that in patients undergoing cardiac surgery, carriers of the APOE e4 allele had a decreased risk of AKI compared with non-carriers [28,29]. Until now, our knowledge of  the genetic polymorphism of AKI is still limited. In the future, a better charac- terization of genetic predisposition to AKI may enhance risk prediction. Is the Saudi population at increased risk for developing AKI compared with other nations? This is not clear since we do not have data about the genetic makeup of our population, and this is an impor- tant area to explore in future studies. The pathogenesis of renal injury following cardiac surgery is not well understood. It has been divided into preoperative events, intraoperative events and postoperative events; all are related either to impaired renal per- fusion or decreased renal  reserve [19].  Both haemodynamic and inflamma- tory factors interact at a cellular level that ultimately lead to the development of acute tubular necrosis, which is manifested as a rise in serum creatinine and decreased urine output. Several risk factors have been identified as be- ing associated with the development of AKI after cardiac surgery, such as Table 2 Multivariate analysis of risk factors associated with the development of acute kidney injury following cardiac surgery Variable Adjusted OR (95% CI) P-value Age 1.68 (1.30–2.20) < 0.001 Bypass duration 0.61 (0.34–1.09) 0.095 Emergent surgery 0.21 (0.07–0.61) 0.004 Left ventricular dysfunction 0.59 (0.36–1.30) 0.190 Diabetes mellitus 0.47 (0.24–0.91) 0.026 Chronic kidney disease 0.15 (0.05–0.50) 0.002 Chronic obstructive pulmonary disease 1.24 (0.64–2.40) 0.527 OR = odds ratio; CI = confidence interval. Figure 1 Acute kidney injury (AKI) after surgery by patient’s age Book 17-6.indb 498 6/6/2011 9:44:52 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 499 female sex, presence of COPD, diabetes mellitus, peripheral vascular disease, renal insufficiency and congestive heart failure, valve surgery, need for emergent surgery, cardiogenic shock requiring intra-aortic balloon, left main coronary artery disease, length of cardio- pulmonary bypass, crossclamp time, off-pump versus on-pump surgery, non- pulsatile flow, haemolysis and haemo- dilution [19,30–32]. In our study, sever- al but not all of these factors were found to be associated with the development of AKI. Both population size and patient characteristics may have contributed to the difference between our findings and those reported in earlier studies. There is a high morbidity and mor- tality associated with AKI after cardiac surgery. Depending on the definition of AKI and the postoperative period studied (whether time to hospital dis- charge or 30 days mortality),  the mor- tality rate has been shown to range from 15%–30%  [19]. Among our patients  who developed AKI, the mortality rate was 10.5%, considerably less than what  has been reported in other studies [19].  In addition to the high morbidity and mortality associated with AKI, the cost of treatment of this complication, espe- cially when renal replacement therapy is required, is very high. Despite all the research in the field, there is currently no effective treatment for AKI, with the exception of supportive measures that include identification of high-risk patients, optimization of renal perfusion and avoidance of nephrotoxins [19]. Pharmacological  treatment with  atrial natriuretic peptide, fenoldopam, N-acetylcysteine, statins and clonidine have only shown modest results in small trials  [19,33]. Therefore  it  is  important  to identify and recognize the risk factors that predispose individuals to AKI in order to take the necessary measures to prevent it or modify its course. Several groups have developed clinical scoring systems to help predict the risk for AKI after cardiac surgery [31,32,34].  In our  study we identified certain factors that led to the development of AKI: age, diabetes mellitus, chronic kidney disease and emergent surgery. Other factors pre- viously reported to be associated with a higher incidence of AKI, e.g. peripheral vascular disease and COPD, were not found to be significant in our population, possibly due to the small number of patients included in this study. This study has several limitations, including the single-centre data, the relatively small number of patients and the retrospective observational design. However, the study sheds light on some of the risk factors that lead to AKI among the Saudi population, with the hope that timely recognition of these condi- tions will lead to better surveillance and monitoring, which may impact posi- tively on the overall outcome of patients undergoing open-heart surgery. Acknowledgements The authors acknowledge the use of Saudi Aramco Medical Services Or- ganization (SAMSO) facilities for the research data used in this article. The opinions expressed in this article are those of the authors and not necessarily of SAMSO. References Bellomo R. Defining, quantifying, and classifying acute renal 1. failure. Critical Care Clinics, 2005, 21:223–237. Bellomo R, Raman J, Ronco C. Intensive care unit management 2. of the critically ill patient with fluid overload after open heart surgery. Cardiology, 2001, 96:169–176. Haase M et al. Cardiopulmonary bypass-associated acute kid-3. ney injury: a pigment nephropathy? Contributions to Nephrol- ogy, 2007, 156:340–353. Alkhunaizi AM, Schrier RW. Management of acute renal fail-4. ure: new perspectives. American Journal of Kidney Diseases, 1996, 28:315–328. Zanardo G et al. Acute renal failure in the patient undergoing 5. cardiac operation. Prevalence, mortality rate, and main risk factors. Journal of Thoracic and Cardiovascular Surgery, 1994, 107:1489–1495. Chertow GM et al. Independent association between acute 6. renal failure and mortality following cardiac surgery. American Journal of Medicine, 1998, 104:343–348. Lassnigg A et al. Minimal changes of serum creatinine predict 7. prognosis in patients after cardiothoracic surgery: a prospec- tive cohort study. Journal of the American Society of Nephrology, 2004, 15:1597–1605. Mehta RL et al.; Acute Kidney Injury Network. Report of an 8. initiative to improve outcomes in acute kidney injury. Critical Care (London, England), 2007, 11:R31. Molitoris BA et al.; Acute Kidney Injury Network working 9. group. Improving outcomes of acute kidney injury: report of an initiative. Nature Clinical Practice. Nephrology, 2007, 3:439–442. Bellomo R et al. The pathophysiology of cardiac surgery-10. associated acute kidney injury (CSA-AKI). International Journal of Artificial Organs, 2008, 31:166–178. Dimov V et al. Who is at risk for developing acute renal failure 11. after surgery? IMPACT consults. Proceedings of the 2nd An- nual Cleveland Clinic Perioperative Medicine Summit. Cleve- land Clinic Journal of Medicine, 2006, 73 (Electronic Suppl. 1):S12–S13. Gruberg L et al. The prognostic implications of further renal 12. function deterioration within 48 h of interventional coronary procedures in patients with pre-existent chronic renal insuf- ficiency. Journal of the American College of Cardiology, 2000, 36:1542–1548. Hoste EA et al. The epidemiology of cardiac surgery-associat-13. ed acute kidney injury. International Journal of Artificial Organs, 2008, 31:158–165. Kochi AC et al. Preoperative risk factors for the development 14. of acute renal failure in cardiac surgery. Revista Brasileira de Cirurgia Cardiovascular; Orgao Oficial da Sociedade Brasileira de Cirurgia Cardiovascular, 2007, 22:33–40. Bellomo R et al.; Acute Dialysis Quality Initiative workgroup. 15. Acute renal failure - definition, outcome measures, animal Book 17-6.indb 499 6/6/2011 9:44:52 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 500 models, fluid therapy and information technology needs: the Second International Consensus Conference of the Acute Dialysis Quality Initiative (ADQI) Group. Critical Care (London, England), 2004, 8:R204–R212. Lombardi R, Ferreiro A. Risk factors profile for acute kidney 16. injury after cardiac surgery is different according to the level of baseline renal function. Renal Failure, 2008, 30:155–160. Palomba H et al. Acute kidney injury prediction following elec-17. tive cardiac surgery: AKICS score. Kidney International, 2007, 72:624–631. Ronco C, Kellum JA, Bellomo R. Cardiac surgery-associated 18. acute kidney injury. International Journal of Artificial Organs, 2008, 31:156–157. Lameire N, Van Biesen W, Vanholder R. Acute renal failure. 19. Lancet, 2005, 365:417–430. Schetz M et al. Prevention of cardiac surgery-associated acute 20. kidney injury. International Journal of Artificial Organs, 2008, 31:179–189. Tolwani A et al. Treatment of patients with cardiac surgery 21. associated-acute kidney injury. International Journal of Artificial Organs, 2008, 31:190–196. Vaschetto R, Groeneveld AB. An update on acute kidney injury 22. after cardiac surgery. Acta Clinica Belgica. Supplementum, 2007, (2):380–384. Chertow GM et al. Acute kidney injury, mortality, length of 23. stay, and costs in hospitalized patients. Journal of the American Society of Nephrology, 2005, 16:3365–3370. Levy MM et al. Early changes in organ function predict even-24. tual survival in severe sepsis. Critical Care Medicine, 2005, 33:2194–2201. Praught ML, Shlipak MG. Are small changes in serum creatinine 25. an important risk factor? Current Opinion in Nephrology and Hypertension, 2005, 14:265–270. Lu JC et al. Translational Research Investigating Biomarkers 26. and Endpoints for Acute Kidney Injury (TRIBE-AKI) Consor- tium. Searching for genes that matter in acute kidney injury: a systematic review. Clinical Journal of the American Society of Nephrology, 2009, 4:1020–1031. Haase-Fielitz A et al. Genetic polymorphisms in sepsis- and 27. cardiopulmonary bypass-associated acute kidney injury. Con- tributions to Nephrology, 2007, 156:75–91. Chew ST et al. Preliminary report on the association of apoli-28. poprotein E polymorphisms, with postoperative peak serum creatinine concentrations in cardiac surgical patients. Anesthe- siology, 2000, 93:325–331. Isbir SC et al. Genetic polymorphisms contribute to acute kid-29. ney injury after coronary artery bypass grafting. Heart Surgery Forum, 2007, 10:E439–E444. Bellomo R, Kellum JA, Ronco C. Defining and classifying acute 30. renal failure: from advocacy to consensus and validation of the RIFLE criteria. Intensive Care Medicine, 2007, 33:409–413. Thakar CV et al. A clinical score to predict acute renal failure 31. after cardiac surgery. Journal of the American Society of Nephrol- ogy, 2005, 16:162–168. Chertow GM et al. Preoperative renal risk stratification. 32. Circula- tion, 1997, 95:878–884. Kandula P. Statins in perioperative prevention of acute kidney 33. injury in patients undergoing cardiac surgery. European Heart Journal, 2009, 30:250. Eriksen BO, Hoff KR, Solberg S. Prediction of acute renal fail-34. ure after cardiac surgery: retrospective cross-validation of a clinical algorithm. Nephrology, Dialysis, Transplantation, 2003, 18:77–81. Book 17-6.indb 500 6/6/2011 9:44:52 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 501 Effect of nutritional intervention on the prevalence of metabolic syndrome and heart disease risk factors in urban Tehran (Tehran Lipid and Glucose Study) A. Ramezankhani,1 P. Mirmiran1 and F. Azizi1 ABSTRACT In a case–control study a nutritional intervention consisting of an educational programme based on the Therapeutic Lifestyle Change diet (TLC) guidelines was implemented in one area of Tehran. Data were collected from subjects in the intervention area (n =133) and controls from another area (n = 183), before and 3.8 years after the intervention. Mean energy and macronutrient intakes and prevalence of risk factors including metabolic syndrome were compared between and within cases and controls. Baseline and follow-up evaluations showed improvement in hypercholesterolemia and high LDL cholesterol levels in cases versus controls. Central obesity and low HDL cholesterol levels increased significantly in controls but not in cases. As there were no significant differences between the 2 groups in energy and macronutrient intakes, it is difficult to claim that nutritional interventions played an important role. 1Research Institute of Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Islamic Republic of Iran (Correspondence to F. Azizi: azizi@erc.ac.ir). Received: 17/05/09; accepted: 19/10/09 ةيضرلحا نارهط قطانم في يبلقلا ضرلما راطتخا لماوع رئاسو ةيبلاقتسلاا ةمزلاتلما راشتنا لىع ةيوذغتلا تلاخدتلا يرثأت )زوكولغلاو تاينهدلل نارهط ةسارد( يزيزع نوديرف ،نايرميرم نيورب ،نياخنازمار ارذأ يئاذغلا ماظنلل ةيداشرلإا لئلادلا لىع ٍّينبم يفيقثت جمانرب نم فلأتي يوذغت لخدت ذيفنت دهاوشلاو تلااحلل ةساردلا هذه في مت دق :ةصلالخا نمو )133 مهددعو( لخدتلا ةقطنم في ةساردلا ةعوممج نم تايطعلما تَعُِجمو .نارهط قطانم نم ةقطنم في ،ةايلحا طمن في يجلاعلا يريغتلا لىع مئاقلا ةيربكلا تايذغلماو ةقاطلا لوانت طسوتم نوثحابلا نراقو .هئارجإ نم تاونس 3.8 دعبو لخدتلا ءارجإ لبق ،)183 مهددعو( ىرخأ ةقطنم في دهاوش ةعباتلماو يدعاقلا ىوتسملل تماييقتلا ترهظأ دقو .دهاوشلاو تلاالحا نم ٍّلك دارفأ في ةيبلاقتسلاا ةمزلاتلما اهيف ماب راطتخلاا لماوع راشتناو رادقلما في دايدزا دهوش ماك .دهاوشلاب ًةنراقم تلاالحا في LDL ةفاثكلا ضفخنلما يمحشلا ينتوبرلا نم ةعفترلما تايوتسلماو مدلا لويرتسلوك طرف في ًانستح لم هنإ ثيحو .تلااحلل ًافلاخ دهاوشلا في ًايئاصحإ هب ُّردتعُي ٍوحن لىع HDL ةفاثكلا عفترلما يمحشلا ينتوبرلا في ضافخناو ةيزكرلما ةنمسلا تلااح تلاخدتلا نأب ءاعدلإا بعصلا نمف ،رادقلما ةيربكلا تايذغلماو ةقاطلا لوخدم ثيح نم ينتعومجلما ينب ًايئاصحإ ابه ُّردتعُي تافلاتخا كانه نكي .كلذ في مهم رود اله ناك دق ةيوَذغتلا Effet d’une intervention nutritionnelle sur la prévalence du syndrome métabolique et sur les facteurs de risque de cardiopathie dans l’agglomération de Téhéran (étude sur le glucose et les lipides réalisée à Téhéran) RÉSUMÉ Dans une étude cas-témoins, une intervention nutritionnelle consistant en un programme éducatif fondé sur les directives du régime de changement thérapeutique de style de vie a été mise en œuvre dans un district de la ville de Téhéran. Des données ont été recueillies auprès de sujets habitant le district de l’intervention (n = 133) et de témoins résidant dans un autre district (n = 183), avant, puis 3,8 années après l’intervention. Les apports énergétiques moyens, les apports moyens en macronutriments et la prévalence des facteurs de risque, notamment le syndrome métabolique, ont été comparés entre les deux groupes et au sein de chaque groupe. Les évaluations du début de l’étude et pendant la période de suivi ont révélé des améliorations dans les taux d’hypercholestérolémie et de cholestérol des lipoprotéines de basse densité pour les sujets ayant bénéficié de l’intervention par rapport aux témoins. L’obésité abdominale et les faibles taux de cholestérol des lipoprotéines de haute densité avaient augmenté de manière importante chez les témoins mais n’avaient pas augmenté dans le groupe sous intervention. En l’absence de différences significatives entre les deux groupes pour les apports énergétiques et les apports en macronutriments, il est difficile d’affirmer que les interventions nutritionnelles jouent un rôle important. Book 17-6.indb 501 6/6/2011 9:44:52 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 502 Introduction Although significant reductions have occurred in the incidence of cardiovas- cular disease (CVD) since the mid- 1970s,  this  is  still  the  primary  cause  of morbidity and mortality in many countries  [1].  Recent  studies  in  the  Islamic Republic of Iran have shown an increasing mortality from CVD, and have found it to be a major health problem which imposes a high burden of disease on  the health system [2–5].  It has been shown that hypertension, hyperlipidaemia, impaired glucose tolerance and diabetes, smoking, and stress are powerful risk factors for CVD. Previous studies in the Tehran Lipid and Glucose study (TLGS) population showed 22% of men and 24% of women  were  hypertensive;  23%  of  the  total  population were hypercholestrolaemic and 4% were hypertriglyceridaemic [6].  Most of these risk factors are linked to lifestyle, in conjunction with excess calorie intake, increased dietary fat consumption and decreased physical activity [7–10]. Additionally,  individu- als with the metabolic syndrome are at high risk of coronary heart disease. The metabolic syndrome is defined as a pattern of disturbances including central obesity, insulin resistance and hypertriglyceridaemia, dyslipidaemia and hypertension [11]. A recent study  showed that the metabolic syndrome is highly prevalent in Tehrani adults, with an estimated prevalence of over 30%  [12],  which  is  higher  than  that  in most developed countries such as the United States of America [13]. It is  thought that genetic, metabolic and en- vironmental factors, including diet, play an important role in its development [14]. The high prevalence of noncom- municable diseases has led to many countries implementing mechanisms for the prevention of these diseases, of which lifestyle modification is a major one  [15,16]. Modifications of dietary  pattern and increased physical activity have been shown to lead to a reduction in metabolic syndrome and other CVD risk  factors  [11,17]. The present data  indicates a shortage of appropriate in- tervention programmes in the Islamic Republic of  Iran  [18],  and hence  this  study was conducted to investigate the effectiveness of a nutritional interven- tion on the prevalence of metabolic syndrome and other CVD risk factors among adults in Tehran. Methods The current study was conducted within the framework of the TLGS, a prospec- tive study of a representative sample of residents of district 13 of Tehran, performed to ascertain the prevalence of noncommunicable disease risk fac- tors and developing a healthy lifestyle to curtail these risk factors [18]. Subjects Residents in district 13 are covered by 3 health care centres. For the TLGS, 15 005 people ≥ 3 years were selected by  a multistage cluster, random sampling method.  For  the  case–control  study  reported here, nutritional interventions were implemented for the population covered by one of the health care cen- tres. The remaining populations in the areas covered by the other 2 centres had  no nutritional interventions and served as controls. The area of the intervention group was far from the areas where the control subjects lived. Interactions in- volving schooling, shopping and gather- ings were estimated to be < 5% between  the intervention and control groups. The first dietary assessment was done during 1999  to 2002 and  the  second  during 2002 to 2005. For the first assess- ment a representative sample of 1474 people aged ≥ 3 years was randomly selected from the 3 areas. After 3.9 years, biochemical, anthropometric and di- etary assessments were done in all these subjects. Pregnant women and subjects who had used hypoglycaemic agents, lipid-lowering and anti-hypertensive prescription medications were excluded from the study. Subjects > 20 years old  with relevant data were included in the study. Finally, 316 subjects remained and were divided into 2 groups accord- ing to area of residence (133 cases and 183 controls). All subjects signed voluntary con- sent forms. The protocol for the study was approved by the research council of the Endocrine Research Centre of Shahid Beheshti University of Medical Sciences. Nutritional intervention The nutritional intervention consisted of an educational programme ac- cording to the Therapeutic Lifestyle Change diet (TLC) guidelines which were developed by the US National Heart, Lung, and Blood Institute for the National Cholesterol Education Program [19]. The TLC diet  is  a  low  saturated  fat  (< 7% of  total  caloric  in- take)  and  low cholesterol  (< 200 mg  of dietary cholesterol a day) diet that emphasizes grains, cereals, legumes, vegetables, fruits, lean meats, poultry, fish and non-fat dairy products. Accord- ing to the TLC, 25%–35% of the day’s  total calories should be from fat, and persons who are overweight or obese with dyslipidaemia should reduce their body weight through a combination of physical activity, total calorie reduction and behaviour therapy modifications. This programme was introduced for all individuals aged 3+ years in health care centres, schools and public places in intervention areas. At health care centres, family members were invited in turn to the centre, and were educated with a face-to-face approach between the educators and the participants. In schools, the intervention was conduct- ed through direct education by trained teachers, parent–teacher cooperation  societies and group-based activities such as fairs and competitions. Foods provided by school buffets or canteens were changed according to nutritional guidelines. Pamphlets and posters with Book 17-6.indb 502 6/6/2011 9:44:53 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 503 related information were mailed every 2–4 months  to  family members,  and  lectures and discussion sessions were arranged in public places. Data collection The study population was interviewed privately, face-to-face. Trained inter- viewers using pretested questionnaires conducted interviews and all variables were assessed at baseline and at follow- up in both groups after 3.8 years. Assessment of dietary intake Dietary intake assessment was un- dertaken by 2-day 24-hour  recall,  ad- ministered to the subjects by expert interviewers who had experience in the Nationwide Food Consumption Sur- vey project [20]. The first day recall was  performed at subject’s homes and the second day recall at a clinic visit in the dietary unit of TLGS within 1–3 days of  the first visit. These 2 days aimed to be  among typical eating days for subjects. Standard reference tables were used to convert household portions to grammes for  computerization  [21].  Following  coding of diaries, the dietary recall form was linked to the Nutritionist III foods nutrient database, version 7.0 designed  for Iranians (N-Squared Computing) and daily intakes of carbohydrates, pro- teins and fats for each individual were determined  from  the means of  the 2  × 24-hour dietary recalls. Assessment of other variables Blood pressure was measured using a standard mercury sphygmomano- meter. Participants were made to rest for 15 min before their blood pressure was measured. A qualified physician measured the blood pressure of the seated subject twice; the mean of the 2  measurements was considered as the participant’s blood pressure. Weight was measured while the sub- jects were minimally clothed without shoes using digital scales and recorded to the nearest 100 g. Height was meas- ured in a standing position, without shoes using a tape measure while the shoulders were in a normal position. Waist circumference was measured at the narrowest level [22]. Body mass  index (BMI) was calculated as weight divided by height squared (kg/m2). Additional covariate information regarding age, sex, education, marital status and job was obtained using vali- dated questionnaires. A blood sample was drawn into vacutainer tubes from all subjects between 07.00  and 09.00 hours  after  12–14 hours overnight fasting [23]. The  samples were  centrifuged 30–45 min  after collection. All blood lipid analyses were done at the TLGS research labo- ratory on the day of blood collection. The analysis of samples was performed using the Selectra 2 autoanalyser (Vital  Scientific). Fasting plasma glucose was measured on the day of blood collection by the enzymatic colorimetric method using glucose oxidase. Serum total cho- lesterol and triglyceride concentration were measured by commercially avail- able enzymatic reagents (Pars Azmoon) adapted to the Selectra autoanalyser. High-density lipoprotein (HDL) cho- lesterol was measured after precipita- tion of the apolipoprotein B-containing lipoproteins with phosphotungstic acid. Low-density lipoprotein (LDL) cho- lesterol was calculated according to the method of Friedewald [24].  It was not  calculated when the serum concentra- tion of  triacylglycerol was > 400 mg/ dL. All samples were analysed when internal quality control met the accept- able criteria. Inter-assay and intra-assay coefficients of variation were 2.0% and  0.5% for total cholesterol and 1.6% and  0.6% for triacylglycerol respectively. Definition of terms The following definitions were used: obesity was BMI ≥ 30 kg/m2 [25]; hyper- cholesterolaemia was total cholesterol ≥ 240 mg/dL; high LDL cholesterol was  ≥ 160 mg/dL [26]; diabetes was fasting  plasma  glucose  concentration  ≥  126  mg/dL or  2-h  postchallenge  glucose  concentration of ≥ 200 mg/dL  [27];  and hypertension was systolic blood pressure ≥ 140 mmHg or diastolic blood  pressure ≥ 90 mm Hg or current use of  antihypertensive medication [28]. Diag- nosis of metabolic syndrome as recom- mended by the Adult Treatment Panel (ATP) III criteria was based on having at least 3 of the following 5 components: (1) waist  circumference > 102 cm  in  men and > 88 cm in women; (2) serum  HDL cholesterol < 40 mg/dL  in men  and < 50 mg/dL in women; (3) serum  triacylglycerol  concentrations  >  150  mg/dL; (4) blood pressure > 130/85  mmHg; and (5) fasting plasma glucose concentration > 110 mg/dL [26]. Statistical methods All data were analysed using SPSS, ver- sion  9.05. Mean  energy  and macro- nutrient intakes were measured and compared within  the 2  groups using  the paired t-test. Analysis of covariance (ANCOVA) was used to compare the means between  the 2 groups after  controlling for age, sex and baseline variables. The chi-squared test was per- formed to compare the prevalence of risk factors and metabolic syndrome between  the 2  groups  after  interven- tions. Mantel–Haenszel  test was used  to compare the prevalence of risk fac- tors and metabolic syndrome between the 2 groups after  controlling  for  age,  sex and baseline variables. McNemar test was used to assess the change of risk factors status and metabolic syndrome, pre- and post-intervention. Results The mean age was 42.1  [standard de- viation (SD) 11.9] years in controls (73  men and 110 women),  and 40.6 (SD  10.7)  years  in  cases  (61 men and 72  women). The mean values for macronutrient intakes of the 2 groups are shown in Ta- ble 1. The reported mean daily intakes of energy, carbohydrate and fat decreased significantly, whereas cholesterol and Book 17-6.indb 503 6/6/2011 9:44:53 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 504 protein as percentages of total energy increased significantly in both groups. Mean protein intake increased and fat as percentage of total energy decreased significantly in controls. After adjusting for age, sex and baseline variables, no sig- nificant differences regarding macronu- trients and energy intakes were observed between the case and control groups. The prevalence of the risk factors and metabolic syndrome at baseline and follow-up in the 2 groups are shown  in Table 2. The prevalence of low HDL  cholesterol increased significantly in controls (from 39.9% to 60.4%) between  baseline and follow-up measurements whereas in cases the increase was not significant (from 49.2% to 57.6%) (P < 0.01). Abdominal obesity also increased  significantly in controls (from 26.2% to  38.3%) while  in cases  the  increase was  not  significant (from 30.1% to 37.6%)  (P < 0.01). The prevalence of high LDL  cholesterol did not change in controls over the period (19.2% versus 18.9% re- spectively) whereas in the cases exposed to the educational intervention it de- creased significantly from 21.7% to 9.5%  (P < 0.05). After adjusting  for age,  sex  and baseline variables, the same results were obtained (P < 0.05). The decrease  in the rate of hypercholesterolemia was small  in  the  controls  (from 18.6%  to  13.2%) but was significant  in  the cases  (from 18.3% to 8.3%) (P < 0.01). There  were no significant differences between the 2 groups  regarding  the prevalence  of metabolic syndrome at baseline and follow-up  in  controls  (24.6%  versus  30.2%  respectively) and cases  (28.7%  versus 29.8% respectively). The distribution of subjects with regard to changes in risk factor status and metabolic syndrome at baseline and follow-up is shown in Table 3. In controls,  45.0% of  subjects  (49/109)  who had normal HDL cholesterol at baseline had low HDL cholesterol at follow-up; whereas 16.4% (12/73) of  subjects who had low HDL cholesterol at baseline showed normal levels in the follow-up assessment. These changes were significant (P < 0.01). Also 20.7%  of controls (28/135) who did not have  abdominal obesity at baseline devel- oped abdominal obesity at follow-up, whereas 12.5% (6/48) of cases who had  abdominal obesity at baseline became normal status after exposure to the in- tervention (P < 0.01). In the cases, 1.9%  (2/106) of  subjects who had normal  cholesterol at baseline developed hy- percholesterolaemia after the interven- tion, whereas 62.5% (15/24) of  those  with hypercholesterolaemia at baseline showed normal cholesterol at follow-up (P < 0.01). Moreover, 3.3% (3/90) of  cases who had normal LDL cholesterol at baseline developed high LDL cho- lesterol in the follow-up measurement after  the  intervention; whereas 65.2%  (15/23) of  cases who had high LDL  cholesterol at baseline, showed normal levels after the intervention (P < 0.01).  In  controls 12.5% of  individuals with  normal triglycerides developed high hypertriglyceridaemic  and  52.6%  of  hypertriglyceridaemic individuals re- turned to normal in the follow-up meas- urement, whereas in the cases 35.7% of  hypertriglyceridaemic subjects became normal. Discussion This study, conducted in an urban population of Tehran, showed that the prevalence of several risk factors for CVD improved between the baseline and the follow-up measurements 3.8 years later. The prevalence of high LDL cholesterol did not change in controls whereas in the cases exposed to the educational intervention it decreased significantly. The prevalence of low HDL cholesterol increased significantly in controls between baseline and follow- up measurements whereas in cases the increase was not significant. Abdominal obesity also increased in controls while in cases the increase was not significant. The decrease in the rate of hypercholes- terolemia was small in the controls but significant in the cases. Table 1 Self-reported macronutrient intakes at baseline and at follow-up for the control group (no intervention) and the case group (exposed to educational intervention) Variables Controls (n = 182) Cases (n= 133) Baseline Follow-up Baseline Follow-up Mean (SD) Mean (SD) Mean (SD) Mean (SD) Total energy (kcal/dL) 2327 (810) 2155 (673)a 2452 (705) 2245 (664)a Carbohydrate (g/dL) 345 (117) 320 (99)a 367 (110) 333 (106)a Protein (g/dL) 65 (24) 69 (27)b 70 (22) 72 (32) Fat (g/dL) 80 (40) 71 (32)a 81 (33) 72 (29)b Carbohydrate (% of total energy) 59.1 (7.4) 58.8 (9.1) 59.3 (6.9) 59.1 (7.5) Protein (% of total energy) 11.2 (2.1) 12.7 (3.4)c 11.4 (1.7) 12.9 (4.7)c Fat (% of total energy) 29.8 (7.8) 28.1 (7.4)b 29.2 (6.9) 28.5 (8.8) Cholesterol (mg/dL) 130 (115) 219 (150)c 164 (159) 199 (113)b aP < 0.01; bP < 0.05; cP < 0.001 comparing baseline and follow-up data using analysis of covariance test adjusted for age, sex and baseline of each variable. SD = standard deviation. Book 17-6.indb 504 6/6/2011 9:44:53 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 505 Several studies have shown the prevalence of hypercholesterolaemia and hypertriglyceridaemia declined significantly after nutritional interventions, in both sexes and among different  races  [29–31].  In  contrast, the National Healthy Lifestyle Programme in Singapore,  implemented in 1992, was unsuccessful  in  reducing  total  blood  cholesterol  levels  [32]. An  intervention study in England that was a part of a World Health Organization project was conducted on 18 210 workers in 24 factories. Subjects were followed  for 5 years, and only 4% reduction in CVD risk factors  was seen [33]. In the present study, despite significant decreases in energy, carbohydrate and fat intake between base- line and follow-up in both groups, the prevalence of low HDL cholesterol increased significantly only in controls. Other studies have shown that HDL choles- terol level is less affected by nutritional factors [34], and  more affected by BMI, physical activity, smoking, alco- hol and some hormones [35]. The significant increase  in the prevalence of abdominal obesity in controls may be responsible for the change. On the other hand, the difference of the prevalence of low HDL cholesterol between the 2 groups may be due in part to differences  in physical activity and other confounding factors. We did not measure physical activity data since the reliability and validity of the Lipid Research Clinic questionnaire that was used in the TLGS had not been evaluated in our country. The availability of valid data for this confounding variable could have helped to provide a better understanding of this difference of low HDL cholesterol between the 2 groups. In this study the prevalence of high LDL choles- terol and total cholesterol decreased significantly in the intervention group, despite significant increases in cho- lesterol intake and decreases in total fat in both groups. It has been shown that high cholesterol intake leads to higher LDL cholesterol  levels  [36], whereas some  studies have found that the effect of saturated fatty acid on serum cholesterol is more important than dietary cholesterol. Interestingly, other experimental studies have found that, when combined, cholesterol intake and saturated fatty acids synergistically promote the elevation of LDL cholesterol [37]. Furthermore, it has  been shown that age, obesity, physical activity, some diseases, poly- and mono-unsaturated fatty acids, the type of carbohydrate and some micronutrients affect serum cholesterol  levels  [38–41]. Further  research  assessing these factors will provide stronger evidence of this relationship. The data on changes in individuals’ CVD risk status showed that in controls a high proportion of individuals Ta bl e 2 Pr ev al en ce o f r is k fa ct or s an d m et ab ol ic s yn dr om e at b as el in e an d at fo llo w -u p fo r t he c on tr ol g ro up (n o in te rv en ti on ) a nd th e ca se g ro up (e xp os ed to e du ca ti on al in te rv en ti on ) Ri sk fa ct or a C on tr ol s (n = 1 82 ) C as es (n = 1 33 ) P- va lu ec (c as es v s co nt ro ls ) P- va lu ed ad ju st ed (c as es v s co nt ro ls ) Ba se lin e Fo llo w -u p P- va lu eb Ba se lin e Fo llo w -u p P- va lu eb N o. % N o. % N o. % N o. % D ia be te s 5 2. 7 10 5. 5 0 .0 6 4 3. 1 5 3. 8 1.0 0 0 .4 8 0 .4 0 H yp er tr ig ly ce rid ae m ia 38 20 .8 36 19 .8 0 .8 7 29 22 .1 28 21 .2 1.0 0 0 .7 5 0 .9 9 H yp er ch ol es tr ol ae m ia 34 18 .6 24 13 .2 0 .11 24 18 .3 11 8. 3 0 .0 0 2 0 .18 0 .2 3 H ig h LD L ch ol es te ro l 35 19 .2 34 18 .9 1.0 0 28 21 .7 11 9. 5 0 .0 0 8 0 .0 2 0 .0 2 Lo w H D L ch ol es te ro l 73 39 .9 11 0 60 .4 0 .0 0 1 64 49 .2 76 57 .6 0 .14 3 0 .6 1 0 .2 0 H yp er te ns io n 20 10 .9 19 10 .6 1.0 0 20 15 .4 13 9. 8 0 .14 3 0 .8 2 0 .6 5 O be si ty 41 22 .9 46 26 .3 0 .2 6 29 21 .8 28 22 .2 0 .7 2 0 .4 2 0 .7 3 A bd om in al o be si ty 48 26 .2 70 38 .3 0 .0 0 1 40 30 .1 50 37 .6 0 .0 8 0 .9 0 0 .5 9 M et ab ol ic sy nd ro m e 45 24 .6 54 30 .2 0 .15 37 28 .7 39 29 .8 1.0 0 0 .9 4 0 .6 6 a U si ng st an da rd in te rn at io na l c rit er ia [2 4– 27 ]. b C om pa ris on b et w ee n ba se lin e an d at fo llo w -u p us in g M cN em ar te st . c C om pa ris on b et w ee n ca se a nd co nt ro l g ro up s a t f ol lo w -u p us in g ch i-s qu ar ed te st . d C om pa ris on b et w ee n ca se a nd co nt ro l g ro up s a t f ol lo w -u p us in g M an te l– H ae ns ze l, an d af te r a dj us tin g fo r b as el in e of e ac h va ria bl e. SD = st an da rd d ev ia tio n; L D L = lo w -d en si ty li po pr ot ei n; H D L = hi gh -d en si ty li po pr ot ei n. Book 17-6.indb 505 6/6/2011 9:44:54 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 506 who were normal at baseline developed low HDL cholesterol, whereas fewer individuals with low HDL cholesterol at baseline became normal in the follow- up measurement. As mentioned before, this may be attributed to the increased prevalence of abdominal obesity in this group. More of the controls improved their hypertriglyceridaemic status from abnormal to normal than did cases. Al- though not significant, the changes are an interesting finding. Despite decreased energy, carbo- hydrate and fat intakes in both groups, modulation of triglyceride status in controls was greater than in cases. This may be due to a significant decrease in the percentage of energy obtained from fat. As demonstrated in a recent study, decreases in the percentage of energy from fat intake could potentially decrease serum triglyceride  levels  [42].  Furthermore, limited saturated fat intake, modified carbohydrate intake, decreased alcohol drinking, stopping smoking and increased physical activity result in fa- vourable lipid profiles [43,44]. There were no significant differ- ences between  the 2 groups  regarding  the prevalence of metabolic syndrome at baseline and follow-up in controls and cases. The metabolic syndrome is well established as a problem condition, and is associated with the development of atherosclerosis and increased CVD risk. Moreover, there is extensive sci- entific evidence, especially in countries with better and longer term national health programmes, that the prevalence of metabolic syndrome has increased in the last decade, which suggests that the disease burden  (including  type 2  diabetes) has  increased  as well  [45].  Obesity and sedentary lifestyle, coupled with unhealthy diet and genetic fac- tors, are believed to interact to produce metabolic syndrome. In recent decades, several epidemiological studies have underlined the relation between diet and incidence of coronary heart disease and other diseases. Dietary factors exert their influence largely through their ef- fects on blood lipids and lipoproteins, as well as on other established modifi- able risk factors, with the exception of cigarette  smoking  [44–46]. Our find- ings did not support the hypothesis that nutritional intervention is associated with a significant reduction in the risk of developing metabolic syndrome. The ATP III highlighted the importance of diagnosing and treating metabolic syn- drome, focusing on increasing physical activity, lowering excess body fat and on modifying specific dietary patterns [45].  We therefore believe that the physical activity of individuals in both controls and cases in our study may have been insufficient. As we did not measure physical activity level, it is difficult to confirm this theory. There were some limitations to the current study. We did not find sub- stantial differences in the measures of nutrient and energy intake between the 2  groups. This may be  attributed  to  the 24-hour  recall method used  for  data collection. Problems commonly associated with this method include: an inability to recall accurately the kinds and amounts of food eaten, difficulty in determining whether the day being recalled represents an individual’s typi- cal intake and the tendency for persons to over-report low intakes and under- report high intakes of foods. Further- more, the study was a community field trial and it was not possible educate all individuals about nutrition face-to- face. Some trials have shown that this approach is the most successful inter- vention programne in schools, health centres and work places [47–49]. The  short duration of interventions in this study may also have been a factor, as recent studies have shown that lifestyle Table 3 Changes in levels of risk factors and metabolic syndrome status at baseline and at follow-up for the control group (no intervention) and the case group (exposed to educational intervention) Risk factora Controls (n = 182) Cases (n = 133) Deterioratedb Improvedc P-valued Deterioratedb Improvedc P-valued No. % No. % No. % No. % Diabetes 5 2.8 0 0.0 0.06 1 0.8 0 0.0 1.00 Hypertriglyceridaemia 18 12.5 20 52.6 0.87 9 8.8 10 35.7 1.00 Hypercholestrolaemia 11 7.4 21 61.8 0.11 2 1.9 15 62.5 0.002 High LDL cholesterol 16 11.0 17 48.6 1.00 3 3.3 15 65.2 0.008 Low HDL cholesterol 49 45.0 12 16.4 0.001 24 36.4 14 22.2 0.143 Hypertension 10 6.3 11 55.0 1.00 5 4.6 12 60.0 0.143 Obesity 9 6.8 4 10.2 0.26 5 5.0 3 11.5 0.72 Abdominal obesity 28 20.7 6 12.5 0.001 19 20.4 9 22.5 0.08 Metabolic syndrome 25 18.5 15 34.1 0.15 15 16.5 14 38.9 1.00 aUsing standard international criteria [24–27]. bDeteriorated = number of subjects who were normal at baseline, abnormal at follow-up; % of abnormal/normal subjects. cImproved = number of subjects who were abnormal at baseline, normal at follow-up; % of normal/abnormal subjects. dComparison between baseline and at follow-up using McNemar test. LDL = low-density lipoprotein; HDL = high-density lipoprotein. Book 17-6.indb 506 6/6/2011 9:44:54 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 507 modification, especially dietary pat- terns, need longer-term interventions [50,51]. In summary, this study showed modulation of some CVD risk factors in cases exposed to an educational intervention compared with controls. As there was no significant difference between the 2 groups regarding energy  and macronutrient intakes, it is hard to claim that nutritional interventions played an important role. Our data therefore raise the possibility that other lifestyle choices are important in the modulation of certain CVD risk factors. Acknowledgements The authors thank the participants of the Tehran Lipid and Glucose Study and the staff of the Research Institute of Endocrine sciences and the TLGS unit, for their valuable help in conducting this study. This study was supported by grant no. 121 from the National Re- search Council of the Islamic Republic of Iran, and by the combined support of the National Research Council of the Islamic Republic of Iran and Research Institute of Endocrine sciences of Shaheed Beheshti University of Medi- cal Sciences. References Burchfiel CM et al. Cardiovascular risk factors and hyperin-1. sulinemia in elderly men: the Honolulu Heart Program. Annals of Epidemiology, 1996, 6:490–497. Sarraf-Zadegan N et al. Secular trends in cardiovascular mor-2. tality in Iran, with special reference to Isfahan. Acta Cardio- logica, 1999, 54:327–333. Sarraf-Zadegan N et al. The prevalence of coronary artery dis-3. ease in an urban population in Isfahan, Iran. Acta Cardiologica, 1999, 54:257–263. Ghassemi H, Harrison G, Mohammad K. An accelerated 4. nutrition transition in Iran. Public Health Nutrition, 2002, 5 1A;149–155. Kimiagar SM et al. Food consumption pattern in the Islamic Re-5. public of Iran and its relation to coronary heart disease. Eastern Mediterranean Health Journal, 1998, 4:539–547. Azizi F et al. Distribution of blood pressure and prevalence of 6. hypertension in Tehran adult population: Tehran Lipid and Glucose Study (TLGS), 1999–2000. Journal of Human Hyperten- sion, 2002, 16:305–312. Keys A. Coronary heart disease–the global picture. 7. Atheroscle- rosis, 1975, 22:149–192. Kuller LH. Epidemiology of cardiovascular diseases: cur-8. rent perspectives. American Journal of Epidemiology, 1976, 104:425–496. Stamler J. Epidemiology of coronary heart disease. 9. Medical Clinics of North America, 1973, 57:5–46. Stamler J. George Lyman Duff Memorial Lecture. Lifestyles, 10. major risk factors, proof and public policy. Circulation, 1978, 58:3–19. Panagiotakos DB et al. Impact of lifestyle habits on the preva-11. lence of the metabolic syndrome among Greek adults from the ATTICA study. American Heart Journal, 2004, 147:106–112. Azizi F et al. Prevalence of metabolic syndrome in an urban 12. population: Tehran Lipid and Glucose Study. Diabetes Re- search and Clinical Practice, 2003, 61:29–37. Ford ES, Giles WH, Dietz WH. Prevalence of the metabolic 13. syndrome among US adults: findings from the third National Health and Nutrition Examination Survey. Journal of the Ameri- can Medical Association, 2002, 287:356–359. Hollenberg NK. Genetic versus environmental etiology of the 14. metabolic syndrome among male and female twins. Current Hypertension Reports, 2002, 4:178. First WHO food and nutrition action plan for Europe 2000-2005. 15. Plans for 2000–2001. Copenhagen, World Health Organiza- tion Regional Office for Europe, 2000. Leparski E, Nussel E. CINDI, countrywide integrated noncom-16. municable diseases intervention programme. In: Protocol and guidelines for monitoring and evaluation procedures. New York, World Food Programme, 1987. Monzavi R et al. Improvement in risk factors for metabolic 17. syndrome and insulin resistance in overweight youth who are treated with lifestyle intervention. Pediatrics, 2006, 117:e1111– e1118. Azizi F. Tehran Lipid and Glucose Study: rationale and design. 18. CVD Prevention, 2000, 3:242–247. Expert Panel on Detection, Evaluation, and Treatment of High 19. Blood Cholesterol in Adults. Executive summary of the third report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). Journal of the American Medical Association, 2001, 285:2486 –2497. Kimiagar M20. . [National food consumption survey]. Tehran, Na- tional Nutrition and Food Technology Research Institute, 1995 [in Farsi]. Ghaffarpour M, Houshiar-Rad A, Kianfar H. 21. The manual for household measures, cooking yield factors and edible portion of foods. Tehran, Keshaverzi Press, 1999. Mirmiran P, Esmaillzadeh A, Azizi F. Detection of cardiovas-22. cular risk factors by anthropometric measures in Tehranian adults: receiver operating characteristic (ROC) curve analysis. European Journal of Clinical Nutrition, 2004, 58:1110–1118. Azizi F et al. Serum lipid levels in an Iranian adults population: 23. Tehran lipid and glucose study. European Journal of Epidemiol- ogy, 2003, 18:311–319. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the con-24. centration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical Chem- istry, 1972, 18:499–502. National Institutes of Health. Clinical guidelines on the identifi-25. cation, evaluation, and treatment of overweight and obesity in adults—the evidence report. Obesity Research, 1998, 6(Suppl. 2);51S–209S. National Cholesterol Education Program (NCEP) Expert Panel 26. on Detection, Evaluation, and Treatment of High Blood Cho- lesterol in Adults (Adult Treatment Panel III). Third report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. Circulation, 2002, 106:3143–3421. Expert Committee on the Diagnosis and Classification of 27. Diabetes Mellitus. Report of the Expert Committee on the Di- Book 17-6.indb 507 6/6/2011 9:44:54 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 508 agnosis and Classification of Diabetes Mellitus. Diabetes Care, 1997, 20:1183–1197. Joint National Committee on Prevention, Detection, Evalua-28. tion, and Treatment of High Blood Pressure. The sixth report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Archives of Internal Medicine, 1997, 157:2413–2446. Harrell JS et al. A public health vs a risk-based intervention to 29. improve cardiovascular health in elementary school children: the Cardiovascular Health in Children Study. American Journal of Public Health, 1999, 89:1529–1535. Obarzanek E et al.; DISC Collaborative Research Group. 30. Long-term safety and efficacy of a cholesterol-lowering diet in children with elevated low-density lipoprotein cholesterol: seven-year results of the Dietary Intervention Study in Children (DISC). Pediatrics, 2001, 107:256–264. Haq IU et al. Population implications of lipid lowering for 31. prevention of coronary heart disease: data from the 1995 Scottish health survey. Heart (British Cardiac Society), 2001, 86:289–295. Cutter J, Tan BY, Chew SK. Levels of cardiovascular disease 32. risk factors in Singapore following a national intervention programme. Bulletin of the World Health Organization, 2001, 79:908–915. Head J, Fuller JH. International variation in mortality among 33. diabetic patients: The WHO Multinational Study of Vascular Disease in diabetics. Diabetologia, 1990, 33:477–481. Mann JI. Dietary effects on plasma LDL and HDL. 34. Current Opin- ion in Lipidology, 1997, 8:35–38. Krummel D. Nutrition in cardiovascular disease. In: Mahan LK, 35. Escott-Stump S, eds. Krauses food, nutrition, and diet therapy. Philadelphia, WB Saunders, 1996:558–595. Krauss RM et al. AHA Dietary Guidelines: revision 2000: A 36. statement for healthcare professionals from the Nutrition Committee of the American Heart Association. Circulation, 2000, 102:2284–2299. Schaefer EJ, Brousseau ME. Diet, lipoproteins, and coronary 37. heart disease. Endocrinology and Metabolism Clinics of North America, 1998, 27:711–732. Pasternak RC et al. 27th Bethesda Conference: matching the 38. intensity of risk factor management with the hazard for coro- nary disease events. Task Force 3. Spectrum of risk factors for coronary heart disease. Journal of the American College of Car- diology, 1996, 27:978–990. Miyashita Y et al. Beneficial effect of low carbohydrate in low 39. calorie diets on visceral fat reduction in type 2 diabetic patients with obesity. Diabetes Research and Clinical Practice, 2004, 65:235–241. Lichtenstein AH. Dietary fat, carbohydrate and protein: ef-40. fects on plasma lipoprotein profiles fat, carbohydrate and protein and plasma lipids. Journal of Lipid Research, 2006, 47:1661–1667. Oda H. Functions of sulfur-containing amino acids in lipid 41. metabolism. Journal of Nutrition, 2006, 136(6 Suppl.):1666S– 1669S. Pejic RN, Lee DT. Hypertriglyceridemia. 42. Journal of the American Board of Family Medicine, 2006, 19:310–316. Castelli WP. Epidemiology of triglycerides: a view from Fram-43. ingham. American Journal of Cardiology, 1992, 70:3H–9H. Wing RR. Behavioral approaches to the treatment of obesity. 44. In: Bray G, Bouchard C, James P, eds. Handbook of obesity. New York, Marcel Dekker, 1993:855–873. Pitsavos C et al. The adoption of Mediterranean diet attenuates 45. the development of acute coronary syndromes in people with the metabolic syndrome. Nutrition Journal, 2003, 2:1. Klem ML et al. A descriptive study of individuals successful at 46. long-term maintenance of substantial weight loss. American Journal of Clinical Nutrition, 1997, 66:239–246. Puska P et al. The North Karelia Project: a programme for 47. community control of cardiovascular diseases. Scandinavian Journal of Social Medicine, 1976, 4:57–60. Pietinen P et al. Changes in diet in Finland from 1972 to 1992: 48. impact on coronary heart disease risk. Preventive Medicine, 1996, 25:243–250. Pietinen P et al. Nutrition and cardiovascular disease in Fin-49. land since the early 1970s: a success story. Journal of Nutrition, Health & Aging, 2001, 5:150–154. Cicero AF et al. Long-term effect of a dietary education pro-50. gram on postmenopausal cardiovascular risk and metabolic syndrome: the Brisighella Heart Study. Journal of Women’s Health, 2010, 19(1):133–137. Plachta-Danielzik S et al. Eight-year follow-up of school-based 51. intervention on childhood overweight—the Kiel obesity pre- vention study. Obesity Facts, 2011, 4(1):35–43. Book 17-6.indb 508 6/6/2011 9:44:54 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 509 Factors associated with breast self-examination among Malaysian women teachers P. Parsa,1 M. Kandiah 2 and N. Parsa 3 ABSTRACT The purpose of this study was to examine factors related to breast self-examination (BSE) among teachers in Selangor, Malaysia. A cross-sectional study was conducted among 425 female teachers in 20 randomly selected secondary schools. A self-administered questionnaire based on the health belief model was used, including sociodemographic background and knowledge, beliefs and practices about breast cancer and BSE. Only 19% of the women performed BSE on a regular basis. Higher knowledge about breast cancer, greater confidence in performing BSE and regular visits to a physician were significant predictors for practising BSE. To promote BSE practice among Malaysian women, tailored health education and health promotion programmes should be developed based on a specific understanding of women’s health beliefs. 1Child and Maternal Health Research Centre and Health Science Research Centre, Department of Maternal and Child Health, Hamedan University of Medicine and Health Sciences, Hamedan, Islamic Republic of Iran (Correspondence to P. Parsa: pparsa2003@yahoo.com). 2Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences; 3Department of Psychology, Faculty of Human Ecology, Universiti Putra Malaysia, Serdang, Malaysia. Received: 12/07/09; accepted: 29/10/09 تايزيلالما تماّلعلما ينب يدثلل تياذلا صحفلاب ةطبترلما لماوعلا اسراب اسيكن ،ايدناك ينيلانيرم ،اسراب اسيرب تاثحابلا ترجأ دقو .ايزيلماب روغنلايس في تايزيلالما تماّلعلما ينب يدثلل تياذلا صحفلاب ةطبترلما لماوعلا صحف لىإ ةساردلا هذه فدته :ةصلالخا ،ةيحصلا تادقتعلما جذومن لىع ًاينبم ًايتاذ أ َّبعي ًانايبتسا َنْمَدختساو .ًايئاوشع تيرتخا ةيوناث ةسردم 20 في ةمّلعم 425 تلمش ةضرعتسم ةسارد %19 نأ َّينبت دقو .يدثلل تياذلا صحفلاو يدثلا ناطسرب ةقلعتلما تاسرمالماو ،تادقتعلماو ،فراعلماو ،ةيفارغوميدلاو ةيعماتجلاا ةيفلخلل ًانمضتمو ،يدثلل تياذلا صحفلا ءارجإ في لضفأ ةقثب عتمتلاو ،يدثلا ناطسرب ةديلجا ةفرعلما نأ َّينبت ماك .يدثلل ًايتاذ ًاصحف ماظتناب نيرُيج ءاسنلا نم طقف تياذلا صحفلا ةسرامم زيزعتل ،يغبني هنأ تاثحابلا تجتنتساو .يدثلل تياذلا صحفلا ةسرمامب ةئبنلما لماوعلا يه تناك ،بيبطلا ةرايز لىع ةبظاولماو ةيحصلا تادقتعملل حيحص م ُّرهفت لىع زكترتو ليحلما عضولا عم مءاوتت ةحصلا زيزعتو يحصلا فيقثتلل جمارب دادعإ ،تايزيلالما ءاسنلا ينب يدثلل .ءاسنلا ىدل Facteurs associés à l’auto-examen des seins chez des enseignantes malaisiennes RÉSUMÉ La présente étude avait pour objectif de rechercher les facteurs liés à l’auto-examen des seins chez des enseignantes de l’État de Selangor (Malaisie). Une étude transversale a été conduite auprès de 425 enseignantes travaillant dans vingt établissements d’enseignement secondaire sélectionnés aléatoirement. Un auto- questionnaire reposant sur un modèle de croyances relatives à la santé a été utilisé, couvrant les informations sociodémographiques des répondantes, leurs connaissances et croyances au sujet du cancer du sein et de l’auto- examen des seins et leurs pratiques en la matière. Seules 19 % des femmes pratiquaient l’auto-examen des seins de manière régulière. Une meilleure connaissance du cancer du sein, une confiance élevée dans la pratique de l’auto-examen des seins et des visites régulières chez un médecin étaient des facteurs prédictifs importants pour la pratique de cet auto-examen. Afin de promouvoir l’auto-examen des seins chez les femmes malaisiennes, des programmes sur mesure d’éducation sanitaire et de promotion de la santé doivent être élaborés en tenant compte des croyances des femmes en matière de santé. Book 17-6.indb 509 6/6/2011 9:44:54 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 510 Introduction According to a recent report of the Malaysian cancer registry, 1 out every 19 Malaysian women has a chance of getting breast cancer in her lifetime, and more  than 4000 new  cases  of  breast  cancer are diagnosed every year. Breast cancer is currently the most common female cancer in Malaysia, account- ing  for 30.4% of all  cancers diagnosed  among women [1]. Early detection and  effective treatment are important to reduce morbidity and mortality due to breast cancer. Breast self-examination (BSE), mammography and clinical breast examination are believed to be appropriate and effective methods of ensuring early detection of breast can- cer. Although the effectiveness of BSE as a breast cancer screening method is  controversial  [2–4],  the American  Cancer Society  [2]  and  the Ministry  in Health of Malaysia  [5]  encourage  women to be aware of how their breasts look and feel so they will be able to rec- ognize any changes and report them promptly to their clinicians. Despite the effectiveness of breast cancer screening behaviours in reduc- ing mortality, research findings indicate that screening rates remain low. In stud- ies of community samples of diverse groups of women in the United States of America (USA), the rates for performing monthly BSE ranged from 29% to 63%  [6,7].  Similar  findings were  reported  in  studies  in Canada  [8], Taiwan  [9],  Jordan [10] and Turkey [11]. The na- tional health morbidity survey showed that 34% of women above age 20 years  performed BSE but the frequency of performance was not studied [12]. In this study the health belief model [13–15] was  used  as  the  theoretical  framework to examine variables related to BSE use. In previous studies, perform- ing regular BSE has been associated with health belief model variables such as perceived susceptibility to breast can- cer, seriousness of breast cancer, benefits and barriers to screening, confidence and health motivation  [1–11,14–18].  Socioeconomic status, level of educa- tion, referral from a physician, knowl- edge, health insurance coverage and family history of breast cancer have also been associated with the practice of BSE [6,10,11,19,20]. The purpose of the current study was to identify the rate of practising BSE and factors related to BSE screening behaviour in a sample of well educated Malaysian women. Understanding Ma- laysian women’s health beliefs related to breast cancer screening behaviours will help health care professionals to choose more effective health education programmes and potentially to increase women’s screening practices. Methods A cross-sectional study was carried out among female secondary-school teach- ers in the state of Selangor, Malaysia, between January and April 2006. Sample A multi-stage random sampling method was  used  to  select  the  20  secondary  schools. A total of 425 teachers met the  inclusion criteria and gave informed consent to participate in the study. The participants eligible for the study met the following criteria: age 23–56 years (age  range of working female teachers cur- rently in employment up to retirement), no history of breast cancer or any other cancers, not pregnant or breastfeeding. This study obtained approval from the Ministry of Education of Malaysia. Data collection A questionnaire was developed by the authors based on an extensive review of the literature. The questionnaire obtained information on participants’ sociodemographic characteristics; can- cer-related history; and knowledge, be- liefs and behaviours concerning breast cancer and BSE. Sociodemographic variables included: age, current marital status, education level, income level, ethnicity, religion and health insurance coverage. Cancer-related questions included: having regular health check- ups with a physician (yes/no), previous breast disease (yes/no) and family his- tory of breast cancer (yes/no). Breast cancer knowledge questions (yes/no response) included: having ever heard/read about breast cancer screening tests; sources of information; and 43 knowledge questions on inci- dence (3 items), symptoms (7 items), risk factors of breast cancer (15 items) and screening tests (18 items). A score of 1 was given for a correct answer and 0  for  incorrect. The maximum  score  for knowledge was 43 (100%) and the  minimum  score  was  0  (0%).  More  description of the development of the knowledge scale may be found in an- other published paper [21]. The section about beliefs had 42 questions  that were  self-reported  measures with 6 scales: susceptibility to breast cancer (5 items), seriousness of breast cancer (7 items), benefits of BSE (6 items), barriers to performing BSE (6 items), confidence in their ability to perform BSE (11 items) and health mo- tivation (7 items). All the items had 5 response choices ranging from strongly disagree (1 point) to strongly agree (5 points). All scales were positively related to screening behaviours, except for bar- riers, which were negatively associated. The reliability of the knowledge and belief  subscales  ranged  from 0.73  to  0.91,  indicating good  levels of  internal  consistency [22]. Factor analysis with  principal components was carried out to assess the construct validity of the scales and was found to be acceptable. A detailed description of the translation and adaptation of Champion’s health belief model scale can be found in an- other published article [23]. BSE behaviour was measured by self-reported responses to questions about: ever having carried out BSE; fre- quency, technique, etc.; and reasons for reluctance to practise BSE. Book 17-6.indb 510 6/6/2011 9:44:55 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 511 The Malay version of the instrument was pretested on 30 female teachers to  check the clarity of the items. Analysis The women were  categorized  into  2  groups: those who reported that they performed BSE and those who did not. Independent t-test was used to deter- mine differences between the 2 groups.  The chi-squared test was used to exam- ine the association between categorical variables and BSE. A logistic regression analysis was conducted to identify the extent to which variables significantly predicted BSE behaviour. In all tests, the level of significance was set at P < 0.05. Results General characteristics of the subjects The mean age of respondents was 37.2  (SD 7.2),  range 23  to 56 years. Most  of them were married, of Muslim reli- gion and Malay ethnic origin. Nearly all of them had a university degree and around one-fifth had no medical insur- ance. Most  teachers had  less  than 20  years teaching experience. Among the total sample a family history of breast cancer was recorded by 36 respondents (9%) and only 11 (3%)  indicated  that  they had a personal history of breast disease (Table 1). Practice, intention to practice, and sources of information Although  90%  of  the  participants  reported that they had heard about BSE,  only  230/425  (54%)  had  ever  performed BSE. Of  these 19%  stated  that they performed BSE on a regular monthly basis; others reported per- forming BSE every 2–3 months (11%)  or occasionally (25%).  When asked about their intention to practise BSE in the coming year, 80%  of them said that they would consider examining themselves regularly. The most common reason for not doing breast cancer screening was a lack of knowledge, followed by belief that is was time-consuming or that BSE was not needed if one was in good health. Magazines and television pro- grammes were identified as the main sources of information on breast cancer and BSE by 95% and 83% of  the par- ticipants, respectively. Printed materials (67%), friends (52%) and health profes- sionals (46%) were mentioned as other  sources of information on breast cancer and BSE. Participants’ health beliefs and knowledge on breast cancer and screening Average responses to the items on the 6 belief scales and the 4 knowledge scales  are  summarized  in  Table  2.  Significant differences between those who performed BSE and those who did not were observed for the total knowl- edge score (P < 0.01) as well as for the  items of knowledge about symptoms of breast cancer (P < 0.01), risk factors  of breast cancer (P < 0.01) and screen- ing methods (P  <  0.01). There were  no significant differences between the 2 groups  for  knowledge  about breast  cancer incidence (P = 0.290). Concerning belief scores and per- forming BSE, significant differences between groups were observed for total beliefs (P < 0.001). Women who per- formed BSE had greater confidence (P  <  0.001)  and  health  motivation  (P < 0.001) and  lower barriers  to per- forming BSE (P  <  0.001)  than  those  who did not. There were no significant differences between the 2 groups for be- liefs about susceptibility to breast cancer (P = 0.204), seriousness (P = 0.355) and  the benefits of BSE (P = 0.068). Factors associated with BSE As shown in Table 1, significant associa- tions were identified between perform- ing BSE and income level (P = 0.019)  and having regular checkups with the physician (P < 0.001). Family history of  breast cancer, history of breast disease, marital status, menstruation status, age, education level, ethnicity, religion, teaching experience, health insurance, ever heard about breast cancer and perceived health status were not signifi- cantly related to performing BSE. Table 3 shows the logistic regres- sion model for predicting BSE per- formance from the sociodemographic variables and the knowledge and belief scales. This model was a good model for prediction of BSE and it explained 27% of the variance in BSE performance  (Nagelkerke R2 = 0.27, χ2 = 82.49, df =   24, P < 0.001). The  logistic  regression  analysis identified 3 variables with sig- nificant odds ratios (OR). Women who reported having regular check-ups with a physician were over 3 times more like- ly to perform BSE than those who had not (OR = 3.64, 95% CI: 1.82–7.27).  Women with greater knowledge about breast cancer and screening methods (OR = 1.08, 95% CI: 1.02–1.13) and  confidence in their ability to do BSE (OR = 1.06, 95% CI: 1.00–1.12) were  also more likely to perform BSE. Women who had perceived good health status (OR = 4.34, 95% CI: 0.66– 28.33), a family history of breast cancer  (OR = 2.49, 95% CI: 0.92–6.71), ever  undergone clinical breast examination (OR = 1.90, 95% CI: 0.98–3.66), ever  heard about BSE (OR = 1.88, 95% CI:  0.21–16.78) and married (OR = 1.28,  95% CI:  0.46–3.53) were  somewhat  more likely to perform BSE than who had not. However, these factors reached the accepted level of significance (P < 0.05). The  remaining  belief  scales  (perceived susceptibility for breast can- cer, seriousness of breast cancer, ben- efits of BSE, barriers to BSE and health motivation) were also not significant predictors for BSE performance. Discussion The findings of this study have shown that teachers in Malaysia had a low rate of practice of BSE (only 19% performed  Book 17-6.indb 511 6/6/2011 9:44:55 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 512 Table 1 Factors associated with performing breast self-examination (BSE) among Malaysian woman teachers (n = 425) Characteristic Performing BSE (n = 230) Not performing BSE (n = 195) χ2-test P-value No. % No. % Age (years) 20–30 42 17.8 38 19.3 5.190 0.158 31–40 116 51.1 89 45.3 41–50 64 28.0 53 27.6 > 51 8 3.1 15 7.8 Marital status Married 207 90.0 171 87.7 0.571 0.450 Single 23 10.0 24 12.3 Educational status Diploma 15 6.1 15 7.7 2.230 0.332 Degree 208 90.8 169 86.7 Postgraduate 7 3.1 11 5.6 Ethnicity Malay 199 87.2 157 80.6 4.596 0.204 Indian 11 4.4 16 8.1 Chinese 20 8.3 22 11.3 Religion Muslim 203 87.7 159 81.7 5.346 0.254 Buddhist 14 6.1 14 7.0 Hindu 8 3.5 15 7.5 Christian 5 2.2 7 3.8 Menstruation status Premenopause 216 94.3 183 94.1 0.047 0.977 Postmenopause 14 5.7 12 6.0 Income level (RM) Low (< 3000) 28 12.0 31 16.0 7.940 0.019 Moderate (3000–5000) 96 42.0 103 52.5 Good (> 5000) 106 46.0 61 31.5 Health insurance coverage No 45 19.6 41 21.0 0.139 0.709 Yes 185 80.4 154 79.0 Having regular health check-ups with physician Yes 66 28.7 30 15.4 10.693 No 164 71.3 165 84.6 0.001 Family history of breast cancer Yes 22 9.6 14 7.2 0.775 0.379 No 208 90.4 181 92.8 Personal history of breast disease Yes 7 3.0 4 2.2 0.319 0.573 No 223 97.0 191 97.8 Ever heard/ read about breast cancer and BSE Yes 223 97.0 183 93.8 2.391 0.122 No 7 3.0 12 6.2 Perceived health status Good 97 42.4 73 37.8 1.17 0.556 Satisfied 129 55.9 117 59.5 Poor 4 1.7 5 2.7 RM = Malaysian ringgit. Book 17-6.indb 512 6/6/2011 9:44:55 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 513 BSE monthly). Similarly, the rate of regular performance of BSE among female  teachers was  reported  to be 6%  in the Islamic Republic of Iran [24], 7%  in  Jordan [10] and 11%  in Egypt [25].  The higher rate of BSE performance in our study may be attributed to teach- ers’ awareness about the risk of breast cancer in Malaysia and their exposure to media information about breast cancer and screening methods. Most of our educated women had heard or read about breast cancer but only a few per- formed BSE monthly. Consistent with this, Rashidi and Rajarm reported that 85% of women of Middle East origin  had heard of breast cancer screening but 74% had never performed BSE [26]. In the analysis of factors associated with performing BSE, having regular health check-ups with a physician was significantly associated with BSE performance. Several researchers have reported on the role of physicians and health care providers in educating and encouraging women to carry out BSE [10,11,27,28]. Routine breast  checks  by providers may help women to feel at ease and become more confident about performing BSE, and may pro- vide knowledge about its benefits. Women with higher levels of knowl- edge about breast cancer symptoms and screening demonstrated higher per- formance rates of BSE. This is consistent with previous findings suggesting that knowledge of breast cancer screening is an important facilitator for breast cancer screening behaviours [6,29,30]. Know- ing the steps required, understanding the required frequency of BSE and be- ing aware of the normal anatomy of their own breasts are issues that can be addressed by health personnel in assisting women to do BSE regularly. Information provided by health profes- sionals via the media about correct BSE techniques and other health education opportunities may increase women’s BSE practice [31]. Several factors based on the health belief model theory—greater confi- dence of women in their ability to perform BSE, higher health motivation and fewer barriers to BSE—were asso- ciated with performing BSE. However, confidence about performing BSE was the only factor that reached statistical significance. Similarly Yarbrough et al. [32] and MacDonald et al. [33]  found  that the health belief model did not predict breast cancer screening behav- iour. The low variance on the perceived belief scales among our subjects may ex- plain why the other health belief model scales could not predict breast cancer screening behaviour. The significant association between confidence and BSE performance in the previous year is consistent with the results of other studies  [29,34,35]. This highlights  the  importance of introducing educational programmes to increase confidence and identifying barriers to BSE for Ma- laysian women. Intervention strategies should focus on teaching women how to make BSE a monthly habit. Although a large proportion of the women in this study perceived breast cancer as a serious disease, most of them did not perceive themselves as being Table 2 Comparison of knowledge and belief scores with breast self-examination (BSE) performance among participants (n = 425) Variable Performing BSE (n = 230) Not performing BSE (n = 195) Range t-test P-value Mean score SD Mean score SD Knowledge Incidence knowledge 1.98 0.84 1.80 0.87 1–3 2.197 0.290 Symptom knowledge 2.75 1.22 2.18 1.34 1–7 4.488 0.001 Risk factor knowledge 6.43 2.57 5.50 2.55 1–15 3.668 0.001 Screening knowledge 10.59 2.46 9.00 3.41 1–18 5.500 0.001 Total knowledge 21.77 5.18 18.55 6.28 1–43 5.702 0.001 Beliefs Susceptibility to breast cancer 2.39 0.75 2.29 0.84 1–5 1.270 0.204 Seriousness of breast cancer 3.46 0.70 3.39 0.77 1–5 0.926 0.355 Benefits of BSE 3.89 0.50 3.79 0.62 1–5 1.829 0.068 Barriers to BSE 3.66 0.63 3.87 0.56 1–5 3.423 0.001 Confidence in performing BSE 3.49 0.46 3.21 0.53 1–5 5.758 0.001 Health motivation 3.98 0.50 3.77 0.51 1–5 4.103 0.001 Total beliefs 3.51 0.23 3.23 0.30 1–5 6.116 0.001 SD = standard deviation. Book 17-6.indb 513 6/6/2011 9:44:56 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 514 Table 3 Logistic regression analysis for factors related to performing breast self-examination (BSE) (n = 425) Variable β-coefficient SE Wald P-value OR 95% CI Marital status Single 1 Married 0.244 0.520 0.221 0.638 1.28 0.46–3.53 Age (years) 20–30 1 31–40 0.55 0.370 0.022 0.883 1.06 0.51–2.18 41–50 –0.360 0.429 0.703 0.402 0.70 0.30–1.62 > 50 –1.177 0.809 2.129 0.145 0.31 0.06–1.50 Education Diploma 1 Degree 0.310 0.515 0.364 0.546 1.36 0.50–3.74 Postgraduate –0.450 0.819 0.302 0.583 0.64 0.13–3.17 Income (RM) < 3000 1 3000–5000 –0.123 0.402 0.093 0.760 0.88 0.40–1.95 > 5000 0.389 0.446 0.760 0.383 1.48 0.62–3.34 Insurance No 1 Yes 0.105 0.314 0.112 0.738 1.11 0.60–2.06 Regular health checkups No 1 Yes 1.291 0.354 13.325 0.001 3.64 1.82–7.27 Family history of breast cancer No 1 Yes 0.912 0.506 3.249 0.071 2.49 0.92–6.71 Personal history of breast disease No 1 Yes –0.156 0.849 0.034 0.854 0.86 0.16–4.52 Heard about BSE No 1 Yes 0.626 1.119 0.313 0.576 1.87 0.21–16.8 Perceived health status Poor 1 Good 1.467 0.958 2.346 0.126 4.34 0.66–28.3 Satisfied 1.522 0.946 2.587 0.108 4.58 0.72–29.3 Undergoing clinical breast examination No 1 Yes 0.639 0.335 3.634 0.057 1.90 0.98–3.66 Sources of information Others 1 Doctors 0.115 0.301 0.147 0.701 1.12 0.63–2.62 Knowledge and beliefs Knowledge of breast cancer & screening 0.073 0.026 8.240 0.004 1.08 1.02–1.13 Susceptibility to breast cancer 0.054 0.034 2.522 0.112 1.06 0.99–1.13 Seriousness of breast cancer 0.033 0.026 1.591 0.207 1.03 0.98–1.09 Benefits of BSE 0.003 0.048 0.003 0.955 1.01 0.88–1.07 Barriers to BSE –0.010 0.041 0.061 0.806 0.91 0.92–1.00 Confidence in BSE 0.061 0.028 4.804 0.028 1.06 1.00–1.12 Health motivation 0.043 0.043 1.036 0.309 1.04 0.96–1.14 SE = standard error; OR = odds ratio; CI = confidence interval; RM = Malaysian ringgit. Book 17-6.indb 514 6/6/2011 9:44:56 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 515 susceptible. This could be due to a lack of education on breast cancer and breast cancer screening practices. Health care personnel can provide information about the magnitude and risk factors of breast cancer through public health education programmes. We found no significant relationship between women’s beliefs about the seriousness of breast cancer and BSE practice. Previous studies have shown variable results about the relation- ship of perceived seriousness of breast cancer with BSE practices. While studies in the USA [30], Jordan [10] and Korea  [29] suggested that screening  increases  with increased perceived seriousness of breast cancer, other studies in Turkey [11] and Hong Kong [36] found no as- sociation between perceived seriousness and BSE behaviors. Women need to be helped to avoid misconceptions about breast cancer and learn more about the benefits of early detection methods and timely treatment of breast cancer. The majority of women in this study had positive beliefs about the benefits of BSE. Several studies have reported a significant positive relationship be- tween perceived benefits of screening and BSE practice  [11,15,37], whereas  others have found no significant effect [10,35]. This  indicates a need  for well- designed awareness programmes that underline the benefits of preventive care and early screening. Lack of knowledge, no time for BSE, embarrassment, fear of cancer diagnosis and perception of low susceptibility to breast cancer were common barriers for performing BSE in the current study. Thus, further qualitative research is needed to identify barriers to BSE for Malaysian women. Although a majority of the women in this study had high health motiva- tion, this was not a predictor for BSE practice. According to previous studies using the health belief model, women who are more motivated to promote their health are more likely to perform BSE [10,29,30]. Similar to our finding,  Secginli and Nahcivan found no asso- ciation between health motivation and BSE practice [11].  Our results contrasted with previ- ous findings suggesting that younger and well-educated women are more likely to practice breast cancer screen- ing [11,17]. Women’s family history of  breast cancer was not a predictor for performing BSE also contrasted with previous  studies  [7,10,11].  It  could be  related to the small sample size and the low rate of family history of breast can- cer among women in this study. There were some limitations to this study. First, the participants were all secondary school teachers and were therefore unlikely to represent all Ma- laysian women and this influences the generalizability of the study results. Secondly, a self-administered question- naire might lead to overestimation of cancer screening practices and use of References National cancer registry, Malaysia 2003.1. The second report. Kuala Lumpur, Malaysia, Ministry of Health, 2003 Smith RA, Cokkinides V, Brawley OW. Cancer screening in 2. the United States, 2009: a review of current American Cancer Society guidelines and issues in cancer screening. CA: a Cancer Journal for Clinicians, 2009, 59:27–41. Franco EL, Duarte-Franco E, Rohan TE. Evidence-based policy 3. recommendations on cancer screening and prevention. Can- cer Detection and Prevention, 2002, 26:350–361. Smith RA, Cokkinides V, Eyre HJ; American Cancer Society. 4. American Cancer Society guidelines for the early detection of cancer, 2003. CA: a Cancer Journal for Clinicians, 2003, 53:27–43. Clinical practice guidelines for management of breast cancer5. . Kuala Lumpur, Malaysia, Ministry of Health, 2002. Phillips JM, Wilbur J. Adherence to breast cancer screening 6. guidelines among African-American women of differing em- ployment status. Cancer Nursing, 1995, 18:258–269. Salazar MK. Breast self-examination beliefs: a descriptive 7. study. Public Health Nursing (Boston, Mass.), 1994, 11:49–56. Miedema BB, Tatemichi S. Breast and cervical cancer screen-8. ing for women between 50 and 69 years of age: what prompts women to screen? Women’s Health Issues, 2003, 13:180–184. Lu ZJ. Effectiveness of breast self-examination nursing inter-9. ventions for Taiwanese community target groups. Oncology Nursing Forum, 1998, 25:1693–1701. health care services by subjects, a find- ing that could reduce the validity of the study. Thirdly, the study included a large number of young women. The inclusion of more women in the older age groups (particularly menopausal women), could yield a larger proportion of women who are currently practising BSE. Further research is recommended using a larger sample size with women of different ages, sociodemographic groups and occupational backgrounds. Nevertheless, the findings of this study could influence the planning of specific screening interventions and strategies for Malaysian women. Conclusions The fact that most breast cancers are found  by  patients  themselves  [3,38]  suggests that women should know about breast cancer symptoms and BSE techniques for early detection. In- creased knowledge about breast cancer risk factors and screening methods can help women to change their lifestyle risk factors, decrease modifiable risk fac- tors and actively practice breast cancer screening. The findings of this study point to an urgent need to increase Ma- laysian women’s awareness about the value of BSE. The health belief model may be a useful framework for planning programmes for the early detection of breast cancer in Malaysian women. Book 17-6.indb 515 6/6/2011 9:44:56 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 516 Petro-Nustus W, Mikhail BI. Factors associated with breast self-10. examination among Jordanian women. Public Health Nursing (Boston, Mass.), 2002, 19:263–271. Secginli S, Nahcivan NO. Factors associated with breast cancer 11. screening behaviours in a sample of Turkish women: a ques- tionnaire survey. International Journal of Nursing Studies, 2006, 43:161–171. Narimah A. Breast examination. In: Public Health Institute, 12. Ministry of Health. Report of the second national health and morbidity survey conference. Kuala Lumpur, Ministry of Health, 1997:145–148. Rosenstock IM. Why people use health services. 13. Milbank Me- morial Fund Quarterly, 1995, 44:94–127. Champion VL. Instrument refinement for breast cancer screen-14. ing behaviors. Nursing Research, 1993, 42:139–143. Champion VL, Scott CR. Reliability and validity of breast cancer 15. screening belief scales in African American women. Nursing Research, 1997, 46:331–337. Pisani P, Bray F, Parkin DM. Estimates of the world-wide preva-16. lence of cancer for 25 sites in the adult population. Interna- tional Journal of Cancer, 2002, 97:72–81. Hoeman SP, Ku YL, Ohl DR. Health beliefs and early detection 17. among Chinese women. Western Journal of Nursing Research, 1996, 18:518–533. Straughan PT, Seow A. Attitudes as barriers in breast screening: 18. a prospective study among Singapore women. Social Science & Medicine, 2000, 51:1695–1703. Juon HS, Seo YJ, Kim MT. Breast and cervical cancer screening 19. among Korean American elderly women. European Journal of Oncology Nursing, 2002, 6:228–235. Legg JS, Fauber TL, Ozcan YA. The influence of previous breast 20. cancer upon mammography utilization. Women’s Health Is- sues, 2003, 13:62–67. Parsa P et al. Knowledge and behaviors on breast cancer 21. screening among female teachers in Selangor, Malaysia. Asian Pacific Cancer Prevention Journal, 2008, 9:271–278. Nunnally J, ed. 22. Psychometric theory. New York, McGraw-Hill, 1967. Parsa P et al. Reliability and validity of Champion’s Health Be-23. lief Model Scale for breast cancer screening among Malaysian women. Singapore Medical Journal, 2008, 49:897–903. Jarvandi S et al. Beliefs and behaviours of Iranian teachers 24. toward early detection of breast cancer and breast self-exami- nation. Public Health, 2002, 116:245–249. Yanni-Seif N, Aziz M. Effect of breast self examination training 25. program on knowledge, attitude and practices of a group of working women. Journal of the Egyptian National Cancer Insti- tute, 2000, 12:105–115. Rashidi A, Rajaram SS. Middle Eastern Asian Islamic women 26. and breast self-examination. Needs assessment. Cancer Nurs- ing, 2000, 23:64–70. Ajayi IO, Adebamowo CA. Knowledge, belief, attitudes to-27. wards breast cancer in Southwestern Nigeria. Cancer Strategy, 1999, 1:20–24. Aliabadi-Wahle S. Training in clinical breast examination as 28. part of a general surgery core curriculum. Journal of Cancer Education, 2000, 15:10–13. Han Y, Williams RD, Harrison RA. Breast cancer screening 29. knowledge, attitudes, and practices among Korean American women. Oncology Nursing Forum, 2000, 27:1585–1591. Champion VL, Menon U. Predicting mammography and breast 30. elf-examination in African American women. Cancer Nursing, 1997, 20(5):315–322. Kalichman SC, Williams E, Nachimson D. Randomized com-31. munity trial of a breast self-examination skills-building inter- vention for inner-city African-American women. Journal of the American Medical Women’s Association, 2000, 55:47–50. Yabroff KR, Mandelblatt JS. Interventions targeted toward 32. patients to increase mammography use. Cancer Epidemiology, Biomarkers & Prevention, 1999, 8:749–757. McDonald PA et al. Perceptions and knowledge of breast 33. cancer among African-American women residing in public housing. Ethnicity & Disease, 1999, 9:81–93. Erblich J, Bovbjerg DH, Valdimarsdottir HB. Psychological dis-34. tress, health beliefs, and frequency of breast self-examination. Journal of Behavioral Medicine, 2000, 23:277–292. Smiley MR et al. Comparison of Florida Hispanic and non-35. Hispanic Caucasian women in their health beliefs related to breast cancer and health locus of control. Oncology Nursing Forum, 2000, 27:975–984. Fung SY. Factors associated with breast self-examination be-36. haviour among Chinese women in Hong Kong. Patient Educa- tion and Counseling, 1998, 33:233–243. Bazargan M et al. Mammography screening and breast self 37. examination among minority women in public housing projects: the impact of physician recommendation. Cel- lular and molecular biology (Noisy-le-Grand, France), 2003, 49(8):1213–1218. Aspinall V. An effectiveness way to reduce mortality. Screen-38. ing for malignant breast disease. Professional Nurse (London, England), 1991, 6:283–287. Book 17-6.indb 516 6/6/2011 9:44:56 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 517 Evaluating success of no-scalpel vasectomy by ligation and excision with fascial interposition in a large prospective study in Islamic Republic of Iran H.R. Farrokh-Eslamlou,1 M. Eslami,1 I. Abdi-Rad 1 and B. Eilkhanizadeh 1 ABSTRACT The aims of this prospective, non-comparative study were to determine time to azoospermia and vasectomy success rate based on the results of semen analysis. A total of 334 men seeking vasectomy at a clinic in Urmia city, Islamic Republic of Iran were followed bi-weekly up to 24 weeks after vasectomy or until azoospermia was confirmed via semen analysis. The cumulative life table rate for azoospermia was 93/100 men (95% CI: 88.1 to 97.9). The median time to azoospermia was 10 weeks. By week 24 of follow-up, 3.3% of participants had failed to achieve azoospermia. One pregnancy was reported during the study period and attributed to user failure. The results suggest that men can begin to rely on vasectomy for contraception 12 weeks after no-scalpel vasectomy using fascial interposition performed by an experienced surgeon. 1Reproductive Health Research Centre, Urmia University of Medical Sciences, Urmia, Islamic Republic of Iran (Correspondence to M. Eslami: parhamii@hotmail.com). Received: 29/09/09; accepted: 26/11/09 في ةيربك ةيقابتسا ةسارد في تافافللا ينب عطقلاو طبرلاب طشرم نودب )ينَّيونلما نْيَءاعولا( نْيَرهسلأا عطق تايلمع حاجن مييقت ةيملاسلإا ناريإ ةيروهجم .هداز نياخليإ زوربه ،دار يدبع ىسيع ،يملاسإ دممح ،ولملاسإ خرف اضر ديحم ًادانتسا )ْينَّيونلما نْيَءاعولا( نْيَرهسلأا عطق حاجن لدعمو فاطنلا مادعنا تقو لىع فرعتلا ةنراقلما يرغ ةيقابتسلاا ةساردلا هذه فدهتست :ةصلالخا ،ةيملاسلإا ناريإ ةيروهجم في ايمروأ ةنيدم تادايع في نْيَرهسلأا عطق ءارجإ اوبلط ًلاجر 334 نوثحابلا عبات دقف .يونلما لئاسلا ليلتح جئاتن لىع .يونلما لئاسلا ليلحتب فاطنلا مادعنا نم دكأتلا ىتح وأ )ْينَّيونلما نْيَءاعولا( نْيَرهسلأا عطق دعب ًاعوبسأ 24 رورم ىتح ينعوبسأ لك ةعباتلما اورجأف لوصولل يطسولا نمزلا امأ .)%95 ةقث ةلصافب 97.9 لىإ 88.1( لجر ةئم لكل 93 غلبي برتخلما في فاطنلا مادعنلا يمكاترلا لدعلما نأ نوثحابلا دجوو نع غلبُأ دقو .فاطنلا مادعنا لىإ ينكراشلما نم %3.3 لصي لم ةعباتلما نم نيشرعلاو عبارلا عوبسلأا لولحبو .عيباسأ ةشرع ناكف فاطنلا مادعنا لىإ نْيَرهسلأا عطق لىع دماتعلاا لاجرلا ناكمإب نأ لىإ جئاتنلا يرشتو .ةيلمعلا قافخإ لىإ لملحا اذه َيِزُعو ،ةساردلا ةترف للاخ دحاو ٍلحم ثودح ينب طبرلا ءارجإب طشرم نودب )ْينَّيونلما نْيَءاعولا( نْيَرهسلأا عطق لىع ًاعوبسأ شرع ينثا ءاضقنا دعب كلذو لملحا عنم لجأ نم )ْينَّيونلما نْيَءاعولا( .سرمتم حارج هارجأ اذإ تافافللا Évaluation de l’efficacité de la vasectomie sans bistouri par ligature et excision avec interposition fasciale dans une étude prospective à grande échelle en République islamique d’Iran RÉSUMÉ Les objectifs de la présente étude prospective et non comparative étaient de déterminer le temps jusqu’à l’azoospermie et le taux d’efficacité de la vasectomie mesurés par spermogramme. Au total, 334 hommes ayant subi une vasectomie dans un dispensaire de la ville d’Urmia (République islamique d’Iran) ont été suivis deux fois par semaine et jusqu’à 24 semaines après l’intervention ou jusqu’à la confirmation de l’azoospermie au moyen du spermogramme. Le taux cumulé pour l’azoospermie en utilisant la table de survie était de 93/100 hommes (IC à 95 % : 88,1 à 97,9). Le temps médian jusqu’à l’azoospermie était de dix semaines. À la vingt-quatrième semaine de suivi, 3,3 % des participants n’avaient pas obtenu une azoospermie. Une grossesse a été rapportée pendant la période de l’étude et imputée au comportement du patient. Les résultats suggèrent que les hommes peuvent commencer à compter sur l’efficacité de la vasectomie pour assurer leur contraception douze semaines après une intervention sans bistouri avec interposition fasciale réalisée par un chirurgien expérimenté. Book 17-6.indb 517 6/6/2011 9:44:57 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 518 Introduction Vasectomy is one of the safest family planning methods currently available and continues to be the most reliable form of male contraception worldwide. Over 45 million couples rely on vasec- tomy as their method of family planning [1]. Li  Shunqiang of  the Chongqing  Family Planning Scientific Research Institute in China developed the no- scalpel vasectomy (NSV) technique in 1974. Today, NSV is a popular family planning method in many countries as it eliminates concerns about incisions and has a low complication rate [2]. The success of vasectomy is confirmed by the demonstration of azoospermia (absence of sperm in the ejaculate). Even so, the desired end- point of azoospermia is not achieved immediately after surgery and requires analysis of semen samples obtained at one or more clinic visits following the procedure. It is widely accepted in clini- cal practice that becoming azoospermic may take up to several months for most men because of sperm residing in the seminal vesicles and vas deferens up- stream  from  the  surgical  incision  [3].  The duration of the risk of pregnancy after a vasectomy varies greatly and is based on factors such as the time and/ or the number of ejaculations since va- sectomy, sperm motility, sperm viability and the method of vas occlusion [4–7].  In the clinical setting, recommenda- tions for semen analysis vary widely from 1  to 12 months  [8].  In addition,  since men are advised to use alterna- tive contraception until azoospermia is confirmed, a long interval to the first follow-up visit may be problematic for some men, and those who do not dem- onstrate azoospermia must return for further visits, and therefore follow-up rates and compliance with semen testing protocols are often poor [9,10]. While  counselling guidelines commonly used in vasectomy centres recommend that men can rely on vasectomy for con- traception  after  20  ejaculations  or  2  months [11,12], in the Islamic Republic  of Iran the recommended time interval is 3 months. While many reports have been pub- lished on the time to azoospermia and the number of ejaculations required for achieving azoospermia following vasectomy, most of these are retrospec- tive, descriptive studies, and interpreting the data are difficult [13,14]. One care- fully controlled prospective study on the time and number of ejaculations to azoospermia after vasectomy by ligation and excision showed only 60/100 and  27.9/100 of men were azoospermic by  12 weeks and 20 ejaculations,  respec- tively [15]. This  result  is different  from  our experience at the national NSV training centre in the Islamic Republic of Iran after more than 9000 vasectomies  using the NSV technique. We therefore conducted this large prospective study to examine the vasectomy success rate of NSV with fascial interposition, to determine the time to azoospermia and to evaluate adverse events associated with the method. Methods Study design This was a prospective, non-compara- tive study of men followed for up to 24  weeks after vasectomy. The study was conducted  from  January 2007  to De- cember 2008 at  a  reproductive health  research centre in Urmia city, Islamic Republic of Iran. Sample As a routine of the clinic, all vasectomy clients together with their wives par- ticipated in family planning counsel- ling to make sure that vasectomy was their informed choice. Men seeking vasectomy were asked if they would like to participate in the study, and then were screened for eligibility. Informed consent, a medical history, physical ex- amination and a pre-vasectomy semen sample were obtained. The eligibility criteria included: meeting the above-mentioned clinic criteria for vasectomy; being currently sexually active; willing to provide a se- men specimen pre-vasectomy and bi- weekly up to 24 weeks after vasectomy  or until azoospermia was confirmed; and freely consenting to participate in the study and sign an informed consent form. Exclusion criteria were: any acute or febrile illness; history of prior vasec- tomy or other scrotal surgery; clinical evidence of active sexually transmitted infection; a large varicocele or other scrotal mass; or taking any type of ana- bolic steroids. Over the period of the study out of a total of 1622 men who underwent va- sectomy at Urmia reproductive health research  centre  380  (23.4%)  were  compatible with the eligibility criteria and were enrolled in the study. Of the 380  enrolled men,  46  (12.1%) never  returned for follow-up after vasectomy and were therefore excluded from anal- ysis. The study group therefore included 334 men who delivered at least 1 semen specimen after vasectomy. Vasectomy technique Vasectomy was performed using the no-scalpel technique following local infiltration with  2%  epinephrine-free  lidocaine. The vas deferens was ligated at 2  locations approximately 1.5 cm apart  using 2  separate 2.0  silk  ligatures  and  the segment of vas about 1 cm between the ligations was excised. Then fascial interposition was performed with the stump of the vasal prostatic end outside the fascial sheath and the stump of the testicular end inside the fascial sheath. The surgeons were master trainers in the technique, which ensured that stand- ardized NSV with fascial interposition was used for all participants. Prior to the study the surgeons attended a meeting where the technique was standardized under the supervision of the developers of the NSV technique in China. After vasectomy, participants were given instructions about the conduct of Book 17-6.indb 518 6/6/2011 9:44:57 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 519 the study and asked to return bi-weekly until they were told that they could rely on vasectomy for contraception. A se- men analysis was performed at post- vasectomy follow-up visits. Men who did not attain azoospermia by 24 weeks  after vasectomy were counselled regard- ing potential fertility and offered addi- tional semen testing, another vasectomy or other contraceptives. At all follow-up visits, the investigators examined each patient for granuloma, haematoma, epididymitis or wound infection. Semen analysis procedures We performed semen analysis pre- vasectomy and then bi-weekly up to 24 weeks  after  vasectomy or  until  azoospermia was confirmed. Men who did not develop azoospermia at week 24  were followed up to week 34 to evaluate the delayed onset of azoospermia. Participants produced semen sam- ples at their home. Semen was examined for concentration and motility within 1 hour of collection using procedures based on World Health Organization guidelines  [16] under  the  supervision  of a pathologist who was expert in this procedure. Briefly, an aliquot of semen was examined by phase-contrast mi- croscopy at high-power magnification (× 400)  to estimate  sperm concentra- tion. Appropriate dilutions of 1:4 to 1:20 depending on  the estimated con- centration were prepared using water to determine the concentration and using saline for motility subjective assessment (0%  to  100%).  Concentration  and  motility were determined using an im- proved Neubauer haemocytometer. If no sperm were seen on the initial phase contrast examination, semen samples were centrifuged at 600 g for 15 minutes  and then were examined as previously described. Analysis Men who delivered at least 1 post- vasectomy sample were included in the analysis. Participants’ baseline information (age, spouse’s age and pre- vasectomy semen analysis measures) was summarized using mean, standard deviation (SD), minimum, maximum and median values. Vasectomy suc- cess,  i.e. azoospermia, was defined as 2  consecutive semen specimens without sperm. The follow-up weeks were de- fined with a follow-up window of 14 (SD 7) days from the previous visit. For example, week 16 was defined as a visit ≥ 108 days or ≤ 119 days since the  procedure. The presence of any motile sperm at week 24 or later in the semen  specimen was used to define vasectomy failure. In evaluating azoospermia and motility,  2  outcome measures  were  evaluated: the median number of weeks to azoospermia or zero motility; and the week in which the cumulative rate reached the maximum level observed during the study. Changes over time were evaluated first for each outcome for all ages com- bined, followed by the results stratified by age. The time to azoospermia were calculated from the date of vasectomy to the date of the first specimen without sperm. The censor date for men not achieving azoospermia was the date of the last semen analysis. To calculate time to azoospermia, cumulated life-table probabilities were used. The results are reported at 12 weeks  after  vasectomy  due to current counselling guidelines in the Islamic Republic of Iran. Results Participants’ characteristics Of  the  334  men,  280  participants  (83.8%)  demonstrated  azoospermia  according to the study definition; 11 participants  (3.3%)  completed  the  study but did not achieve azoosper- mia by 24 weeks of  follow-up and  so  were defined as vasectomy failure; 43 participants (12.9%) discontinued  the  study prior to reaching azoospermia or reaching 24 weeks follow-up. Of the  latter  group  13  (3.9%) discontinued  for personal  reasons and  the other 30  (9.0%)  for unknown reasons,  i.e. were  lost to follow-up. The 43 men who had the potential to reach azoospermia but whose semen analysis status was un- known were included in all the analyses. No pregnancies related to vasectomy failure were reported. Baseline data The mean age of all study participants who delivered at least 1 sample for analysis after vasectomy was 40.9 years  (range 26  to 76 years). The mean age  of participants’ wives was 34.4 years (range 22 to 53 years). All participants  were married men, their spouse had most commonly used the combined oral contraceptive pill before the vasec- tomy (32.9%) and most of them had 2  children (59.9%). The mean volume of ejaculate analysed in the pre-vasectomy semen specimen was 3.6 mL (range 0.6–6.7  mL). The mean concentration of the sperm in the samples was 115 million/ mL (range 20–250 million/mL). The  mean percentage of motile sperm was 66.6% (range 34% to 88%). Time to azoospermia For the primary analysis, the cumulative survival curve of time to azoospermia estimated by the life table method was calculated (Figure 1). At the end of week  22, which was  the  last  visit  for  determining azoospermia, the cumula- tive life table rate for azoospermia was 93/100 men [95% confidence  interval  (CI): 88.1–97.9].  When time to azoospermia was examined by age group, younger men reached azoospermia at a faster rate (Figure 2). The cumulative life table rate  for men under age 40 years reached its  maximum of 95.5/100 men (95% CI:  90.4–00.6). At  the age 40+ years, men  reached the cumulative life table rate of 89/100 men (95% CI: 82.5–95.5). The median t ime to success (azoospermia)  was  10  weeks  for  all  participants. Among men under age Book 17-6.indb 519 6/6/2011 9:44:57 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 520 40 years and men of age 40+ years  the  median times to azoospermia were 8.5 and 11.5 weeks respectively. The cumulative survival prob- ability  for  azoospermia was 76.0/100  men (95% CI: 69.6–82.4) at 12 weeks  (Figure 1). Vasectomy failure based on semen analysis By week 24 of follow-up, 11 of the 334  participants  (3.3%) had not  achieved  azoospermia. All of these men accepted an offer of extended follow-up to 34 weeks. Of this group 4 participants (1.2%  of the total) ended the 24 weeks follow- up with persistent low sperm concentra- tions  (mean 25 000  sperm/mL), but  reached azoospermia at 34 weeks after vasectomy. Presumably these men had delayed onset success of vasectomy. The other 7 participants (2.1% of total)  had sperm concentrations greater than 2 million sperm/ mL (mean 25 million  sperm/mL) with many motile sperm at 34 weeks. These men were considered to have vasectomy failure. Pregnancies One pregnancy was reported during the study period. This pregnancy occurred about 1 month after vasectomy, when the participant failed to use back-up fam- ily planning method as instructed until reaching azoospermia. The participant reported that prescribed condoms were not used during sexual intercourse. This was considered a user failure. Among the 8 men with vasectomy failures, 6 accepted an offer of repeat vasectomy. Adverse events At every post-vasectomy follow-up visit, all of the participants were clinically examined and were asked questions about probable adverse events. The most commonly reported adverse event was mild post-surgical local pain. Among  286 men  (85.6%) with  data  on  post-surgical  pain,  145  (50.7%)  reported taking no analgesics. 84 (29.4%)  reported  analgesic use  for  a  maximum of 3 days, 41 (14.3%) for up  to 1 week, and 16 (5.6%) for more than  1 week. Urogenital adverse events con- sidered to be related to the procedure were:  sperm granuloma  in 27 (8.1%),  epididymitis  or  orchitis  in  4  (1.2%),  scrotal pain or swelling in 6 cases (1.8%)  and haematomas in 5 (1.5%). The hae- matomas were small and none required drainage.  Infections  occurred  in  2  (0.6%) of the cases. No serious adverse  events were reported. Weeks to azospermia C um ul at iv e ra te 0 5 10 15 20 25 1.0 0.8 0.6 0.4 0.2 0.0 Figure 1 Gross cumulative life table probabilities for azoospermia after no-scalpel vasectomy by ligation and excision with fascial interposition (n = 334) Book 17-6.indb 520 6/6/2011 9:44:57 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 521 Discussion This was a large prospective study which provided detailed information on the success of vasectomy by using the technique of NSV by ligation and exci- sion together with fascial interposition occlusion. Prospectively gathered data with frequent semen analysis are rare in the literature. Our study has shown rapid achievement of azoospermia us- ing this technique, a high cumulative life table rate for azoospermia at the end of week 22  (93/100)  and  a  low  proportion of men potentially at risk for fertility at 34 weeks. Younger men reached azoospermia at a faster rate than older men. Even in developed countries com- pliance with post-vasectomy follow-up is poor [9,10]. In our study only 12.1%  of enrolled men never returned for follow-up after vasectomy and were ex- cluded  from analysis, and only 9.0% of  those in analysis could be defined as lost to follow-up. Pre- and post-vasectomy counselling may have been a factor in good post-vasectomy follow-up com- pliance. The  2.1%  vasectomy  failure  rate  based on semen analysis in this study was  lower  than  the 11.5% [15], 12.7%  and 5.9% [17]  failure  rates  from other  well-designed studies, but was similar to the commonly cited failure rate of 1% to  2%. One of the above-mentioned stud- ies was prospective [15] and the other  was a large randomized controlled trial [17], but these high rates were the result  of vasectomies without fascial inter- position. Our rate is even lower than the failure rates reported elsewhere for vasectomies with fascial interposition [17].  It  should be noted  that all vasec- tomies in our study were performed by master trainers with experience of more than 10 000 NSVs  and other  factors  such as the experience of the surgeon may be effective in reducing the failure rate of vasectomy, as others have sug- gested [17]. A broad range of failure rates have been reported for vasectomy, including pregnancy  rates of  4.2% at 3  years  in  Nepal [18] and 9.5% at 5 years in China  [19]. Our study outcomes were based  on semen analysis rather than on preg- nancy data, but it is worth noting that, despite the fact that the participants and their wives were young on average, we had no pregnancies reported in the 2-year period of  the  study  except  for  1 case of user failure. This prospective study is continuing to gather longer term follow-up data from study participants Weeks to azospermia C um ul at iv e ra te 1.0 0.8 0.6 0.4 0.2 0.0 0 5 10 15 20 25 Age group ≤ 40 years > 40 years Figure 2 Gross cumulative life table probabilities for azoospermia by age group after no-scalpel vasectomy by ligation and excision with fasacial interposition (n = 334) Book 17-6.indb 521 6/6/2011 9:44:57 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 522 to examine possible later occurrence of pregnancy, as well as long-term com- plications and the occurrence of rare non-motile sperms. At 12 weeks  after  vasectomy,  the  cumulative probability for azoospermia was 76.0/100  in  this  study  in contrast  with 60.0/100  in a  study where  fascial  interposition was not used for vasal oc- clusion [15]. Therefore, current guide- lines of azoospermia at 12 weeks used  in low-resource settings such as many NSV centres in the Islamic Republic of Iran, may leave only about 20% of men  at risk for continued fertility. The results of this study are consistent with the recommendation of Barone et al. that 3 months is a better criterion for doing semen analysis [15]. Within 8 weeks of  surgery,  13.2%  of the participants reported one or more related adverse events and this is comparable with other well-designed studies [15,17]. All of the adverse events  were mild and temporary. There were some limitations to the study. One limitation was that for re- ligious reasons the men preferred to produced semen samples at home by intercourse rather than by masturbation at the health centre. This caused logistic problems in the delivery of samples to the health centre laboratory for exami- nation within 1 hour, especially for men who lived far from the health centre. However, it is important to note that due to active follow-up and efficient systems at the health centre, all semen samples were examined within 1 hour. The lack of a comparison group or ran- domization of the participants necessi- tates caution in interpreting the results. Conclusions Our results indicate that NSV by liga- tion and excision together with fas- cial interposition may be effective in decreasing the time to azoospermia, increasing the cumulative life table rate for azoospermia and reducing vasectomy failure rates. It appears that current guidelines for when men can begin to rely on vasectomy for con- traception  based  on  12  weeks  after  vasectomy can replace semen testing when ligation and excision with fascial interposition is performed by an expe- rienced surgeon. Acknowledgements The authors would like to thank the personnel of the clinic and laboratory for their excellent collection of data and all participants for their cooperation in delivering semen specimens. Financial support of this study was provided by Population and Fam- ily Health Department of Ministry of Health and Medical Education, and by the Deputy for Research, Urmia Uni- versity of Medical Sciences. References Haldar N et al. How reliable is a vasectomy? Long-term follow-1. up of vasectomised men. Lancet, 2001, 356:43–44. Sokal D et al.; the Male Sterilization Investigator Team. A 2. comparative study of the no scalpel and standard incision ap- proaches to vasectomy in 5 countries. Journal of Urology, 1999, 162:1621–1625. Belker AM et al. The high rate of noncompliance for post-3. vasectomy semen examination: medical and legal considera- tions. Journal of Urology, 1990, 144:284–286. Freund M, Davis JE. Disappearance rate of spermatozoa from 4. the ejaculate following vasectomy. Fertility and Sterility, 1969, 20:163–170. Schmidt SS. Vasectomy by section, luminal fulguration and 5. fascial interposition: results from 6248 cases. British Journal of Urology, 1995, 76:373–374. Marwood RP, Beral V. Disappearance of spermatozoa from 6. ejaculate after vasectomy. British Medical Journal, 1979, 1:87. Richardson DW, Aitken RJ, Loudon NB. The functional com-7. petence of human spermatozoa recovered after vasectomy. Journal of Reproduction and Fertility, 1984, 70:575–579. Haws JM et al. Clinical aspects of vasectomies performed in 8. the United States in 1995. Urology, 1998, 52:685–691. Bradshaw HD et al. Review of current practice to establish 9. success after vasectomy. British Journal of Surgery, 2001, 88:290–293. Maatman TJ, Aldrin L, Carothers GG. Patient noncompliance 10. after vasectomy. Fertility and Sterility, 1997, 68:552–555. Huezo CM, Carignan CS. 11. Medical and service delivery guidelines for family planning, 2nd ed. London, Stephen Austin and Sons., 1997. Hatcher RA et al. 12. The essentials of contraceptive technology. Bal- timore, Maryland, Population Information Program Center for Communicating Programs, 1997. Pollack AE, Barone MA. Male sterilization. In: Sciarra JJ, ed. 13. Gynecology and obstetrics. Volume 6. Chapter 47. Philadelphia, Lippincott Williams & Wilkins, 2000. Cortes M et al. Results of a pilot study of the time to azoosper-14. mia after vasectomy in Mexico City. Contraception, 1997, 56:215–222. Barone MA et al. A prospective study of time and number of 15. ejaculations to azoospermia after vasectomy by ligation and excision. Journal of Urology, 2003, 170:892–896. World Health Organization. 16. WHO laboratory manual for the examination of human semen and sperm-cervical mucus interaction, 3rd ed. Cambridge, Cambridge University Press, 1993. Sokal D et al.; Investigator Study Group. Vasectomy by ligation 17. and excision, with or without fascial interposition: a rand- omized controlled trial. BMC Medicine, 2004, 2:6. Nazerali H et al. Vasectomy effectiveness in Nepal: a retro-18. spective study. Contraception, 2003, 67:397–401. Wang D. Contraceptive failure in China. 19. Contraception, 2002, 66:173–178. Book 17-6.indb 522 6/6/2011 9:44:58 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 523 Prevalence and predictors of smoking among adolescent schoolchildren in Monastir, Tunisia S. El Mhamdi,1 G. Wolfcarius-Khiari,2 S. Mhalla,2 K. Ben Salem 1 and S.M. Soltani 1 ABSTRACT A study in Monastir, Tunisia estimated the prevalence of smoking and analysed the determinants of tobacco use among adolescents aged 10–19 years. An observational cross-sectional study was performed in the 8 colleges and high schools of Monastir city in 2004. The mean age of the 900 respondents was 15.8 (SD 2.2) years and 47.7% were aged under 16 years. The overall prevalence of cigarette use during the past year was 16.0% (30.2% among males and 4.6% among females). The first smoking experience was initiated by friends in 45.8% of cases, at a mean age of 13.8 (SD 2.3) years. One-fifth of smokers (21.5%) had used other forms of tobacco. In multivariate analysis, male sex, academic failure, poor family management, antisocial behaviour and addictive behaviour were the main predictors of adolescent smoking status. The prevalence of smoking among adolescents in Monastir is high and requires targeted action. 1Department of Preventive Medicine and Epidemiology, University Hospital of Monastir, Monastir, Tunisia (Correspondence to S. El Mhamdi: sanaelmhamdi@yahoo.fr). 2Department of Psychiatry, University Hospital of Monastir, Monastir, Tunisia. Received: 02/09/09; accepted: 31/03/10 سنوتب يرتسنلما ةنيدم سرادم في ينقهارلما ينب ينخدتلاب ةئبنلما لماوعلاو راشتنلاا لدعم نياطلس سيوسلا دممح ،لماس نب لماك ،ةلمح يماس ،يرايخ سويعكلوف وفايفنيج ،يدمحلما ءانس نيذلا ينقهارلما ينب غبتلا يطاعت تاد ِّدمح ليلتحو ،ينخدتلا راشتنا لدعم ريدقتل سنوتب يرتسنلما ةنيدم في ةساردلا هذه نوثحابلا ىرجأ :ةصلالخا ناكو .2004 ماع يرتسنلما ةنيدم في ايلع سرادمو تايلك نيماث في ةبقارلما لىع ةمئاق ةضرعتسم ةسارد يهو .ةنس 19و تاونس 10 ينب مهُرماعأ حواترت لياجملإا راشتنلاا لدعم غلبو .ةنس 16 رمع تتح مهنم %47.7 ناكو ،)2.2 يرايعلما فارحنلاا( ةنس 15.8 وه ةساردلل بيجتسم ةئم عست رماعأ طسوتم قيرط نع تأدب دق ينخدتلا براتج لىوُأ نأ ةساردلا تحضوأو .)ثانلإا نم 4.6%و ،روكذلا نم %30.2( %16.0 قباسلا ماعلا للاخ غبتلا يطاعتل ىرخأ ًلااكشأ )%21.5( يننخدلما سُخم ىَطاعتو .)2.3 يرايعلما فارحنلاا( ةنس 13.8 ُهُطسوتم رُمُع في ،تلاالحا نم %45.8 في ءاقدصلأا نم ٍءارغإ ،يميداكلأا ليصحتلا في قافخلإاو ،ركذلما سنلجا في لثمتت ينغلابلا ينخدتب ةئبنلما ةيسيئرلا لماوعلا نأ لىع تايرغتلما ديدعلا ليلحتلا َّلدو .غبتلا نم بلطتي امم يرتسنلما ةنيدم في ينقهارلما ينب ًاعفترم ينخدتلا راشتنا ناكو .ةينامدلإا تايكولسلاو ،نياودعلا يعماتجلاا كولسلاو ،ليئاعلا يربدتلا ءوسو .ينخدتلا ةحفاكلم ةفداه ًلااعفأ Prévalence et facteurs prédictifs du tabagisme chez les adolescents à Monastir (Tunisie) RÉSUMÉ Une étude effectuée à Monastir (Tunisie) a estimé la prévalence du tabagisme et analysé les déterminants de l’utilisation du tabac chez les adolescents âgés de 10 à 19 ans. Une étude transversale d’observation a été conduite dans huit établissements d’enseignement secondaire de la ville de Monastir en 2004. L’âge moyen des 900 répondants était de 15,8 ans (E.T. 2,2) et 47,7 % avaient moins de 16 ans. La prévalence globale de consommation de cigarettes au cours de l’année antérieure était de 16,0 % (30,2 % chez les adolescents et 4,6 % chez les adolescentes). La première expérience de consommation de tabac était initiée par des amis dans 45,8 % des cas, à un âge moyen de 13,8 ans (E.T. 2,3). Un cinquième des fumeurs (21,5 %) avait utilisé d’autres formes de tabac. Une analyse multivariée a montré que le sexe masculin, l’échec scolaire, une famille qui ne joue plus son rôle, un comportement antisocial et addictif étaient les principaux facteurs prédictifs du statut tabagique des adolescents. La prévalence du tabagisme chez les adolescents scolarisés à Monastir est élevée et appelle à une action ciblée. Book 17-6.indb 523 6/6/2011 9:44:58 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 524 Introduction In the face of anti-smoking interventions by policy-makers that aim to reduce the rate of smoking in populations, the tobacco industry often targets adoles- cents, who are seen as the weakest link in the tobacco epidemic chain [1]. Stud- ies show that almost all smokers initiate cigarette smoking during adolescence, a phase that is influenced by home habits, and the social and school context [2,3].  According to the World Health Organi- zation and other studies, the prevalence of smoking among school-age adoles- cents is high, especially in developing countries, with estimates ranging from 14%  to 29%  [4–7]. These figures  for  adolescents have serious public health implications  [4].  Efforts  to  prevent  uptake of tobacco use by adolescents requires knowledge of the magnitude and the determinants of their smoking habits [2]. A study in Tunisia in 1996 showed that the prevalence of tobacco smoking among adults was high (30.4% for both  sexes) and that the age at which people started smoking appeared to be falling [8]. Thus smoking by adolescents has  become a serious concern that demands specific actions such as targeted educa- tion campaigns [9]. The success of such  interventions requires knowledge of the epidemiological profile of the specific target group. The objective of this study was to estimate the prevalence of smok- ing and identify the determinants of tobacco use among school adolescents in the city of Monastir. Methods Setting and sampling We performed a cross-sectional study in the city of Monastir in Tunisia from 1 –21 May 2004. The city had 81 296  inhabitants  in 2004, of whom 17 885  (22%) were  adolescents  aged 10–19  years [10]. There were a total of 8 pub- lic and private institutions in the city (colleges and high  schools) with 240  classes and 7648 students at all levels. Among secondary school adolescents we expected the minimum prevalence of tobacco use to be 10%. The required  minimum sample size to determine the prevalence with 95% confidence  limits  and 2% precision was estimated  to be  864 adolescents. A stratified, random sampling meth- od was used to select a representative sample of school adolescents. All 8 pub- lic and private schools in Monastir city were included. In each school, classes were randomly selected according to the number at each  level. All 1023 adoles- cents in selected classes were included, of whom 940 were reached at the time  of the study and agreed to complete the questionnaire, resulting in a response rate  of  91.8%.  Incomplete  question- naires were returned by 40 students had  and these were excluded. Thus, our final sample comprised 900 students. Data collection Adolescents completed a self-adminis- tered questionnaire that was validated in a previous  study [11].  It  comprised  135 items covering the following do- mains: sociodemographic character- istics; smoking habits (age of starting smoking, number of cigarettes smoked per day, types of tobacco smoked and environmental tobacco exposure); con- sumption of toxic substances other than tobacco; family experiences; academic success or failure; addictive and anxious behaviour; aspects of quality of life that could influence smoking habits; and attitudes, perceptions and motivation for smoking Each domain was explored by various items (yes/no or Likert-type responses) and mean scores were cal- culated for each domain. After that, the score of each domain was divided into 2  classes  (yes/no)  according  to  the  cut-offs from previous studies using the same questionnaire [11]. The following operative definitions were used: non-smoker was a student who had never smoked tobacco in any form during his/her lifetime; smoker was a student who ever used cigarettes during the past year; smoking addiction was defined as a Fagerström test score ≥ 7 (high nicotine addiction). The distribution of the questionnaire was made outside examination and revi- sion periods and students completed the questionnaires in their classroom. The completed questionnaires were collected by the researchers. The survey was approved by the ethics committee of the Ministry of Education. The questionnaire was administered totally anonymously in the classroom. To protect the privacy of participants and to obtain as frank answers as possible, we explained to the students that questionnaires were anonymous. We also explained that participation was voluntary and that not participating would not have any repercussions. Statistical analysis To facilitate the statistical analysis we analysed only the domains of the questionnaire and not the 135 items separately. To identify factors associ- ated with tobacco addiction among adolescents in the city of Monastir, we used Student t-test to compare means and the chi-squared test to compare percentages. A P-value ≤ 0.05 was con- sidered to be statistically significant. Multivariate stepwise logistic regression was used to identify factors independ- ently associated with smoking status. In this model, variables with a univariate test value ≤ 0.25 were included. The final  returned variables were those significant at the level of 5%. Confidence intervals  (CI) at the 95% level were used for es- timation and generalization of different frequencies. Results The mean age of  the 900  respondents  was 15.8 (SD 2.2) years and 47.7% were  Book 17-6.indb 524 6/6/2011 9:44:58 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 525 under 16 years. There was preponder- ance of females in the sample (sex ratio = 0.8) and 92.2% of  adolescents were  living with both their parents. A total of 144 students reported that they were smokers, giving a preva- lence of smoking among these school adolescents of 16.0%. The prevalence  of  smoking  among  men  was  30.2%  (n = 121) and among women was 4.6%  (n = 23). The median number of ciga- rettes smoked was 7 per day (interquar- tile range 4–15).  Among smokers there were a sig- nificantly higher proportion of males than  females  (84.0%  versus  16.0%)  (P < 0.01) and of those aged < 16 years  than ≥ 16 years (53.5% versus 46.5%)  (P < 0.01). However, it did not differ sig- nificantly by parent’s level of education or parent’s smoking status (Table 1). The mean age of smokers was 15.5 (SD 2.1)  years  and  the mean  age  at  the first smoking experience was 13.8 (SD 2.3) years, with  a  significant dif- ference according to sex: females were older than males at the first smok- ing  experience  (Table 2)  (P  < 0.01). Smoking initiation was motivated by a  friend  in 45.8% of  cases  and by  the  smoker’s family in 10.8%. Among these  smokers,  21.5%  (n = 31) reported consuming other tobacco products, 8.2% consumed alcohol and 2.1% were  cannabis users. In univariate analysis, the domain of academic failure was significantly as- sociated with a greater risk of smoking: the odds increased more than 6-fold with academic  failure (OR = 6.2, 95%  CI: 3.9–9.7). Antisocial  and addictive  behaviours (OR = 2.8, 95% CI: 2.3–3.5  and OR = 2.3, 95% CI: 1.9–2.8 respec- tively) and favourable attitudes toward alcohol  (OR = 3.7, 95% CI: 2.6–5.3)  were significantly associated with an increasing smoking risk (P < 0.01). We  also showed a significant correlation between smoking behaviour and poor  family management  (OR = 2.0,  1.4–2.9) and poor quality of  life  (OR  1.8, 95% CI: 1.2–2.7) (Table 3). How- ever, family permissiveness and anxious behaviour were not correlated with the smoking status of these adolescents (Table 3). In multivariate analysis, we included sex; age divided into classes and the other significant risk factors for smoking (as reported in Table 3). In the final model we showed that academic failure significantly increased the risk of smok- ing after adjustment for others factors (OR = 3.9, 95% CI: 2.4–6.3) (P < 0.01).  Antisocial behaviour (OR = 2.2, 95% CI:  1.2–4.7) and addictive behaviour (OR  = 1.7, 95% CI: 1.1–2.8) were also  still  significantly associated with smoking behaviour. This model retained female sex as a protective factor for smoking (OR = 0.3, 95% CI: 0.2–0.4), P < 0.01)  (Table 4). Table 1 Demographic characteristics of the school adolescents who were smokers in Monastir city Characteristic Total sample (n = 900) Smokers (n = 144) P-value No. % No. % Age (years) < 16 430 47.7 77 53.5 < 0.01 ≥ 16 470 52.3 67 46.5 Sex Male 400 44.5 121 84.0 < 0.01 Female 500 55.5 23 16.0 Mother’s education School graduate or less 489 54.3 69 48.0 NSCollege degree 343 38.1 58 40.0 Postgraduate education 68 7.6 17 12.0 Father’s education School graduate or less 289 32.1 42 29.0 NSCollege degree 416 46.2 69 48.0 Postgraduate education 195 21.7 33 23.0 Mother smokes Yes 234 26.0 46 32.0 NS No 666 74.0 98 68.0 Father smokes Yes 527 58.6 75 52.0 NS No 373 41.4 69 48.0 NS = not significant. Book 17-6.indb 525 6/6/2011 9:44:58 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 526 Discussion Our study aimed to estimate the preva- lence of tobacco use among adoles- cents in Monastir city and to assess its correlates. To achieve our objectives we conducted the study on a random sample of college and high-school ado- lescents using a questionnaire based on validated scores [11].  In order  to  limit  problems of inconclusive or missing answers we clearly explained the objec- tives of the study to the adolescents. Anonymity was also guaranteed to make students feel more comfortable about responding. However, our results cannot be applied to all young people of the same age. A new generation of adolescents continue to start using tobacco at younger ages and it is particularly im- portant to prevent tobacco use at this stage of life. Indeed, estimates of the prevalence of smoking among school adolescents range from 9% to 17.5% in  other developing countries  [12,13].  In  developed countries the rate of tobacco use among adolescents is showing a continual decrease [14]. This decrease  is related to effective interventions since  the 1980s  that  target adolescent  smoking prevention [15].  In develop- ing countries, including Arab countries, smoking among adolescents has begun to increase alarmingly [4,7]. In Tunisia the prevalence of young smokers  is  also  high:  18.1%  in  a  na- tional  study  in 2000  [16]. According  Table 2 Characteristics of the 144 school adolescents who were smokers in Monastir city by sex Characteristic Males (n = 121) Females (n = 23) P-value Mean (SD) age of smoker 15.2 (2.3) 16.7 (2.0) < 0.01 Mean (SD) age at first smoking experience 13.7 (2.3) 14.2 (2,2) < 0.01 Median no. of cigarettes smoked/day 6.5 7.2 NS SD = standard deviation; NS = not significant. Table 3 Risk factors for smoking among school adolescents of Monastir city: univariate logistic regression analysis Risk factor Smokers Non-smokers OR 95% CI P-value No. % No. % Academic failure < 0.01 No 80 55.5 566 74.9 1 – Yes 64 44.5 190 25.1 6.2 3.9–9.7 Antisocial behaviour < 0.01 No 96 66.6 556 73.6 1 – Yes 48 33.4 200 26.4 2.8 2.3–3.5 Family management 0.02 Good 56 38.9 501 66.3 1 – Poor 88 61.1 255 33.7 2.0 1.4–2.9 Family commitment 0.09 Yes 76 52.8 479 63.4 1 – No 68 47.2 277 36.6 1.2 0.9–1.7 Quality of life 0.03 Good 98 68.1 604 79.9 1 – Poor 46 31.9 152 20.1 1.8 1.2–2.7 Attitudes toward alcohol < 0.01 Unfavourable 84 58.4 533 70.5 1 – Favourable 60 41.6 223 29.5 3.7 2.6–5.3 Anxious behaviour 0.1 No 91 63.2 546 72.3 1 – Yes 53 36.8 210 27.7 1.0 0.8–2.3 Addictive behaviour < 0.01 No 46 31.9 660 87.3 1 – Yes 98 68.1 96 12.7 2.3 1.9–2.8 OR = odds ratio; CI = confidence interval. Book 17-6.indb 526 6/6/2011 9:44:59 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 527 to the Global Youth Tobacco Survey (GYTS) in the Eastern Mediterranean region, this prevalence was rising con- stantly between 2001 and 2007 [17]. In  our study of adolescents from Monastir city, we also found a high prevalence of  self-reported smoking (16.0%). The  rates recorded in our country require health care policies that encourage tar- geted tobacco prevention strategies. If effective actions are not implemented the consequences of the tobacco habit, especially  in youth, will be heavy [18].  We also need a description of the deter- minants of smoking cessation among this particular population of adolescents to improve the effectiveness of tobacco prevention programmes. According to the literature, tobacco consumption among females varies across different countries/cultures. Although there are societies without appreciable sex differences in tobacco use [19], many studies have found that  tobacco use is more common among males than females [20,21]. In our study  we also found a male predominance in tobacco consumption. This is mainly related to cultural and social taboos against women smoking in Tunisia. The mean age of first smoking ex- perience was  13.8  (SD 2.3)  years  in  our study. This is younger than in most studies of tobacco use among teenagers [22]. This finding confirms the need for  strategies to help young people to avoid starting smoking, for example through school-based programmes for smoking prevention [23]. The use of other tobacco products is frequent among cigarettes users, both male and  female  [24].  It has been  re- ported that over 60% of cigarette smok- ers use other tobacco products [25]. In  our study, 21.5% of the adolescents used  other tobacco products. Although this prevalence was lower than found in other studies, it is expected to increase rapidly. Indeed, in the GYTS, the use of other tobacco products besides cigarettes in Tunisian adolescents  rose  from 8% to  15% between 2001 and 2007 [17]. Compared with non-smokers, cur- rent smokers also show other addictive behaviours that have been attributed to a lower quality of life and greater life stresses  [26].  Affiliation  with  drug- using peers increases the risk of starting tobacco smoking and the use of illicit substances [27]. Our results are consist- ent with the literature that indicates that almost half of smokers begin their experience with peers who are smokers. These results highlight the key role of friends in smoking initiation and sug- gest a need for collective interventions among youth  [28]. These prevention  strategies should involve not only the students themselves but also the home, school and social environments [29]. Studies with youth groups have documented an association between academic difficulties and cigarette use. Several arguments have been advanced to explain this correlation; the most important suggests that smoking may be a means to compensate for stress due to lower academic achievement [27]. In  Table 4 Risk factors for smoking among school adolescents of Monastir city: multivariate logistic regression analysis Risk factor OR 95% CI P-value Sex 0.3 0.2–0.4 < 0.01 Academic failure 3.9 2.4–6.3 < 0.01 Antisocial behaviour 2.2 1.2–4.7 < 0.01 Addictive behaviour 1.7 1.1–2.8 0.03 Poor family management 1.6 1.0–2.7 0.04 OR = odds ratio; CI = confidence interval. fact, some studies from both developed and developing countries concluded that academic failure is a predictive factor for early tobacco, alcohol and marijuana use [6,30]. In our study, uni- variate and multivariate analyses were consistent with those of other studies. Many strategies can be used to pre- vent adolescents’ tobacco use, such as laws restricting sales of tobacco prod- ucts to minors. However, the evidence that such laws are effective in prevent- ing initiation of tobacco use by adoles- cents  is  limited [31]. Others  strategies  against adolescents’ tobacco smoking are more likely to be effective, such as school-based  programmes  [32]  and  media-based tobacco-counter market- ing  campaigns  [33]. We also  can use  new technologies (Internet/e-mail) that have proven effectiveness in includ- ing adolescents in anti-tobacco actions and prevention [34]. Youth who have  already started smoking also should be targeted and given specific counselling in order to help them to escape their addiction [33]. Conclusion In our study we showed that smoking rates among adolescents remains high in Tunisia and the age of initiation of smoking was under 14 years. These re- sults suggest that greater investment in preventive measures is needed to limit the human and economic impact of the smoking among young people. Acknowledgements Special thanks are due to Dr Zaafrane Ferid (Professor of Psychiatry) for his help in the monitoring of this study, the Ministry of Education for their agree- ment and help in the implementation of the study and the regional directors of study of schools and colleges for their help and their contribution in this study. Book 17-6.indb 527 6/6/2011 9:44:59 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 528 References Grimshaw GM, Stanton A. Tobacco cessation interventions for 1. young people. Cochrane Database of Systematic Reviews, 2006, (4):CD003289. DiNapoli PP. Early initiation of tobacco use in adolescent girls: 2. key sociostructural influences. Applied Nursing Research, 2009, 22:126–132. Nilsson M et al. Adolescent’s perceptions and expectations of 3. parental action on children’s smoking and snus use; national cross sectional data from three decades. BMC Public Health, 2009, 9:74. Nazary AA et al. Smoking among male medical sciences 4. students in Semnan, Islamic Republic of Iran. Eastern Mediter- ranean Health Journal, 2010, 16:156–161. Heydari G et al. Prevalence of smoking among high-school stu-5. dents of Tehran in 2003. Eastern Mediterranean Health Journal, 2007, 13:1017–1021. Abolfotouh MA et al. Health-related lifestyles and risk behav-6. iours among students living in Alexandria University Hostels. Eastern Mediterranean Health Journal, 2007, 13:376–391. Al-Mohamed HI, Amin TT. Pattern and prevalence of smoking 7. among students at King Faisal University, Al Hassa, Saudi Ara- bia. Eastern Mediterranean Health Journal, 2010, 16:56–64. Fakhfakh R et al. Tobacco use in Tunisia: behaviour and 8. awareness. Bulletin of the World Health Organization, 2002, 80:350–356. Fakhfakh R, Hsairi M, Achour N. Epidemiology and prevention 9. of tobacco use in Tunisia: a review. Preventive Medicine, 2005, 40:652–657. Demographic health survey in Tunisia 200410. . Tunis, National Family and Population Office, 2005. Melki W et al. [Validation of a school children addictive behav-11. iors questionnaire.] Validation d’un questionnaire d’addiction en milieu scolaire. La Tunisie Medicale, 2006, 84:603–606. Sreeramareddy CT et al. Prevalence and correlates of tobacco 12. use amongst junior collegiates in twin cities of western Nepal: a cross-sectional, questionnaire-based survey. BMC Public Health, 2008, 8:97. Mpabulungi L, Muula AS. Tobacco use among high shool 13. students in Kampala, Uganda: questionnaire study. Croatian Medical Journal, 2004, 45:80–83. Rasmussen M et al. Smoking trends in 11–15-year-olds from 14. 1988 to 2006. Ugeskrift for Laeger, 2008, 170:736–739. Murphy-Hoefer R et al. A review of interventions to reduce 15. tobacco use in colleges and universities. American Journal of Preventive Medicine, 2005, 28:188–200. Fakhfakh R et al. Trends in tobacco consumption in Tunisia. 16. Eastern Mediterranean Health Journal, 2000, 6:678–686. Warren CW et al. Global youth tobacco surveillance, 2000–17. 2007. Morbidity and Mortality Weekly Report, 2008, 57(SS01):1– 28. Fakhfakh R et al. [Epidemiology and prevention of smoking in 18. Tunisia: current situation and perspectives.] Epidemiologie et prevention du tabagisme en Tunisie: situation actuelle et per- spective. Archives de l’Institut Pasteur de Tunis, 2001, 78:59–67. Alexander J, Alexander P. Gender differences in tobacco use 19. and the commodification of tobacco in Central Borneo. Social Science & Medicine, 1994, 38:603–608. Edvardsson I, Lendahls L, Håkansson A. When do adolescents 20. become smokers? Annual seven-year population-based follow-up of tobacco habits among 2000 Swedish pupils—an open cohort study. Scandinavian Journal of Primary Health Care, 2009, 27:41–46. Rudatsikira E, Muula AS, Siziya S. Prevalence, correlates of and 21. perceptions toward cigarette smoking among adolescents in South Korea. Indian Journal of Pediatrics, 2009, 76:505–510. Rodrigues ES, Cheik NC, Mayer AF. Level of physical activity 22. and smoking in undergraduate students. Revista de Saude Pub- lica, 2008, 42:672–678. Thomas R, Perera R. School-based programmes for prevent-23. ing smoking. Cochrane Database of Systematic Reviews, 2006, 3:CD001293. Yang T et al. Smoking patterns and sociodemographic factors 24. associated with tobacco use among Chinese rural male resi- dents: a descriptive analysis. BMC Public Health, 2008, 8:248. Bombard JM et al. Monitoring polytobacco use among ado-25. lescents: do cigarette smokers use other forms of tobacco? Nicotine and Tobacco Research, 2008, 10:1581–1589. Okasaka Y et al. Correlation between addictive behaviors and 26. mental health in university students. Psychiatry and Clinical Neurosciences, 2008, 62:84–92. Corona R et al. Risk and protective factors for tobacco use 27. among 8th- and 10th-grade African American students in Vir- ginia. Preventing Chronic Disease, 2009, 6:A45. De Leeuw RN et al. Relative risks of exposure to different 28. smoking models on the development of nicotine dependence during adolescence: a five-wave longitudinal study. Journal of Adolescent Health, 2009, 45:171–178. Bawazeer AA, Hattab AS, Morales E. First cigarette smoking 29. experience among secondary-school students in Aden, Re- public of Yemen. Eastern Mediterranean Health Journal, 1999, 5:440–449. Bergen HA et al. Perceived academic performance and alco-30. hol, tobacco and marijuana use: longitudinal relationships in young community adolescents. Addictive Behaviors, 2005, 30:1563–1573. Stead LF, Lancaster T. Mass media interventions for preventing 31. smoking in young people. Cochrane Database of Systematic Reviews, 2000, (2):CD001006. Abolfotouh MA et al. Smoking intervention programme for 32. male secondary-school students in south-western Saudi Ara- bia. Eastern Mediterranean Health Journal, 1997, 3:90–100. Glynn T et al. The globalization of tobacco use: 21 challenges 33. for the 21st century. CA: a Cancer Journal for Clinicians, 2010, 60:50–61. Norman CD et al. Using the internet to assist smoking preven-34. tion and cessation in schools: a randomized, controlled trial. Health Psychology, 2008, 27:799–810. Book 17-6.indb 528 6/6/2011 9:44:59 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 529 Sociocultural contexts of attempting suicide among Iranian youth: a qualitative study M. Keyvanara1 and A. Haghshenas1 ABSTRACT This paper seeks to illuminate the sociocultural contexts of attempting suicide among Iranian youth. A qualitative approach was employed to uncover the social and cultural dimensions of attempting suicide. In-depth interviews were conducted with 25 participants aged 14–17 years who attempted suicide and were admitted to 2 of the hospitals in Isfahan. A thematic analysis approach was employed. The main themes identified were failure in love, family problems, study, pressure of high expectations and poverty. The findings suggest significant sociocultural influence on attempting suicide in the Islamic Republic of Iran. Exploring sociocultural aspects of suicide is critical in providing effective and culturally-sensitive suicide prevention and care programmes. 1Faculty of Health Management and Medical Informatics, Social Sciences and Health Research Centre, Isfahan University of Medical Sciences, Isfahan, Islamic Republic of Iran (Correspondence to M. Keyvanara: Keyvanara@mng.mui.ac.ir). Received: 20/08/09; accepted: 21/12/09 ةيفيك ةسارد :ينِّيناريلإا بابشلا ينب راحتنلاا تلاواحلم ةيفاقثلاو ةيعماتجلاا تاقايسلا سانش قح سابع ،ارآ ناويك دوممح ةبراقم اهيف تَمِدْخُتسا دقو .ينِّيناريلإا بابشلا ينب راحتنلاا تلاواحلم ةيفاقثلاو ةيعماتجلاا تاقايسلا حيضوت لىإ ةساردلا هذه ىعست :ةصلالخا مهرماعأ تحواَرَت ةساردلا في ًاكراشم نيشرعو ةسخم عم ةقمعتم تلاباقم تيرجُأو .راحتنلاا تلاواحلم ةيفاقثلاو ةيعماتجلاا داعبلأا فشكل ةيفيك نأ ينبتو .تاعوضوملل ةيليلتح ةبراقم ةساردلا في تمدختسا دقو .ناهفصأ ةنيدم في ينيفشتسم في اولخدأو راحتنلاا اولواح نَّمم ،ةنس 17و 14 ينب تاعقوتلا نع ةجمانلا طوغضلاو ،ةيساردلا لكاشلماو ،ةيلئاعلا لكاشلما فيو ،ةلشافلا بلحا صصق في تلثتم اهديدتح نكمأ يتلا ةيسيئرلا عيضاولما فاشكتسا برتعيو .ةيملاسلإا ناريإ ةيروهجم في راحتنلاا تلاوامح في ًايئاصحإ هب ُّردتعُي فياقثلاو يعماتجلاا يرثأتلا نأ لىع جئاتنلا لدتو .رقفلاو ،ةيلاعلا .ةيفاقثلا تايساسحلل ةيعارُم ةلاّعف ةّيئاعرو ةّيئاقو جمارب دادعلإ ًماهم ًارمأ راحتنلال ةيفاقثلاو ةيعماتجلاا بناولجا Contextes socioculturels des tentatives de suicide chez les jeunes Iraniens : une étude qualitative RÉSUMÉ Le présent article met en lumière les contextes socioculturels des tentatives de suicide chez les jeunes Iraniens. Une méthode qualitative a été utilisée pour déterminer les dimensions sociales et culturelles des tentatives de suicide. Des entretiens approfondis ont été réalisés avec 25 participants âgés de 14 à 17 ans et admis dans deux hôpitaux d’Ispahan après une tentative de suicide. L’analyse a été réalisée selon une approche thématique. Les principaux thèmes identifiés étaient une rupture sentimentale, les problèmes familiaux, l’échec scolaire, des attentes élevées générant une pression et la pauvreté. Les résultats laissent entrevoir le poids d’une influence socioculturelle importante sur les tentatives de suicide en République islamique d’Iran. L’étude des aspects socioculturels du suicide est essentielle afin d’offrir des programmes de prévention du suicide et de soins efficaces et adaptés aux sensibilités culturelles. Book 17-6.indb 529 6/6/2011 9:44:59 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 530 Introduction Suicide and attempted suicide are com- plex behaviours with multiple risk factors involved. It has been argued that suicidal behaviour falls along a continuum rang- ing from thoughts of suicide to suicide behaviour (e.g. planning, method iden- tification) to suicide attempts, and in some cases to suicide [1]. Suicide attempt severely impacts on individuals and society in terms of physical and mental health, long-term disability and death as well as quality of life [2,3].  The rate of suicide among youth has been increasing. This escalation in suicide rates among young individuals in developed countries began around 1980  and  has  continued  to  rise  [3];  they are currently the high risk group in one third of all developed and develop- ing countries [4]. Similar studies in the  Islamic Republic of Iran as well as in some other Islamic countries have also highlighted the particular risk related to attempting suicide [5].  It has been shown that attempting suicide is prevalent in the age group 15–24  years  in  the  Islamic Republic  of  Iran,  especially  among women [6].  The main methods used are reported to be overdosing and self-burning (self- immolation) [7,8].  In 1999 and 2000,  895 cases of deliberate overdose and 97 cases of self-immolation were admitted to hospital in Isfahan, the second largest city in the country, most of these aged 10–29 years [9].  It is argued that suicide may be seen as an internal psychological phenom- enon,  as  a  social  phenomenon  [10]  and as a phenomenon related to other psychiatric disorders and genetic prob- lems [11]. It results from factors related  to biological, psychological and social contexts. Suicide has different meaning in different cultures and settings. Social and cultural factors such as marital sta- tus,  isolation,  religion [10], age, unem- ployment [12,13] social class [14], race  and how suicide and its consequences are viewed, valued and interpreted by various cultures are all of consequence. For example, a great number of suicides in the Islamic Republic of Iran are not reported since it is considered a great sin in Islam, the majority religion [15]. Since suicide is defined by many fac- tors and a deep understanding of these is necessary for suggesting avenues for prevention and rehabilitation of those attempting suicide. Therefore, a qualita- tive approach was selected for this study to provide a deep and broad under- standing of this complex, multifaceted phenomenon. Qualitative methods can explore the meanings of suicide [16,17]  and the intentions of actors[18] within  the sociocultural contexts of suicide. Since suicide among youth poses a ma- jor challenge for health care currently in our country, this study focuses on the sociocultural context of suicide among youth. Methods We employed in-depth interview tech- niques with young people aged 14–17  years who attempted suicide in order to obtain descriptions and meanings of the interviewee’s life events. An unstruc- tured interview approach was employed to let participants to raise their own views and perceptions, to uncover un- derlying problems, issues and meanings as well as offering an apparently “deeper”  picture than the variable-based correla- tions of quantitative  studies  [19]. The  interview guide included demographic questions such as sex, age, marital status, geographic location, medical history, experiences and problems. Study participants were recruited from patients who attempted suicide ei- ther through poisoning or self-burning, and who had been admitted to the toxi- cology ward or burn hospitals in Isfahan. Participants were enrolled through a purposive sampling strategy [20] to en- sure a variety of views and perspectives. The research team identified individuals aged  14–17  years  who  had  recently  attempted suicide and invited them to participate. Volunteers were selected who declared themselves willing and who were capable of talking about their experiences. The participants’ medical reports were checked to ensure they were not suffering from acute psychosis, intense depression or bipolar disorder. Patients who had anti-social behav- iour and those who were not able to complete the interview process were excluded. A total of 17 self-poisoned and 8 self- burned patients were interviewed. The interview process was carried out from March 2006 to October 2007. Data col- lection continued until saturation was achieved, i.e. until no new conceptual patterns were emerging [21]. Consent  was obtained from all participants. The anonymity of the participants was pre- served. The interview time ranged from 15 to 50 minutes. All interviews were tape- recorded and were transcribed verbatim by researchers. Data were stored in a secure cabinet and password protected computer file. Thematic analysis was used to make sense of qualitative data. During analysis, transcriptions were read iteratively and frequently in order to get familiar with the text and develop the “theme” out of the text [22].  Results All interviewees were single; 16 were female and 9 were male. The common- est methods used to attempt suicide include overdose, by 15 interviewees; self-burning by 8 interviewees and poi- son by 2 interviewees.  Following analysis, data were cat- egorized into 5 themes: expression of despair, failure in love, family problems, pressure of high expectations, and pov- erty. These themes are explained and explored in detail. Book 17-6.indb 530 6/6/2011 9:45:00 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 531 Expression of despair in participants Participants expressed feelings of de- pression and despair in various ways. Many expressed feeling of worthless- ness, loneliness, sorrow and sadness as well as sleep disturbances. A common complaint was Nara- hati: not being comfortable; upset or in distress. This term encompasses a wide rage of psycho-emotional states such as being anxious, depressed or upset. Other common terms used by participants to express their emotional status were Assabani, Assabi, Feshar-e assabi and Assabe-e khord. These terms originate from the word A’sab (literary meaning nerve) and explains an uncon- trollable anger, being irritable, agitated, high temper, nervous, psychic pressure, and loss of self-control in social interac- tions. A 16-year-old girl for instance says: I was so Assabani [angry] that I took all tablets (Interviewee 11). Another participant also lost control during an impulse: I am very regretful now and I was very Assabani, and I cannot understand what I did. They created a sense of Assab-e khord for me (Interviewee 5). Also the youths expressed feelings of Na’omidi [hopelessness and futility; loss of hope]. For example one girl strongly  expressed Na’omidi  as  her  “life  is  fin- ished” and she had “lost her future”. I felt I have lost my dreams. Everything became dark and my future was also dark. ….It seemed I had lost my future and my life. I felt everything in my life is finished. There were no desires for me. I couldn’t believe that my life was going to be damaged. It seemed my life was burned and passed off. I couldn’t sleep last night and… (Interviewee 5). Some participants explained their emotions as being Zood-ranj  [irritable]  or Hassas  [sensitive]  in  reaction  to  certain circumstances: I am Assabani, Zood-ranj and Hassas person. My mother behaves in a bad way with me all the time and everywhere. Whenever she does this I become really Narahat [sad], Assabani [nervous] and have a feeling of annoyance (Interviewee 6). It was clear that such psycho-emo- tional problems were shared by many participants, which could have played an important role in attempting suicide. The causes of these problems were ex- plored and explained. Failure in love Some participants expressed difficul- ties in love as their main reason for attempting  suicide.  Two  girls  and  2  boys reported overdosing to attempt suicide due to failure in love. One girl, for example, says: I have fallen in love with a 19-year-old boy. I love him extremely. Yesterday he told me he is going overseas, it was so hard, it was really Narahati [sad], I don’t know what I can do…. My mother and my sister knew about my love but my father didn’t (interviewee 5). The other young girl resonates simi- lar issues: I fell in love with a 19-year-old boy; we found each other in a party… I love him but we had to cover our love because of our families … My father did not know about him (my love) but my mother was suspicious about our relationship (Inter- viewee 11). In addition to interpersonal reasons, social stigma regarding outside mar- riage relationships appeared as one of the main causes of troubles in love. Both girls were trying to keep their relation- ship with their boyfriends secret be- cause of strong family opposition. The shame of exposing the relationship was so unbearable for one of the girls that it lead her to attempting suicide. The young participants not only had many obstacles with love and relation- ship outside marriage but also expressed frustration in search for love within so- cially acceptable norms. Issues such as parental consent, jobs, money, educa- tion and social class differences and “traditional customs” of marriage played  important roles in marriage. A 17-year- old boy, for instance, a hairdresser, fell in love with a girl and decided to marry her. He faced strong opposition, however, from the girl’s father, who was quite inflexible  in  settling  the  “marriage por- tion” or Mahr [the part of the marriage portion settled upon the wife, which is paid  in cash]. Having a high marriage  portion for girls is considered to be so- cially prestigious: When my family and I went to their house to propose marriage and, during the procedure of wedlock, my father fell in discussion and then quarrelled with my beloved’s uncle on the marriage portion. Finally we had to leave their home. I became so Narahati [sad] for a few months. Last week, again we went to their house. This time they started quarrelling and did not agree to our marriage (Interviewee 23). Family issues Family issues emerged one of the main themes related to attempting suicide in the youths. This included the subthemes of family disorder, child–parent friction  and sibling friction. Family disorder This refers to family problems such as single parents, divorce, drug abuse, parental conflict and having a step- mother or stepfather. Four participants expressed concerns regarding family conflicts. For example, in a lengthy ac- count, a young girl showed how her parents’ divorce and disagreements led her to leave school, depression and finally attempting suicide. The divorce, her depressive disorder, and her suicide attempts seemed to be interrelated, so she resorted to marriage as a way out of a “bad situation”: I had to go to my father’s home for a few weeks and then go back to my mother’s again; it was horrible and intolerable (Interviewee 20). She thought marriage could bring her an independent life but her mother, who had responsibility for her at the time, believed she ….was too young for marriage, ….but for me marriage was an opportunity to get out of a bad situation (In- terviewee 20). However, from this girl’s point of view, her mother’s opposition to her marriage was mainly a reflection Book 17-6.indb 531 6/6/2011 9:45:00 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 532 of her own marriage experiences. Her fa- ther also opposed her marriage—for no reason. Opposition of both parents to her marriage as the only way of getting out of such a miserable situation left her with no choice except for attempting suicide: I preferred to live with my mother permanently. But my identity card was left in my father’s home as I forgot to bring it with me. Several times I asked my father to give it back but he refused to return it. I needed it because I was going to get married and I needed it for recording the official recognition of marriage. I complained to my uncle about my father. I told him that my father did not support us financially, so he should not bother us and should leave us alone (Interviewee 20). Similar issues were raised by 2 young  girls providing a partial explanation for their suicide attempts. One of them says: Last night my parents fell into a quar- rel again. I have a widowed sister, she doesn’t live with us … she is living with my uncle’s family… (Interviewee 11). Child–parent conflicts Another subtheme identified as be- ing potentially responsible for youth attempting suicide was conflict with their parents. Youth willingness to an independent life and parents efforts to control and impose limitations appeared as one of the reasons for child-parent conflict. This has led some youth to- wards depression and suicide attempts, as in this girl’s excerpt: My mother usually follows me when I go out of my home. She checks the time of my coming and going out. I can’t do any make-up and dressing. I need a bit of freedom. My mother is worried about my relationship with my love (interviewee 11). She saw her mother as the main obstacle in her relationship with her love. She had frequent arguments and quarrels with her mother. Parental control and limitations also extended to boys for issues such as edu- cation, future life plan and also avoiding trouble. A 16-year-old boy believed his mother did not respect his autonomy; this resulted in friction between them and he overdosed on tablets. He says: My mother usually interferes in the details of my duties (my daily life). She has the last say about my friends, my fun and everything else (Interviewee 13). His mother’s control went as far as even burning his leg to stop him smoking cigarettes. Similarly another young boy, 17 years old, experienced difficult relation- ships with his father which finally led to him attempting suicide. These kinds of quarrel occurred from about a few months ago. I worked with him but it was very strict. Now I can’t carry on and I am very tired (psychologically). My father usually let me use his car but for a few days he prevented me using it (Interviewee 7). Sibling conflicts One of the main subthemes emerged was sibling friction. Various reasons caused arguments and conflicts be- tween siblings presented as gender roles, discrimination among siblings and bullying. As pointed out by a young girl, her father and brother opposed her educa- tion, believing that her family and social role does not require such education. Their hostility towards her led her to set herself on fire. They told me that my education was not useful because in the end I had to get married, and that my future job was not more than a housewife. During my examinations when I had to concentrate on my lessons, they disturbed me intentionally (Interviewee 8). Feeling discriminated against by siblings appeared to cause conflicts; this was highlighted by 2 young girls as the  reason for frustration and attempting suicide. When I told my mum about our quarrel, she always said because I was the older one, I shouldn’t have quarrelled with him. That’s the reason why my brother is quarrelling with me. He often thinks he is not doing wrong (Interviewee 1). If I find any problem and argue with my younger brother, my parents take his side ... I intend to kill myself because this situation is really intolerable for me (Interviewee 8). Discrimination between girls and boys still seems to be a significant prob- lem within traditional Iranian families. A 15-year-old boy was bullied and physically abused by his older brother. He felt unprotected and extremely un- comfortable at home. He finally resorted to setting himself on fire to escape from his horrible situation: I have problems with my elder brother. He usually falls in quarrel with me and beats me extremely. I cannot do anything against him … He thinks I am a servant for him (Interviewee 10). Pressure of high expectations Another major theme identified from data was pressure of high expectations from family and peer groups. Family pressures The data showed that some participants had felt extreme pressure from the family to achieve high standing in their educa- tion. Studying in high quality schools is considered socially prestigious for both students and their parents. One young girl attempted suicide by overdose as a result of pressures from her mother to do better at school. She complained about her mother: My mum insisted that I register in a high quality school. I registered but I was unable to pass 3 subjects (Interviewee 3). She  failed 2 consecu- tive years in that school and was finally forced to register in an evening school. She states: I tried to register with another [day] school but they did not accept me because of my [low] scores. Finally I had to attend evening classes. She felt very embar- rassed and pressured from her mother who compared her poor performance with her high-achieving nieces. My cousins pay attention [work hard] in their lessons and studies. Once when they were in our house, my mum told them about my friends. She said that they sometime invited me to their homes for studying but that they don’t study. I didn’t like my mother speaking against me while my cousins were in our house. It was shameful and embarrassing for me (Interviewee 3). A similar issue was raised by a young boy, 15 years old, who was living with Book 17-6.indb 532 6/6/2011 9:45:00 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 533 his family in an outlying village in the south-western region of the country. His father was a builder. He had 4 broth- ers and sisters and was the third child of his family. One of his elder brothers was a soldier and the other one was unemployed. Owing to his family’s low economic situation, his father expected him to do well in his studies so he could help the family in the future. He set himself on fire since he could not bear the pressure of not meeting his family’s expectations: I had to pass all my exams and I had to revise the lessons for which I did not get the average mark. I am scared of my family, especially of my dad. My fam- ily expected me to be better in my studies (Interviewee 2). Peer pressure Pressure from peer groups was also highlighted by participants. The pres- sure and grief felt by one girl from her classmates as a result of her poor school performance led her to attempt suicide. I am so weak in education. I usually have Gham o Ghoseh (grief) with my studies and my low position at school. My classmates underestimate me for this reason (I mean weak in education). I have a very hard time at school (Interviewee 18). Poverty Although economic hardships and un- employment were implicit in accounts made by many participants, this was ex- plicitly highlighted by a young girl who also lost her mother 2 years previously.  She believed that by killing herself she would ease the financial burden on fam- ily. She attempted suicide by overdosing on tablets; she says: I am living with my family. My family is big. We are 7 sisters and brothers. My father does not have a skilled job. He is a manual worker and his wage is too low. His income is so low that he can not support us….. Last night, when I real- ized my father had no money to buy food I became so Narahat [sad]. We slept while all of my sisters and my brothers were hungry. I thought the best way to reduce some of the family expenses would be the removal of family members. Therefore, I thought by taking my own life my family’s difficulties would be eased (Interviewee 21). Discussion Our findings showed that many par- ticipants were on the verge of a psycho- emotional breakdown. They commonly used culturally-bound terms to explain and express their psycho-emotional conditions. Words such as Narahati [not being comfortable, being upset or  in distress], Assabani, Assabi, Feshar- eassabi, Assabe-e Khord [nervous, uncon- trollable anger, being irritable, agitated, high temper, psychic pressure, and loss of self-control], Na’omidi [hopelessness, futility,  loss of hope], Zood-ranj [irrita- ble or  sensitive] were  shared by many  participants to position themselves in a culturally defined emotional mood. Good et al. also highlight the cultural influence on understanding and pres- entation of psychological disorder in the Islamic Republic of Iran [23].  In line with what has already been published, it could be argued that many participants resorted to attempting suicide as a cry  for help [18], as an ap- peal [17] or to communicate with their  parents, relatives and significant oth- ers  [24,25]  in order  to deal with  their  psycho-emotional despair. Youths tried to reduce social and family pressures, and overcome opposition to their will. Although participants shared a common psycho-emotional despair, a variety of social, personal and family conflicts drove them towards this state. Our findings confirm previous studies in the Islamic Republic of Iran and else- where that family problems and failure in love are the most common reasons for attempting suicide [26,27]. The findings  also agree with studies indicating that financial problems, unemployment and poverty contribute in attempted suicide in southern [28,29] and western regions  of  the country  [30]. Similar  studies  in  Muslim countries highlighted family problems, interpersonal relationships (mainly with the opposite sex), unem- ployment and school performance as causes of attempted suicide [31,32].  Shame (Sharmmandegy or Khejalat) stems from the subject’s feeling of general  failure [17].  In agreement with  the mainstream literature [32], we also  found that social stigma and shame play an important role in attempted suicide among youth. Relationships between the opposite sexes outside marriage do exist in the Islamic Republic of Iran, but are considered an area of shame and stigma for the individual as well as the family. Our participants had fears regarding the social and family consequences of their love affairs being exposed. This stigma and shame also extended to other socially unacceptable behaviours such as teenage smoking. Previous studies suggest that the family is an influencing factor in at- tempting  suicide  [33–35].  Despite  dramatic sociocultural changes which have occurred in the Islamic Republic of Iran, the family institution still plays as important role in society. Strong family ties provide a great deal of support for family members in times of hardship. On the other, hand such close ties can potentially cause conflicts and prob- lems between family members. Our findings showed that, although youth were enjoying family support, there were concerns about losing autonomy and self-determination. Family and so- cial traditions and values sometimes impeded their choice in marriage. These traditions impose rules on issues such as marriage portion, social class and wealth of the partners, and marriage ceremo- nies, which could result in extreme dif- ficulties and psychological pressures on youth, leading them to attempt suicide. Another issue is that, owing to the high level of family support, children normally live with their parents until get- ting married. This increases the chance of conflicts and rivalry developing be- tween siblings. Book 17-6.indb 533 6/6/2011 9:45:00 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 534 Nowadays in the Islamic Republic of Iran, education is considered one the main factors in defining social class and prestige as well as conferring the pros- pect of achieving high social standing and status for both students and their parents. Many families put pressure on youth to do better in their education or pursue the dreams of their parents despite their own wishes. This pressure also comes from peers, the educational institutions and broader society. These extreme pressures could potentially cause youth to lose their self-esteem and result in suicide in order to escape from such pressure. In agreement with international studies  [36–38], our findings  showed  that poverty also contributes to suicide attempts among participants. Economic hardships and high unem- ployment in the Islamic Republic of Iran could cause effects within the fam- ily institution such as parental or sibling conflict as well as psycho-emotional distress in youth. The findings of this study are in agreement with the mainstream literature on youth suicide in terms of the role of family problems, love, fam- ily and social pressures and poverty in attempting suicide. However, the con- tributing factors might have played out differently in our country compared to some other societies. The authors believe that the issue of social stigma, especially topics related to gender re- lationships and marriage, might be dif- ferent  from similar  issues  in  “western”  societies. The findings of this study expand the conceptual and theoretical literature on suicide, particularly among youth. They could be used by policy makers and health care providers in design- ing and implementing effective suicide prevention programmes as well as pro- viding better care for young people who attempt suicide. Health and medical education will benefit from the find- ings of this research through provid- ing context-related material in training health professionals. There were a few limitations to our study. Owing to the stigma related to issues such as suicide, it is possible that participants have not exposed the full reasons behind their suicide attempt. However efforts were made to over- come this limitation through establish- ing trust and rapport during interviews. The qualitative nature of the study limits its generalizability to the broader population. However, efforts made to enhance the representation of different voices and concerns of different partici- pants in order to increase the credibility of data. Translation of data from Farsi to English might have contributed to partial distortion or loss of meanings of participant accounts. This limitation was minimized through translation and back translation of transcripts by the research team. Conclusion We investigated a range of different but interconnected contexts of suicide in Iranian youths. Understanding the sociocultural aspects of suicide is critical in providing effective and culturally- sensitive suicide prevention and care programs. The family was considered the most important institution in young peoples’ lives. This is where they are supported when facing social, cultural, and economic problems, and hence where a whole range of personal, social, cultural and economic problems could come together. In addition, there are other problems that especially affect young individuals: these are associated with social changes and the conflicts between traditional and modern atti- tudes such as pressure to succeed in education, desire for independent life and freedom in romantic affairs. Suicide prevention and care provision should devise a holistic approach taking into ac- count medical as well as social, cultural and family factors in their assessment and care provision. Acknowledgements We would like to extend our gratitude to all the interviewees who kindly agreed to share their experiences, feel- ings, attitudes and information with us. This project was funded by the Social Sciences and Health Research Cen- tre (SSHRC) affiliated to the Faculty of Health Management and Medical Informatics, Isfahan University of Medi- cal Sciences. We also wish to thank Dr William Watts Miller for his support, guidance, comments and encourage- ment throughout this work. References De Wilde EJ. Adolescent suicidal behaviour: a general popula-1. tion perspective. In: Hawton K et al., eds. Suicide and attempted suicide. London, Wiley, 2000:249–259. Coggan CA et al. 2. Directory of Service for Youth Suicide. Auck- land, Injury Prevention Research Centre, 1995. Kachur SP et al. Suicide: epidemiology, prevention, treatment. 3. In: Runyan C et al., eds. Adolescent medicine: state of the art reviews. Philadelphia, Hanley and Belfus, 1995. Suicide prevention4. (SUPRE). Geneva, World Health Organiza- tion, 2006 (http://www.who.int/mental_health/prevention/ suicide/, accessed 20 April 2011). Khan MM et al. Suicide in the developing world: case study 5. from Pakistan. Suicide and Life-Threatening Behaviour, 2006, 36(1):76–81. Ghoreishi SA et al. Systematic review of researches on suicide 6. and suicide attempt in Iran. Iranian Journal of Psychiatry and Clinical psychology, 2008, 14:115–121. Book 17-6.indb 534 6/6/2011 9:45:01 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 535 Abdollahi M et al. A retrospective study of poisoning in Tehran. 7. Journal of Toxicology – Clinical Toxicology, 1997, l 35:387–339. Ghazi-Khansari M et al. A prospective study of fatal outcomes 8. of poisoning in Tehran. Veterinary and Human Toxicology,1995, 37(5):449–455. Ghadierifaraz B. [Estimate of the frequency of suicidal attempts 9. by burning in the women patients in the hospital during the period 1999 and comparison with some of the individual characteristics in Department of Medicine] [MD dissertation]. Isfahan, Isfahan University of Medical Sciences, 2000 [in Farsi; English abstract]. Durkheim E. 10. Suicide: a study in sociology. London, Routledge, 1952. Erkki T et al. Suicide in major depression. 11. American Journal of Psychiatry, 1994, 151:530–536. Pritchard C. Is there a link between suicide in young men and 12. unemployment? A comparison of the UK with other Euro- pean Community countries. British Journal of Psychiatry, 1992, 160:50–56. Platt S. Unemployment and suicidal behaviour: a review of the 13. literature. Social Science & Medicine, 1994, 19:93–115. Taylor R et al. Suicide in Urban New South Wales, Australia 14. 1985–1994: socio-economic and migrant Interactions. Social Science & Medicine, 1998, 47:1677–1686. Lester D. Suicide and Islam. 15. Achieves of Suicide Research, 2006, 10(1):77–97. Douglas J. 16. The social meaning of suicide, Princeton, New Jersey, Princeton University Press, 1967. Baechler J. 17. Suicide. Oxford, Basil Blackwell, 1979. Taylor S. 18. Durkheim and the study of suicide, London, Macmillian Press, 1982. Silverman D. 19. Interpreting qualitative data: methods for analysing talk, text and interaction, 2nd ed. London, Sage, 2004. Green J et al. 20. Qualitative methods for health research. London, Sage, 2004. Rubin H et al. 21. Qualitative interviewing: the art of hearing data, 2nd ed. London, Sage, 2005. Sandelowski M. Qualitative analysis: what it is and how to be-22. gin. Research in Nursing and Health, 1995, 18(4):371–375. Good B et al. The interpretation of Iranian illness and dysphoric 23. affect. In: Kleinman A et al., eds. Culture and depression: studies in the anthropology and cross-cultural psychiatry of affect and disorder. Berkeley, Los Angeles, University of California Press, 1985:369–428. Stengel E. 24. Suicide and attempted suicide. Harmondsworth, Pen- guin, 1973. Hods M. Overdosing as communication: a cultural perspec-25. tive. British Journal of Medical Psychology, 1990, 63:319–333. Mohammadi MR et al. Suicidal attempt and psychiatric dis-26. orders in Iran. Suicide and Life-Threatening Behaviour, 2005, 35(3):390. Headley LA. 27. Suicide in Asia and the Near East. California, Univer- sity of California Press, 1983, 238–257. Janghorbani M et al. Completed and attempted suicide in Ilam, 28. Iran (1995–2002): increase and associated factors. Archives of Iranian Medicine, 2005, 8(2):199–129. Toobaei SH et al. Suicidal causes among 15 to 30 year olds in 29. Shiraz, Southern Iran. Iranian Journal of Medical Sciences, 1999, 24(1&2):14–19. Mofidi N et al. Attitudes towards suicide among Kurdish peo-30. ple in Iran. Social Psychiatry and Psychiatric Epidemiology, 2008, 43:291–298. Al Ansari A et al. Risk factors associated with overdose among 31. Bahraini youth. Suicide and Life-Threatening Behaviour, 2001, 31(2):197. Dabbagh TN. 32. Parasuicide in Arab Palestinian society of the West Bank [Doctoral thesis]. London, Department of Psychiatry, University College, 2000. Adams DA et al. Perceived family functioning and adolescent 33. suicidal behavior. Journal of the American Academy of Child and Adolescent Psychiatry, 1994, 33:498–507. Besnard P. Marriage and suicide: testing the Durkheimian 34. theory of martial regulation a century later. In:. Pickering W et al., eds. Durkheim’s suicide: a century of research and debate. London, Routledge, 2000. McDermut W et al. Family functioning and suicidality in de-35. pressed adults. Comprehensive Psychiatry, 2001, 42(2):96–104. Crawford MJ et al. Increasing rates of suicide in young men in 36. England during the 1980s: the importance of social context. Social Sciences & Medicine, 1999, 49:1419–1423. Platt S. Parasuicide and unemployment. 37. British Journal of Psy- chiatry, 1986, 149:401–405. Platt S et al. Suicide behaviour and the laubour market. In: 38. Hawton K et al., eds. The international handbook of suicide and suicide behaviour. New York, Wiley, 2000:310–384. Book 17-6.indb 535 6/6/2011 9:45:01 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 536 Public attitude towards biomedical research at outpatient clinics of King Abdulaziz medical city, Riyadh, Saudi Arabia M. Al-Jumah,1 M.A. Abolfotouh,1 I.B. Alabdulkareem,1 H.H. Balkhy,1 M.I. Al-Jeraisy,1 A.F. Al-Swaid,1 E.M. Al-Musaaed 1 and B. Al-Knawy 1 ABSTRACT The aim of this study was to determine the attitude of Saudi Arabians to research involving storage and use of human tissues from which genetic information may be derived and to assess their willingness to donate tissue samples to biobanks. In a cross-sectional interview study of 1051 outpatients at a hospital in Riyadh city, 68.8% had a positive attitude towards biomedical research and 78.4% were willing to allow use of excess surgical tissues for research purposes. Participants were less willing to allow the use of tissue or organs from a deceased relative. Logistic regression analysis found that predictors for a positive attitude to biomedical research and to use of tissue in research were: female sex, higher level of education, previous experience of blood testing and previous participation in health-related research. The attitudes towards biomedical research among the participants were satisfactory and comparable to findings from other countries. 1King Abdullah International Medical Research Centre, King Saud Bin-Abdulaziz University for Health Sciences, National Guard Health Affairs, Saudi Arabia (Correspondence to M.A. Abolfotouh: mabolfotouh@gmail.com). Received: 26/8/09; accepted: 25/11/09 ةيبرعلا ةكلملماب ،ضايرلا في ةيبطلا زيزعلا دبع كللما ةنيدم في ةيجرالخا تادايعلا في ةارجلما ةيبطلا ثوحبلا هاتج روهملجا فقوم ةيدوعسلا دممح نمايإ ،ديوسلا زياف نحمرلا دبع ،سييرلجا ميهاربإ دجام ،يخلب نسح نانح ،ميركلا دبعلا ميهاربإ ،حوتفلا وبأ ىفطصم ،ةعملجا ليع دممح يوانقلا ردنب ،دعاسلما َّدَمَتسُت نأ نكمي يتلا ةيشربلا ةجسنلأا مادختساو ظفح لىع موقت يتلا ثوحبلا نم ينيدوعسلا فقوم ديدتح لىإ ةساردلا هذه فدته :ةصلالخا ًاضيرم 1051 َةلباقم تنمضت ةضرعتسم ةسارد فيو .ةيجولويبلا كونبلا لىإ ةجسنلأا نم تانيعب عبرتلا في مهتبغر مييقت لىإو ،ةينيج تامولعم اهنم حماسلا لىع نوقفاوي %78.4 نأو ،ةيجولويبلا ةيبطلا ثوحبلا هاتج ًايبايجإ ًافقوم مهنم %68.6 ىدل نأ ينبت ،ضايرلا ةنيدم تايفشتسم دحأ في ًايجراخ .ينفوتلما مبهراقأ نم ءاضعلأا وأ ةجسنلأا مادختساب حماسلا لىع ًةقفاوم لقأ اوناك منهأ ولو ،ثوحبلا ضارغلأ ةدئازلا ةيحارلجا ةجسنلأا مادختساب لّثمتت ثوحبلا في ةجسنلأا مادختساو ةيجولويبلا ةيبطلا ثوحبلا هاتج بيايجلإا فقولماب ةئبنلما لماوعلا نأ يتسجوللا فّوحتلا ليلتح مادختساب َّينبتو تناكو .ةيحص ثوحب في ةكراشلما قباوس فيو ،مدلا صوحفب قلعتي ام في ةقباسلا تابرلخا فيو ،ميلعتلا نم لىعلأا تايوتسلما فيو ثنؤلما سنلجا :في .ىرخلأا نادلبلا في جئاتنلا نم اتهلايثمب ةنراقملل ةلحاصو ًةلوبقم ماع هجوب ينكراشلما ينب ةيجولويبلا ةيبطلا ثوحبلا هاتج فقاولما Attitude d’une population de patients dans un centre de consultations externes de King Abdulaziz medical city, à Riyad (Arabie saoudite) au sujet de la recherche biomédicale RÉSUMÉ L’objectif de la présente étude était d’identifier l’attitude de Saoudiens au sujet de la recherche impliquant la conservation et l’utilisation de tissus humains à partir desquels des informations génétiques pourraient être extraites, et d’évaluer leur disposition à faire don d’échantillons de tissus à des biobanques. Une étude transversale comportant des entretiens a montré que 68,8 % des 1051 patients interrogés en consultation externe dans un hôpital de Riyad montraient une attitude positive au sujet de la recherche biomédicale. D’autre part, 78,4 % d’entre eux étaient disposés à autoriser l’utilisation des déchets chirurgicaux à des fins de recherche. Les participants étaient moins enclins à autoriser l’utilisation de tissus ou d’organes provenant d’un membre décédé de leur famille. L’analyse de régression logistique a indiqué que les facteurs prédictifs d’une attitude positive au sujet de la recherche biomédicale et de l’utilisation des tissus pour la recherche étaient les suivants : sexe féminin, haut niveau d’études, analyses de sang préalables et participation à une étude de recherche dans le domaine de la santé. L’attitude des participants au sujet de la recherche biomédicale était satisfaisante et comparable aux résultats d’autres pays. Book 17-6.indb 536 6/6/2011 9:45:01 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 537 Introduction The rapid development of biotechno- logical research has stimulated the use of biobanks that store biological samples and allow for identification of disease genes, which could lead to more person- alized health prevention programmes and  treatments [1]. Combining health  and genetic data from large populations also means that the complex relation- ships between genes, environment and disease  can be  explored  [1]. Human  tissue may be obtained after death or from living donors. Retention of organs and tissue for research can take place after death if relatives give their consent. For the living, samples of human tissue are often available after surgery. Not all of this tissue is needed for diagnosis and other clinical care and excess tissue samples from surgery may be stored as part of a patient’s medical record [2]. Biobanks depend on people’s will- ingness to contribute samples for both research and storage. Public support is thus essential in securing the long-term viability  of  biobanks  [3].  In  a  survey  of the general population in Ireland, the majority of those surveyed had not heard of any medical or health-related research conducted in Ireland in the previous 3 months and  less  than 10%  had participated in a medical or health research study [4]. Involving public opinion allows for more  informed decision-making  [3].  Knowledge of the public perspective, and of factors that influence their will- ingness to donate tissue samples, may inform the governance of biobanks and the design of information and consent procedures [5]. The public’s willingness  to contribute to genetic research is rela- tively high according to some American [6–9] and Asian [10] studies. The char- acteristics of those in favour of donation include older age [8], higher education,  a positive family history of a genetic dis- order, a belief that genetic research will benefit people, a willingness to partici- pate in government research on health [8,10],  a belief  in genetic determinism  [7,8], having no fear of blood, injections  or needles, and a lack of concern about loss of confidentiality [10]. Different cultures have different views on science, research and genetic discovery. Religious views especially must be considered when planning biobanks because these may influence issues of informed consent and con- cerns  about  justice  [11,12].  There  has been little research examining the circumstances under which Saudi Arabian people would be willing to al- low epidemiological investigators to use their private information and biological samples for research. We do not know whether or not Saudi lay people approve of the kinds of ethical guidelines that are widely accepted among health care pro- fessionals elsewhere. Saudi Biobank is planned as a prospective study, with an expected sample of 200 000 subjects, to  examine the interactions between genes, environment and lifestyle in a range of  common  late-onset  diseases  [13].  The costs associated with establishing such a cohort mean that it is essential to make recruitment as successful and cost-effective as possible. It is therefore important to identify the determinants of whether a person approached is will- ing to be part of Saudi Biobank or not. The objectives of this study there- fore were: to identify the attitude of a sample of Saudi Arabians regarding research involving storage and use of human tissues from which genetic infor- mation may be derived; to assess their willingness to donate tissue samples to biobanks; to identify significant predic- tors for a positive attitude to biomedi- cal research and to the willingness to donate tissue samples; and to assess the level of feedback on research findings considered desirable by the public. Methods A cross-sectional study was conducted on a sample selected from among adults attending outpatient clinics at King Ab- dulaziz Medical City, Riyadh city. Due to their engagement with the health service this group were expected to be supportive of medical research, with high levels of willingness to contribute excess surgical tissue for research. In a survey of the general population in Ire- land,  less  than 10% had participated  in  a medical or health  research study [4].  Based on an average proportion of 10%  for participation in biomedical research, a precision of 2%, with 95% confidence  limits, the estimated sample size was 864. Thus, to compensate for question- naires with incomplete responses, a total sample of 1200 adult subjects, aged 18+  years of both sexes was the target sample for the present study. A period of  2 weeks  (10 working  days) was allocated for data collection. Thus, an average of 120 questionnaires  daily were expected to be completed by data interviewers. A total of 5 data collectors (2 research coordinators and  3 research assistants) at King Abdullah International Medical Research Centre were trained to conduct the interview. Each data collector was responsible for conducting interviews with 24 subjects  daily for 10 days. Subjects were chosen  at random from among those who were willing to participate in the study at the waiting areas of different outpatient clinics of King Abdulaziz Medical City. Interview schedule Since not all the aims of this study could be adequately addressed by any one existing research questionnaire, a spe- cific interview schedule was devised. The interview schedule was informed where relevant by other research questionnaires. Use of questions from relevant international questionnaires was considered to maximize the compa- rability of the data collected in this study [4,14]. The  interview  questionnaire  was  translated  into Arabic. Test–retest  reliability was ensured in a pilot study of 20  subjects  the day before  starting  data collection. The content validity Book 17-6.indb 537 6/6/2011 9:45:01 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 538 and feasibility of the questionnaire was ensured through negotiations with various relevant experts at King Ab- dullah International Medical Research Centre, to ensure the relevancy and clarity of questions. Several additions and amendments were made to ensure that they questions were valid in a Saudi context. The interview schedule was com- posed of 3 parts: Part 1: General information related to biomedical research and biobanking This part was separated into 5 sections that covered the following aspects: per- sonal characteristics and health status; experience of blood or organ donation (whether participants had ever had a blood or other medical tests or donated blood/were willing to donate blood); experience of participation in medi- cal or health-related research; organ retention (whether they heard of organ retention, had they talked about the issue with anyone, had they read news- paper articles or listened to the radio reports about the issue); and desire for feedback about their results. Part 2: Attitude to biomedical research scale This was  10-item  attitude  statement  scale that used a 5-point Likert scale to evaluate participants’ attitudes towards and beliefs about biomedical research. The statements were concerned with: beliefs about medicines and medical research; attitudes to genetic research; willingness to contribute tissue samples to medical research; and desire for feed- back about the results. Participants gave strongly agree, agree, not sure, disagree or strongly disagree responses to all questions. Negative attitude statements were scored from 1 (strongly agree) to 5 (strongly disagree). The reverse of this scoring system was used for positive attitude statements. Accordingly, the maximum total score for attitude ques- tions was 50 and the minimum was 10.  The total score of items were divided by the number of items in the scale to obtain a mean subscale score. For every person, the percentage of attitude was calculated as follows: percentage of at- titude = (sum of the attitude score/ maximum  total  score) ×  100. A per- centage  score < 60% was  considered  negative, 60% or more was considered  positive [15]. Part 3: General-harm subscale of beliefs about medication: Participants’ beliefs about medicines were assessed using the general-harm subscale of the beliefs about medica- tion questionnaire (BMQ) [16,17].  Participants indicated their degree of agreement with 4 statements about medicines on a 5-point scale. These responses were summed to create a general harm sub-scale score, which ranged  from 4  to 20. A score of 20  in- dicated complete agreement with the concept that medicines are harmful, addictive, should not be taken for long periods and/or are less safe than natu- ral remedies. Subjects with total harm scores of < 12 points  (≤ 60% of  total  score) were categorized as  low, 12–15  points as moderate and 16+ points as high harm belief scorers. Training sessions were organized for interviewers covering the issues of medical research using human tissue, recent controversies on these issues reported in the media, areas where particular sensitivity was needed and detailed instructions on conducting the interviews. Interviewers were instructed on their role and responsibilities, in- cluding ensuring their own safety. Field data collection was supervised by the investigators for 1 month, to ensure pro- cedures were followed correctly. Daily meeting sessions were held between the data collectors and field supervisors fol- lowing field activities to solve problems, to check the accuracy and completeness of the data collection forms and to em- phasize standardization of procedures. Ethical considerations Participants’ identity and their address were unknown to the research team. Any participants had the right not to participate in the study or to withdraw during the interview without comple- tion. The  study  protocol  #  RR08/018  received ethical approval from the in- stitutional review board of the National Guard Health Affairs, Riyadh, Saudi Arabia. Statistical analysis Completing the survey involved initially ranking each positive statement on a Likert  scale  from 0 (strongly disagree)  to 4 (strongly agree). Negarive state- ments were reverse scored. SPSS, ver- sion 17 was used for data analysis. The chi-squared test was used as a test of significance to compare cat- egorical data. The Mann–Whitney test,  Kruskal–Wallis test and Pearson corre- lation were used as tests of significance to compare numerical data. Multivariate analyses were per- formed with logistic regression models to determine significant predictors of a positive attitude to biomedical research and to willingness of the participant to donate surgical tissues. The choice of the variables in the model was based on the results of univariate analyses, where only the significant variables in univari- ate analyses were entered in the logistic regression analysis. For all statistical analyses, a P-value < 0.05 was considered significant. Results Personal characteristics and health status The  study  sample  of  1051  respond- ents comprised 53.1% men and 46.9%  women. Table 1 shows the distribu- tion of the study sample according to their personal characteristics (age, sex, education, employment and marital status), as well as their health status (perception of own health, presence of chronic disease and previous hospi- talization). Women were statistically Book 17-6.indb 538 6/6/2011 9:45:02 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 539 significantly more likely than men to report being a hospital inpatient (58.4%  versus 44.7%, P < 0.001) and having a  chronic disease  (17.5% versus 11.8%,  P  <  0.01). On  the  other  hand, men  were significantly more likely to report being employed (85.0% versus 56.9%,  P < 0.001) and perceiving  their health  as  excellent/very good (80.1% versus  76.2%, P = 0.049). Experience with health care system & participation in research Table  2  shows  the  distribution  of  the study sample according to their Table 1 Distribution of study sample according to sociodemographic characteristics and health status Characteristic Males (n = 558) Females (n = 493) Total (n = 1051) No. % No. % No. % Age group (years) < 40 475 85.1 431 87.8 906 86.4 40+ 83 14.9 60 12.2 143 13.6 P-valuea χ2 = 1.53, P = 0.22 Marital status Married 322 58.2 269 55.0 591 56.7 Single 220 39.8 189 39.7 409 39.3 Widowed/divorced 11 2.0 31 6.3 42 4.0 P-valuea χ2 = 12.74, P = 0.002 Current employment status At work 466 85.0 279 56.9 745 71.8 Unemployed 16 2.9 46 9.4 62 6.0 Student 61 11.1 81 16.5 142 13.7 Retired 5 0.9 2 0.4 7 0.7 Home duties – – 82 16.7 82 7.9 P-valuea χ2 = 144.77, P < 0.001 Educational level completed < Secondary 51 9.3 58 11.9 109 10.5 ≥ Secondary 495 90.7 431 88.1 926 89.5 P-valuea χ2 = 1.91, P = 0.17 Having children No 259 48.6 233 48.6 492 48.6 Yes 274 51.4 246 51.4 520 51.4 P-valuea χ2 = 0.01, P = 0.99 Perception of health status Excellent/very good 442 80.1 371 76.2 813 78.2 Good 78 14.1 68 14.0 146 14.1 Fair/poor 32 5.8 48 9.8 80 7.7 P-valuea χ2 = 6.04, P = 0.049 Presence of chronic disease Yes 65 11.8 86 17.5 151 14.5 No 471 88.2 406 82.5 877 85.5 P-valuea χ2 = 6.72, P = 0.01 Previous hospitalization Yes 248 44.7 286 58.4 534 51.1 No 307 55.3 204 41.6 511 48.9 P-valuea χ2 = 19.50, P < 0.001 Data missing in some catogories; percentages are calculated for those participants fro whom data were available. aPearson chi-squared. Book 17-6.indb 539 6/6/2011 9:45:02 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 540 engagement with the health care sys- tem and the following reported health care experiences: blood  tests (78.1%),  tissue  testing (7.8%), blood donation  (43.1%),  tissue/organ donation (1.2%),  partici pation in health-related research (20.7%),  awareness  of  controversy  about organ  retention (63.7%), desire  for  feedback of  their  results  (11.7%)  and moderate to high harm beliefs about medicines (40.2%). Males were  significantly more likely to report previ- ous blood donation than were women (65.4% versus 17.9%) (P < 0.001), while  females were more likely to report previ- ous  tissue  testing  than males  (11.4%  versus  4.7%)  (P  <  0.001). Using  the  belief about medication questionnaire, the study found a mean score of harm beliefs about medicines of 10.8 (SD 3.0)  out of  a  total  score of 20,  indicating a  slight tendency to agree with the general concept that medicines are harmful. Attitudes to biomedical and genetic research Table 3 shows the response of partici- pants to 10 attitude statements describ- ing various potential benefits and ethics of biomedical research. According to Table 2 Distribution according to some biobanking-related variables Variable Males (n = 558) Females (n = 493) Total No. % No. % No. % Previous blood testing Yes 433 77.7 385 78.6 818 78.1 No 124 22.3 105 21.4 229 21.9 P-value χ2 = 0.03, P = 0.87 Previous tissue testing Yes 26 4.7 56 11.4 82 7.8 No 528 95.3 435 88.6 963 92.1 P-value χ2 = 14.96, P < 0.001 Previous blood donation Yes 364 65.4 88 17.9 452 43.1 No 193 34.6 403 82.1 596 56.9 P-value χ2 = 239.32, P < 0.001 Previous tissue (organ) donation Yes 5 0.9 8 1.6 13 1.2 No 545 99.1 483 98.4 1028 98.8 P-value χ2 = 1.09, P = 0.30 Previous participation in health-related research No 436 78.6 394 80.2 830 79.3 Yes 119 21.4 97 19.8 216 20.7 P-value χ2 = 0.45, P = 0.50 Awareness of organ retention controversy No 208 37.8 168 34.6 376 36.3 Yes 335 62.5 317 65.4 659 63.7 P-value χ2 = 1.13, P = 0.29 Desire for feedback about the findings No. 458 85.8 432 91.1 890 88.3 Yes 76 14.2 42 8.9 118 11.7 P-value χ2 = 7.01, P = 0.008 Beliefs about medicines High harm scorers 26 6.0 15 3.8 41 4.9 Moderate harm scorers 147 33.9 146 36.9 293 35.3 Low harm scorers 261 60.1 235 59.3 496 59.8 P-value χ2 = 2.58, P = 0.28 Data missing in some catogories; percentages are calculated for those participants fro whom data were available. aPearson chi-squared. Book 17-6.indb 540 6/6/2011 9:45:02 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 541 Table 3 Response to 10 attitudinal statements towards biobanking-related issues Statement/sex Strongly agree Agree Unsure Disagree Strongly disagree Sex difference % % % % % New genetic developments will result in cures for many diseases Male 16.8 36.4 31.9 11.0 3.9 χ2 = 11.20, P = 0.024Female 23.6 37.9 28.1 7.3 3.2 Total 19.9 37.1 30.1 9.3 3.6 Researchers are mainly motivated by selfish reasons (money) Male 7.2 11.5 22.5 38.3 20.4 χ2 = 15.06, P =0.005Female 4.7 7.7 17.3 45.3 25.0 Total 6.1 9.7 20.1 41.6 22.6 Research on human genetics is tampering with religion Male 4.3 9.2 38.3 26.2 22.1 χ2 = 20.04, P < 0.001Female 4.9 5.7 28.5 36.2 24.7 Total 4.6 7.6 33.7 30.8 23.3 Willing to donate blood in the future Male 63.1 25.7 4.7 3.7 2.8 χ2 = 16.90, P = 0.002Female 50.6 33.8 7.3 5.4 2.8 Total 57.3 29.5 5.9 4.5 2.8 Willing to allow use of own excess surgical tissue in research Male 30.3 33.6 11.9 13.6 10.6 χ2 = 23.99, P < 0.001Female 39.0 38.0 9.8 8.1 5.1 Total 34.4 35.7 10.9 11.0 8.0 Willing to allow use of deceased family member organs or tissues for research Male 9.6 16.4 19.7 29.3 25.0 χ2 = 5.07, P = 0.28Female 11.4 17.4 23.2 27.7 20.2 Total 10.4 16.9 21.4 28.6 22.8 Agree with stem cell research using adult human tissue Male 26.2 32.5 27.1 8.2 6.0 χ2 = 12.46, P = 0.014Female 30.6 36.9 24.1 5.8 2.6 Total 28.2 34.5 25.7 7.1 4.4 Agree with stem cell research using cord blood Male 28.2 31.5 26.5 7.3 6.5 χ2 = 40.01, P < 0.001Female 40.0 37.6 14.1 5.6 2.8 Total 33.7 34.4 20.7 6.5 4.8 Agree with cloning human cells to combat disease Male 28.8 34.5 19.1 9.9 7.7 χ2 = 3.06, P = 0.55Female 28.8 34.4 20.9 10.7 5.1 Total 28.8 34.4 20.0 10.3 6.5 Not allowing own surgical tissue to be used would affect relationships with doctors or nurses and negatively affect health care Male 7.9 11.8 28.0 35.7 16.5 χ2 = 5.01, P = 0.29Female 6.0 12.9 25.2 34.8 21.1 Total 7.0 12.3 26.7 35.3 18.7 aPearson chi-squared. Book 17-6.indb 541 6/6/2011 9:45:03 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 542 an attitude scale of 1–5  for each state- ment, with a percentage mean attitude score of < 60% as negative attitude and  ≥  60%  as  positive  attitude,  68.8%  of  all participants had positive attitudes to the potential benefits and ethics of research and willingness to participate in this research. This positive attitude was significantly more prevalent among females  (76.1%)  than  among males  (62.5%),  (P  <  0.001). Regarding  the  specific types of genetic research such as stem cell research and cloning, over half of the participants (57.0%) agreed that  “new genetic developments will result in  cures  for many diseases”.  In relation  to  the ethical question “Is research on hu- man genetics tampering with religion?”,  the results indicated little concern among the Saudi participants, with only a  small  proportion  (12.2%)  agreeing  that it was tampering with religion. Approval was reported for stem-cell research using cord blood (68.1%) and  or  adult human  tissue (62.7%) or for cloning human cells to combat disease (63.2%). Consistent with positive atti- tudes to medical and genetic research in general, only 15.8% felt that researchers  were motivated by selfish reasons such as money. The majority was willing to allow use of their tissue for research purposes (70.1%). Consistent with  this finding,  only  19.3%  agreed  that  not  allowing  the use of their tissues would jeopard- ize their relationship with doctors and nurses and have a negative effect on their health care. The majority of par- ticipants  (86.8%)  indicated  that  they  would be willing to donate blood in the  future. Only 27.3% of participants  reported that they would be willing to allow the use of organs or tissues of a family member after death for research purposes. Females were significantly more willing than males to allow use of their tissues for research purposes (77.0% versus 63.9%, P < 0.001), while  males (88.8%) were significantly more  willing than women (84.4%) to donate  blood in the future (P = 0.002). There  were no significant sex differences in relation to willingness to donate family members’ organs after death (P = 0.28). Factors associated with attitudes to biomedical research Univariate analysis was conducted to identify factors which may be associ- ated with attitude score to biomedical research (Table 4). Non-significant factors were: age (Kruskal–Wallis χ2 = 3.13, P = 0.37), marital status (χ2 = 1.06,  P  =0.79),  current  employment  status  (χ2 = 4.74, P  = 0.32), having children  (Mann–Whitney z  = 0.15, P  =0. 32),  perception of health status (χ2 = 3.47, P = 0.48), presence of chronic disease (z = 1.21, P = 0.23) previous tissue testing (z = 0.65, P = 0.51), previous blood dona- tion (z = 0.16, P = 0.87) and the desire  for feedback (z = 0.73, P = 0.47). With  regard to the beliefs about medication, there was a significant inverse correla- tion between the total score of harm beliefs about medication and the total attitudinal score to biomedical research (r = –0.08, P = 0.026). However, when  the harm belief was dealt as a categorical variable (high, moderate and low harm belief scorers), no such association was detected (z = 0.18, P = 0.86). Table 4 Significant predictors for positive attitude to biomedical research and willingness to allow use of surgical tissues in research Predictors Positive attitude to biomedical research (n = 654; 68.8%) Willingness to allow use of excess surgical tissue (n = 724; 78.4%) % Crude OR (95% CI) Adjusted OR (95% CI) % Crude OR (95% CI) Adjusted OR (95% CI) Sex Female 76.1 1.91 (1.44–2.53) 2.08 (1.49–2.91) 85.4 2.28 (1.64–3.18) 2.53 (1.69–3.77) Male 62.5 72.0 Education completed ≥ Secondary 59.4 2.13 (1.39–3.28) 2.06 (1.23–3.46) 79.2 1.49 (0.91–2.47) 1.19 (0.62–2.29) < Secondary 40.0 71.8 Previous blood test Yes 57.9 1.47 (1.06–2.05) 1.61 (1.09–2.37) 81.3 2.02 (1.42–2.88) 2.04 (1.32–3.14) No 54.3 68.2 Previous hospitalization Yes 59.0 1.12 (0.85–1.47) 1.06 (0.76–1.47) 83.1 1.78 (1.30–2.45) 1.56 (1.06–2.30) No 55.4 73.3 Previous participation in health-related research Yes 68.1 1.56 (1.09–2.25) 1.65 (1.06–2.55) 82.4 1.37 (0.91–2.07) 1.99 (1.16–3.41) No 54.3 77.3 OR = odds; CI = confidence interval. Book 17-6.indb 542 6/6/2011 9:45:03 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 543 Applying logistic regression analysis the significant predictors of a positive attitude to biomedical research were: sex, education, having had a previous blood test and previous participation in health-related research. Females (ad- justed OR = 2.08, 95% CI: 1.49–2.91, P < 0.01) and those who had completed  secondary education (aOR = 2.06, 95%  CI: 1.23–3.46, P < 0.01) were  twice as  likely to have a positive attitude. Partici- pants with a history of previous blood test  (aOR = 1.61, 95% CI: 1.09–2.37, P < 0.05)), as well as  those who previ- ously participated in health-related re- search (aOR = 1.65, 95% CI: 1.06–2.55,  P < 0.05) were 1.5 times more likely to  have a positive attitude. Univariate analysis was conducted to identify factors that may be associ- ated willingness to allow use of excess surgical tissue for research (Table 4). Non-significant factors were: age (Kruskal–Wallis  χ2 = 0.27, P  = 0.97),  marital  status  (χ2  =  0.38, P  =  0.95),  current employment  status (χ2 = 1.88, P  = 0.76),  having  children  (Mann- Whitney z = 0.72, P = 0.49), perception  of health  status  (χ2 = 4.07, P  = 0.41),  presence of chronic disease (z = 1.24, P = 0.22), previous tissue testing (z = 0.96,  P = 0.34), previous blood donation (z = 0.01, P = 0.99), belief about medications  (z = 0.92, P = 0.35) and  the desire  for  feedback (z = 1.15, P = 0.62). Applying logistic regression analysis, the significant predictors of willingness to allow use of excess surgical tissue were: sex, history of previous blood test and history of previous hospitaliza- tion.  Females  (aOR = 2.53,  95% CI:  1.69–3.77, P < 0.01), those with history  of previous blood test (aOR = 2.04, 95%  CI: 1.32–3.14, P < 0.01), those with his- tory of previous hospitalization (aOR = 1.56, 95% CI: 1.06–2.30, P < 0.01) as  well as those who had previously partici- pated in health-related research (aOR = 1.99,  95% CI:  1.16–3.41, P  < 0.01)  were about twice as likely to allow their excess surgical parts to be used for re- search purposes. Discussion There has been little, if any, research examining the circumstances under which Saudi Arabian people would be willing to allow epidemiological inves- tigators to use their private information and biological samples for research. Attitudes to biomedical research were evaluated in this study using a set of statements regarding the potential benefits and ethics of research. Overall, 68.8% of participants  reported positive  attitudes towards biomedical research. This satisfactory level of positive attitude might be justified by the fact that many of those interviewed had previously engaged with the health care system and reported various health care experi- ences. Female participants were more engaged with the health care system, and this may be why females reported more willingness to allow use of excess surgical parts for research purposes. Genetic research is multi-dimen- sional and there has been considerable controversy surrounding certain types of research such as stem-cell research. Over  half  of  our  participants  (57%)  agreed that new genetic developments would result in cures for many diseases. This figure is less than that of a recent Human Genetics Commission report from the United Kingdom of attitudes to human genetic information, where 88% agreed with this statement [18]. Islam encourages furthering our un- derstanding of some hereditary diseases and our susceptibility to them, under the condition that research upholds the dignity of humanity [12]. The results of  the present study indicated no concern among our Saudi participants. Consist- ent with positive attitudes to medical and genetic research in general, only 16%  felt  that  researchers were moti- vated by selfish reasons such as money. In contrast, a Dutch study comparing cancer trial participants and non-partic- ipants towards clinical research, found that  34% of  participants  and  23% of  non-participants believed that medical research was primarily performed to promote doctors’ careers [19]. With regard to the willingness to contribute to research, the majority of participants had never donated blood. However, the majority of participants (87%)  indicated  that  they would  be  willing to donate blood in the future. This high level of willingness is consist- ent with that found in a national study of the Swedish public [20] and a nationally  representative study of households in the United States [21]. Moreover, when  interviewed subjects were presented with the hypothetical situation of hav- ing surgery and subsequently being asked if their “excess” surgical tissue (i.e.  material which was properly removed as part of surgery and which is surplus to that needed to be stored/tested for patient care purposes) could be used in a research study, the majority was willing to allow such use of their tissue. Similarly, a Swedish study of 1000 par- ticipants found that 71% of participants  would agree to the use of a donated tissue sample for genetic research [22]. Patients may feel obliged to comply with doctors’ request to allow their tis- sue to be used and stored for research almost without regard for personal preferences due to a perceived depend- ence on the doctor for their well-being. However, the present study revealed that only 19.3% participants agreed that  their health care would be affected if not they did not allow the use of their tissues. This finding was in agreement with  that of Kettis-Lindblad et al.  [20].  On the other hand, it was clear that the participants were less willing to allow the use of tissue or organs from a deceased relative than they were to allow their own excess surgical tissue to be used. The decision to donate organs is often ultimately made by family members. However, further research is necessary to identify the symbolic differences be- tween donation of tissue from the living and from the dead. It would appear that in general the public would like some level of personal Book 17-6.indb 543 6/6/2011 9:45:03 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 544 feedback of their results. In a study in Ireland the majority of participants re- ported that they would like to receive general information regarding the re- sults of the research if they allowed blood or tissue samples to be used for research [4]. However, it was interesting that only  12% of  respondents  in our  study  indi- cated that they would like to receive such information, and there was no significant association between the desire for feed- back and either the attitude to biomedi- cal research or willingness to donate their tissues for research purposes. In other studies the characteristics of those in favour of donation include being older  [23], being highly educated and  having a more positive attitude toward medical  and genetic  research  [20,24].  However, this was not the case in the present study, where those who had completed their secondary education were not significantly more in favour of donation than non-educated, but were twice as likely to have a positive attitude to biomedical research. In a previous study, the highest pro- portion of potential donors was reported among those who had previously donat- ed blood  in  the past [20]. However,  in  our study, previous blood testing—and not blood donation—was a significant predictor of both the attitude to bio- medical research and the willingness to donate tissues. Similarly, participants who reported ever being a hospital inpa- tient were significantly more in favour of donation than those without a history of previous hospitalization. Prior participation in medical re- search has been found to positively influence willingness to participate in such research [14]. In the present study,  those who had previously participated in health-related research were more willing to allow use of their surgical parts and to have a positive attitude to bio- medical research. It is also possible that a person’s attitude towards medicines in general may affect his/her willingness to par- ticipate in biomedical research and to allow stored tissue to be used in such research [16,25].  In  the present  study,  there was a slight tendency of partici- pants to agree with the general harm concept that medicines are harmful. This tendency could have lead to a reduced willingness to contribute to medical research. However, although there was a significant inverse correla- tion between the total score of harm beliefs about medicines and the total attitudinal score to biomedical research (r = –0.08, P = 0.026),  this  significant  correlation disappeared after adjusting for sex and other factors. The present study had some limita- tions. First, the subjects of the study were from outpatient clinics, and if they had been from a different environment, e.g. at their workplace, completely different results might be expected. Secondly, the participants that we interviewed were recruited from only one city, and it is possible that regional differences could affect our results, and the attitudes expressed in the interviews may not be representative of the general pub- lic within Saudi Arabia. In addition, many of those interviewed had been engaged with the health care system and reported various health care experi- ences such as blood tests, tissue tests and being a hospital inpatient. This fact must have affected the attitude of par- ticipants, especially females, who were more engaged in the health care system than males. Conclusion Our participants were generally quite supportive of medical research, with high levels of willingness to contribute excess surgical tissue for research and storage. This willingness does not depend on the subjects being well-informed and having trust in experts and institutions. These findings suggest that the attendants of outpatient clinics in Riyadh were gener- ally aware of and committed to making a contribution to research and related activities in the health care system for their own benefit and for the benefit of future patients. However, we need to validate our findings through research with a nationally representative sample of Saudi Arabians. References Kaiser J. Biobanks. Population databases boom, from Iceland 1. to the U.S. Science, 2002, 298:1158–1161. Burton JL, Wells M. The Alder Hey affair. 2. Archives of Disease in Childhood, 2002, 86:4–7. Tutton R, Kaye J, Hoeyer K. Governing UK Biobank: the impor-3. tance of ensuring public trust. Trends in Biotechnology, 2004, 22:284–285. Cousins G et al. 4. Public perceptions of biomedical research: a survey of the general population in Ireland. Psychology reports. Dublin, Royal College of Surgeons in Ireland, 2005. Kettis-Lindblad A et al. Genetic research and donation of tis-5. sue samples to biobanks. What do potential sample donors in the Swedish general public think? European Journal of Public Health, 2006, 16:433–440. McQuillan GM et al. Consent for genetic research in a gen-6. eral population: the NHANES experience. Genetics in Medicine, 2003, 5:35–42. Merz JF, Sankar P. DNA banking: an empirical study of a pro-7. posed consent form. In: Weir RF, ed. Stored tissue samples: ethical, legal, and public policy implications. Iowa, University of Iowa Press, 1998:198–225. Wang SS et al. Public attitudes regarding the donation and 8. storage of blood specimens for genetic research. Community Genetics, 2001, 4:18–26. Malone T et al. High rate of consent to bank biologic samples 9. for future research: the Eastern Cooperative Oncology Group experience. Journal of the National Cancer Institute, 2002, 94:769–771. Book 17-6.indb 544 6/6/2011 9:45:04 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 545 Wong ML et al. Willingness to donate blood samples for ge-10. netic research: a survey from a community in Singapore. Clini- cal Genetics, 2004, 65:45–51. Biobanking in British Columbia. A deliberative public consulta-11. tion. GE3LS Arch Project, W. Maurice Young Centre for Ap- plied Ethics, University of British Columbia [website] (http:// biobanktalk.ca/, accessed 30 March 2011). Seminar on genetics, genetic engineering, the human genes, and 12. genetic treatment: an Islamic perspective. Islamic Organisation for Medical Sciences (http://www.islamset.com/bioethics/ genetics/genetics.html, accessed 30 March 2011). Saudi Biobank13. . King Abdullah International Medical Research Center [website] (http://www.kaimrc.med.sa/, accessed 30 March 2011). Trauth JM et al. Public attitudes regarding willingness to par-14. ticipate in medical research studies. Journal of Health & Social Policy, 2000, 12:23–43. Abolfotouh MA et al. Smoking intervention program for sec-15. ondary school male students in the Southwestern Saudi Arabia. Eastern Mediterranean Health Journal., 1997, 3:90–100. Horne R, Weinman J, Hankins M. The beliefs about medicines 16. questionnaire: the development and evaluation of a new method for assessing the cognitive representation of medica- tion. Psychology and Health, 1999, 14:1–24. Horne R et al. Medicine in a multi-cultural society: the effect 17. of cultural background on beliefs about medications. Social Science & Medicine, 2004, 59:1307–1313. Public attitudes to human genetic information. People’s panel 18. quantitative study conducted for the human genetic commission. London, Human Genetics Commission, 2001. Madsen SM et al. Attitudes towards clinical research amongst 19. participants and nonparticipants. Journal of Internal Medicine, 2002, 251:156–168. Kettis-Lindblad A et al. Genetic research and donation of tis-20. sue samples to biobanks. What do potential sample donors in the Swedish general public think? European Journal of Public Health, 2006, 16:433–440. McQuillan GM et al. Consent for genetic research in a gen-21. eral population: the NHANES experience. Genetics in Medicine, 2003, 5:35–42. Hoeyer K et al. Informed consent and biobanks: a popu-22. lation-based study of attitudes towards tissue donation for genetic research. Scandinavian Journal of Public Health, 2004, 32:224–229. Malone T et al. High rate of consent to bank biologic samples 23. for future research: the Eastern Cooperative Oncology Group experience. Journal of the National Cancer Institute, 2002, 94:769–771. Wang SS et al. Public attitudes regarding the donation and 24. storage of blood specimens for genetic research. Community Genetics, 2001, 4:18–26. Horne R. Assessing perceptions of medication: psychological 25. perspectives. In: McGovock H, ed. Handbook of drug use research methodology. Newcastle, United Kingdom, Drug Utilisation Research Group, 2000:299–319. Operational guidelines for ethics committees that review biomedical research All biomedical research involving human subjects has to comply with established international guidelines that require ethical and scientific review of the research, alongside informed consent. This book sets out operational guidelines for ethics committees in order to facilitate, support, and ensure quality of the ethical review of biomedical research in all countries around the world. Targeted for use by national and local bodies, these guidelines define the role and constituents of an ethics committee, and detail the requirements for submitting an application for review. The review procedure, plus details of the decision making process are provided, together with necessary follow-up and documentation procedures. The document is available in a number of languages, including English and French, and can be downloaded at: http://apps.who.int/tdr/svc/publications/training-guideline-publications/operational-guidelines-ethics-biomedical- research.htm Book 17-6.indb 545 6/6/2011 9:45:04 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 546 Role of HFE gene mutations on developing iron overload in β-thalassaemia carriers in Egypt H.A. Madani,1 R.A. Afify,1 A.A. Abd El-Aal,1 N. Salama 2 and N. Ramy 2 ABSTRACT A case–control study aimed to determine the prevalence of C282Y, H63D and S65C mutations of the HFE gene in β-thalassaemia carriers and investigate their influence on iron absorption. A total of 41 β-thalassaemia carriers and 40 control subjects without haemoglobinopathies were screened for the C282Y, H63D and S65C mutations by polymerase chain reaction-restriction fragment-length polymorphism. The iron status in these subjects was studied and correlated with the HFE gene mutations. H63D, S65C and C282Y allele frequencies were 30.5%, 13.4% and 7.3% respectively in β-thalassaemia carriers and 10.0%, 2.5% and 0.0% respectively in the control group. Compound heterozygosis was found in 10 carriers (24.4%). The transferrin saturation level was high in compound heterozygote cases. Our study has shown that the HFE gene mutations are common in Egypt among β-thalassaemia carriers compared with normal controls. 1Department of Chemical and Clinical Pathology; 2Department of Paediatric Medicine, Faculty of Medicine, University of Cairo, Cairo, Egypt (Correspondence to H.A. Madani: hamadani20@hotmail.com). Received: 12/10/09; accepted: 10/12/09 صرم في ةيميسلاث اتيبلا ةَل ََح ىدل ديدلحا لح طرف روهظ في HFE ينلجا تارفط رود يمار ينميرن ،ةملاس ينفين ،لاعلا دبع دحمأ ءماسأ ،يفيفع ميلعلا دبع مايهر ،نيدم ليع نانح صيقتو ةيميسلاث اتيبلا ةَل ََحم ينب HFE ينجلل S65C و H63D و C282Y تارفطلا راشتنا ديدتح لىإ هذه دهاوشلاو تلاالحا ةسارد فدته :ةصلالخا يأب ينباصلما يرغ نم ًادهاش ًاصخش 40و ةيميثلاس اتيبلل ًلاماح ًاصخش 41 تلمش تاي ِّرتح تاثحابلا ترجأ دقو .ديدلحا صاصتما لىع اهيرثأت فد ُّرشلا لاوطأ لاكشأ ددعتو ،زايرميلوبلل ليسلسلا لعافتلا ءارجإب كلذو C282Y، H63D، S65C تارفطلا دوجو نع ًاثحب ،ينيبولغوميه للاتعا ليلأ رتاوتو H63D: %30.5 ةرفطلا ليلأ رتاوت ناك دقو .HFE ينلجا تارفطب اهطابتراو صاخشلأا ءلاؤه في ديدلحا ةلاح تسِرُد كلذك .ةَعَطَتْقُمـلا تدجو دقو .دهاوشلا ةعوممج في لياوتلا لىع %0و %2.5و %10.0و ،ةيميسلاث اتيبلا ةَل ََحم ينب C282Y: %7.3 ةرفطلا ليلأ رتاوتو S65C: %13.4 ةرفطلا رياغت تلااح في ًاعفترم نييرفسناترلا ع ُّربشت ىوتسم ناك ماك .)%24.4( ةيميسلاث اتيبلا ةَل ََحم نم صاخشأ ةشرع في بّكرلما تويجزلا َرُياغت تاثحابلا نم ينيعيبطلا صاخشلأاب ةنراقم ةيميسلاث اتيبلا ةَل ََحم ينب صرم في ثودلحا ةعئاش HFE ينلجا تارفط نأ لىع ةساردلا تلد دقو .بّكرلما تويجزلا .دهاوشلا Rôle des mutations du gène HFE dans l'apparition d'une surcharge en fer chez les porteurs d'une β-thalassémie en Égypte RÉSUMÉ La présente étude cas-témoins visait à déterminer la prévalence des mutations C282Y, H63D et S65C du gène HFE chez les porteurs d'une β-thalassémie et à rechercher leur influence sur l'absorption du fer. Au total, 41 porteurs d'une β-thalassémie et 40 sujets témoins ne présentant aucune hémoglobinopathie ont participé à cette étude visant à examiner les mutations C282Y, H63D et S65C du gène HFE par la méthode du polymorphisme de longueur des fragments de restriction d'ADN amplifié. Le bilan martial des participants a été étudié et corrélé aux mutations du gène HFE. La fréquence des allèles H63D, S65C et C282Y était de 30,5 %, 13,4 % et 7,3 % respectivement, chez les porteurs d'une β-thalassémie et de 10,0 %, 2,5 % et 0,0 % respectivement, dans le groupe témoin. Une hétérozygotie composée a été retrouvée chez dix porteurs (24,4 %). Le taux de saturation de la transferrine était élevé chez les cas hétérozygotes composés. Notre étude a démontré que les mutations du gène HFE sont fréquentes en Égypte chez les porteurs d'une β-thalassémie par rapport aux sujets témoins. Book 17-6.indb 546 6/6/2011 9:45:04 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 547 Introduction Thalassaemia syndromes are the most commonly inherited single-gene dis- orders  worldwide  [1].  About  3%  of  the  world  population  (150 million)  carry the β-thalassaemia genes  [2].  In  Egypt β-thalassaemia is the most com- mon genetically determined, chronic, haemolytic anaemia with an estimated carrier  rate  of  9%–10.5%  [3].  The  β-thalassaemia trait is associated with extremely mild anaemia and red-cell morphological changes; however it may be completely silent with no anaemia or haematological abnormalities  [3,4].  It is characterized by mild, ineffective erythropoiesis that can induce excessive iron absorption from the diet because of higher iron requirement for haemo- globin synthesis [5]. β-thalassaemia trait alone does not lead to iron overload, and some gene modifiers and acquired causes are reported to modulate the expression of hereditary haemochromatosis  [6].  Haemochromatosis is a common auto- somal recessive disorder of iron metab- olism, with a prevalence of 1 in 300–500  individuals [7], which can lead to total- body iron overload with secondary tis- sue damage in a wide range of organs. When β-thalassaemia trait is inherited together with a mutation in the HFE gene, which is associated with hereditary haemochromatosis, iron overload may ensue [8]. The HFE gene is located on the short arm of chromosome 6 at posi- tion 21.3; its mutation is a major cause  of haemochromatosis. Three missense mutations in the HFE gene are associ- ated with haemochromatosis. About 85% of cases carry cysteine-to-tyrosine  substitution at amino acid position 282  in the HFE gene (C282Y) [9]. This mu- tation  is  responsible  for about 60% of  haemochromatosis cases in Mediterra- nean populations [10], about 15%–20%  carry aspartic acid-to-histidine substitu- tion at amino acid position 63 (H63D) [11,12]  and  a  third mutation  results  from serine-to-cysteine conversion in amino acid position 65 (S65C) [13].  The last 2 mutations are associated with  a milder form of haemochromatosis, but the compound heterozygous state of one of  them with  the C282Y muta- tion increases the risk of developing iron overload  [14,15]. The  interaction  of  HFE mutations with the thalassaemias may have a synergistic effect, increasing the iron intake and storage [9]. The high frequency of β-thalassaemia trait in Egypt led us to design a case–con- trol study to determine the prevalence of C282Y, H63D and S65C mutations  of HFE gene in β-thalassaemia carriers and investigate their influence on iron absorption, comparing them with indi- viduals without thalassaemias. Methods Sample This study was carried out during the period between March and December 2007. We  studied 2 groups: 41  cases  of β-thalassaemia  carriers  (10 males  and 31 females) with a mean (standard deviation) age of 38 [standard deviation (SD) 3.2] years, who were parents of  thalassaemia major patients attending the haematology clinic at the new Cairo University  children’s hospital;  and 40  subjects (15 males and 25 females) with  a mean age of 37.2 (SD 2.7) years with- out haemoglobinopathies, as a control group. Diagnosis of β-thalassaemia trait was defined by low mean corpuscular volume  (MCV  <  80  fL),  low mean  corpuscular haemoglobin (MCH < 27  pg),  and  increased  haemoglobin A2  (> 3.5%). Control  subjects were char- acterized by normal haematological parameters. The institutional ethics committee approved the study and informed con- sent was obtained from all participants. The exclusion criteria were: subjects with impaired liver function (which could interfere with iron metabolism); blood donors (as their iron status may be decreased as a result of repeated blood donation); and children (because their iron deposition tends to increase with age and may reach moderately high levels in adults). Laboratory workup Haematological and iron parameters Blood samples were collected from all participants and tested at the Chemi- cal and clinical pathology laboratory at the new Cairo University children’s hospital. A 2 mL of blood sample was  collected into EDTA tubes for com- plete blood count using an electronic Coulter  counter  (Sysmex KX-21N)  and haemoglobin electrophoresis on cellulose acetate paper at pH 8.4. A 3 mL blood sample was taken into plain tubes for determination of serum iron and total iron binding capacity (TIBC). Both iron and TIBC were assessed using standard colorimetric kits by au- tomated analyser (Beckman Coulter Synchron CX9 Pro). Normal range for iron was 70–200 µg/dL and  for TIBC  was 250–435 µg/dL. The  transferrin  saturation index was calculated using the  formula:  serum  iron/TIBC × 100  (normal range 20%–45%) [16]. Genomic DNA analysis A 3mL blood sample was collected into EDTA vacutainers for genomic DNA analysis by polymerase chain reaction–restriction  fragment-length  polymorphism  (PCR–RFLP). DNA  was extracted from peripheral blood leukocytes by the salting- out procedure [17]. Two primer sets were use d for DNA amplification. The first, 5ʹACATGGTTAAGGCCTGTTGC3ʹ and 5ʹGCCACATCTGGCTTGAAA TT3ʹ,  generates  a  207-bp  fragment  that comprises the H63D and S65C mutation sites. The second, ʹGGG- TATTTCCTTCCTCCAACC3ʹ and ʹCTCAGGCACTCCTCTCAACC3ʹ, generates a 441-bp fragment for C282Y  analysis. The PCR cycles were con- ducted in a thermal cycler (Biometra UNO-thermoblock) and consisted of Book 17-6.indb 547 6/6/2011 9:45:04 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 548 5 min of initial denaturation at 94 °C, 30 cycles of just 1 min. denaturation at  94 °C , 1 min. annealing at 58 °C and 1 min. extension at 72  °C,  followed by  10 min. for final extension at 72 °C. The  amplified PCR products were digested with the restriction enzymes BclI, HinfI and RsaI for H63D, S65C and C282Y  mutations respectively. The C282Y mutation creates a new  RsaI site. The digested PCR product is cut  into 2  fragments of 296 and 145  bp in the normal allele, while in the mu- tated DNA, 3  fragments of  296,  116  and 29 bp are generated after digestion  (Figure 1). The H63D mutation abol- ishes the BclI recognition site in the 207  bp PCR product; while normal DNA is cut  into 2  fragments of 138 and 69 bp  the mutated DNA is not cut (Figure 2). The S65C mutation abolishes  the  HinfI  recognition  site  in  the  207  bp  PCR product; while normal DNA is cut into 2 fragments of 147 and 60 bp, the  mutated DNA is not cut (Figure 3) [7]. Allele frequency was calculated us- ing the gene counting method (each in- dividual is represented by 2 alleles; allele  frequency is number of mutated alleles/ total number of alleles). Chi-squared and Fisher exact tests were used to compare allele and genotype frequency between the β-thalassaemia carriers and the control group. P-value < 0.05 was  considered significant. The clinical data of the patients were represented as mean and SD. Statistical analysis was done using SPSS, version 11.5. Results HFE allelic frequencies and genotypes The allelic frequencies obtained for HFE  gene mutations C282Y, H63D  and S65C in the studied groups are presented in Table 1. There were sig- nificantly high allelic frequencies of the H63D,  S65C  and C282Y muta- tions among β-thalassaemia carriers (30.5%, 13.4% and 7.3%  respectively)  Figure 1 Detection of the HFE C282Y mutation by PCR-RFLP with C282Y primers and digested with restriction enzyme Rsa1. Lane M: DNA marker. Lanes 1, 2, 3 & 5: normal C282Y allele (296 &145 bp). Lane 4: heterozygote alleles (296, 145, 116 & 29 bp). Figure 2 Detection of the HFE H63D mutation by PCR-RFLP with H63D primers and digested with restriction enzyme Bcl1. Lane M: DNA marker. Lanes 1, 5, 6 & 7: normal H63D wild allele digested bands (138 & 69 pb). Lanes 3 & 4: heterozygotes for H63D mutant allele showing normal digested bands (138 & 69 pb) as well as the undigested amplified fragment (207 pb). Lane 2: homozygote for H63D mutant allele show undigested band (207 pb). Figure 3 Detection of the HFE S65C mutation by PCR-RFLP with S65C primers and digested with restriction enzyme Hinf1. Lane M: DNA marker. Lanes 1, 2, 3 & 6: normal S65C wild allele digested bands (147 & 60 pb). Lanes 4 & 5: heterozygotes for S65C mutant allele showing normal digested bands (147 & 60 pb) as well as the undigested amplified fragment (207). Lane 7: homozygote for S65C mutant allele show undigested band (207 pb). Book 17-6.indb 548 6/6/2011 9:45:05 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 549 compared with  the  controls  (10.0%,  2.5% and 0.0%) respectively (Fisher test,  P < 0.05). Mutational analysis for the HFE gene (Table 2) showed that compound  heterozygosis was  found  in 10 of  the  β-thalassaemia  carriers  (24.4%):  6  cases were compound heterozygous for the 3 mutations (5 cases hetero- zygous for the 3 mutations and 1 case heterozygous  for H63D/C282Y and  homozygous for S65C mutation) and 4 cases were H63D/S65C, while in the control group 2 individuals (5.0%) were  H63D/S65C. In β-thalassaemia carri- ers the genotype wild-type/wild-type (–/–) was the most frequent, account- ing for 17 individuals (41.5%). H63D, S65C and C282Y hetero- zygote genotype frequencies among β-thalassaemia carriers were 23 (56.1%),  9 (22.0%) and 6 (14.6%) cases respec- tively while in controls these were 8 (20.0%), 2 (5.0%) and 0 (0.0%) respec- tively (Table 3). The genotype frequency by sex is also represented in Table 3. The male to female sex ratio in cases of heterozygote C282Y mutation  was  6:0,  in H63D  heterozygote cases was 7:16 and in het- erozygote S65C was 6:3. HFE mutations and iron metabolism We found 8 patients with high transfer- rin saturation (> 45%) (7 males and 1  female). Of these, 6 were heterozygous for H63D, S65C and C282Y, 1 patient  was heterozygous for H63D and S65C and 1 patient was homozygous for H63D. We studied the relationship between HFE gene mutations and iron status in β-thalassaemia carriers and found significantly higher allelic frequencies of the H63D, S65C and C282Y mutations  among β-thalassaemia carriers (30.5%,  13.4% and 7.3% respectively) compared  the controls (10.0%, 2.5% and 0.0% re- spectively). H63D, S65C and C282Y  heterozygote genotype frequencies among β-thalassaemia carriers were 56.1%, 22.0% and 14.6%  respectively  while  in  the controls  they were 20.0%,  5.0% and 0.0% respectively.  The results of HFE allele frequencies in our study are similar to Panigrahi et al. [18], who reported allelic frequencies  of the H63D mutation of 22.5% among  patients and 8.1% among controls. The  frequency of  the C282Y mutation was  0% among patients and controls  [18].  Our results also agreed with a screening study for haemochromatosis mutations in β-thalassaemia minor patients from the Islamic Republic of Iran, which in- dicated significant differences in the fre- quencies of C282Y and H63D mutants  in relation to control individuals, where the H63D and C282Y allele  frequen- cies were 12.9% and 1.6%  in patients  compared with 8.7% and 0% in controls  respectively [9]. The results of our study  also agreed with Oliveira et al., who re- ported allelic frequencies of the H63D, S65C  and C282Y mutations  among  β-thalassaemia carriers of 13.7%, 0.6%  and 2.4%  respectively  compared with  9.5%, 0.9% and 0.3% respectively among  controls; the heterozygote genotype frequencies among their patients and controls were not significantly different [7]. In the present study in Egypt, the genotype frequencies and allele fre- quencies among the control group for H63D, S65C and C282Y are  in agree- ment with other studies in Africa show- ing an absence of the C282Y mutation  in Algeria, Ethiopia and Senegal. The H63D mutation, though absent in Sen- egalese, was  found  in about 9% of  the  chromosomes genotyped among the central Ethiopians and Algerians [19].  Also, our genotype frequencies agreed with the results of a study done in Egypt by Settin et al. who reported H63D and C282Y genotype  frequencies as 21.2%  and 0.0%  respectively  in  their  control  subjects [20]. In our study, compound heterozy- gosis was  found  in 10 β-thalassaemia carriers: 6 cases were H63D/S65C/ Table 1 Allele frequencies of H63D, S65C and C282Y mutations among total alleles of beta-thalassaemia carriers and controls without haemoglobinopathies Mutation β-thalassaemia carriers (n = 41) Controls (n = 40) P-value Mutated alleles (n = 82) Mutated alleles (n = 80) No. % No. % H63D 25 30.5 8 10.0 < 0.001 S65C 11 13.4 2 2.5 0.011 C282Y 6 7.3 0 0.0 0.014 Table 2 HFE genotype frequencies of H63D, S65C and C282Y mutations among beta-thalassaemia carriers and controls Genotype β-thalassaemia carriers (n = 41) Controls (n = 40) H63D S65C C282Y No. % No. % +/+ –/– –/– 1 2.4 0 0.0 +/– –/– –/– 13 31.7 6 15.0 +/– +/– –/– 4 9.8 2 5.0 +/– +/– +/– 5 12.2 0 0.0 +/– ++ +/– 1 2.4 0 0.0 –/– –/– –/– 17 41.5 32 80.0 + = mutated; – = wild. Book 17-6.indb 549 6/6/2011 9:45:05 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 550 C282Y and 4 cases were H63D/S65C,  while  in  the control group 2  individu- als were H63D/S65C. Compound heterozygosis  for C282Y and H63D  seems to predispose to disease expres- sion [21]. The clinical significance of the  other forms of compound heterozygo- sis, such as C282Y and S65C or H63D  and S65C,  is  still  controversial  [7].  In  the present study, the high incidence of  the C282Y mutation  observed  in  β-thalassaemia carriers in relation to the control group leads to a concern about the levels of iron deposition in the organs of these patients. Both diseases (haemochromatosis and thalassaemia) affect iron metabolism and the meaning of coinheritance of  the 2 mutations  is  not well understood. In the present study, high trans- ferring saturation was observed in 8 β-thalassaemia carriers (7 males and 1 female), all of whom carried the 3 Table 3 HFE genotype frequencies by sex among beta-thalassaemia carriers and controls Genotype β-thalassaemia carriers Controls Total (n = 41) Males (n = 10) Females (n = 31) Total (n = 40) Males (n = 15) Females (n = 25) No. No. No. No. No. No. H63D +/+ 1 0 1 0 0 0 +/– 23 7 16 8 4 4 –/– 17 3 14 32 11 21 S65C +/+ 1 1 0 0 0 0 +/– 9 6 3 2 2 0 –/– 31 3 28 38 13 25 C282Y +/+ 0 0 0 0 0 0 +/– 6 6 0 0 0 0 –/– 35 4 31 40 15 25 + = mutated; – = wild. mutations. They might be at risk of de- veloping clinical haemochromatosis and strict follow-up would be required to detect early cases. An interesting point was the male to female sex ratio; where all the het- erozygote  cases  of C282Y mutation  were males,  a male:female  ratio of 6:0,  while in the H63D heterozygote cases, the male/female ratio was 7:16 and the heterozygote S65C male/female ra- tio was 6:3. Male individuals carrying H63D and S65C mutations or one of  them  in  combination with C282Y  would be more at risk of developing haemo chromatosis than females. In- deed, due to menstruation and pregnan- cy, females seem to be protected from developing  iron overload  [22], which  can explain why male individuals carry- ing the mutations have higher transfer- rin saturation than females. Thus, the risk of developing haemochromatosis is associated with the HFE genotype and the subject’s sex. However, a larger scale population study is needed to confirm this finding as the sample size in this study was small. Our results confirm the hypothesis that in some way the HFE gene muta- tions could be implicated in increasing iron storage when interacting with other genetic determinants of β-thalassaemia [23]. Our study has shown that the HFE gene mutations are common among β-thalassaemia carriers in Egypt com- pared with normal controls. This em- phasizes the value of routine screening of the HFE mutations in β-thalassaemia carriers to avoid developing iron over- load and to detect early cases. Mass screening for HFE gene mutations among thalassaemia patients is strongly recommended. References Karimi M et al. Prevalence of beta-thalassemia trait and glu-1. cose-6-phosphate dehydrogenase deficiency in Iranian Jews. Archives of Medical Research, 2008, 39:212–214. Saxena A, Phadke SR. Feasibility of thalassemia control by 2. extended family screening in Indian context. Journal of health, population & nutrition, 2002, 20(1):31–35. El Beshlawy A et al. Thalassemia prevalence and status in Egypt. 3. Pediatric Research, 1999, 46:102. Krishnamurti L et al.; LaksShaman K et al. Coinheritance of 4. alpha-thalassemia-1 and hemoglobin E/beta zero-thalassemia: practical implications for neonatal screening and genetic counseling. Journal of Pediatrics, 1998, 132:863–865. Book 17-6.indb 550 6/6/2011 9:45:05 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 551 Thein SL. Genetic modifiers of 5. β-thalassaemia . Heamatologica, 2005, 90:649–660. Weatherall DJ. Science, medicine, and the future. Single gene 6. disorders or complex traits: lessons from the thalassaemias and other monogenic diseases. BMJ (Clinical Research Ed.), 2000, 321:1117–1120. Oliveira TM et al. HFE gene mutations in Brazilian thalassemic 7. patients. Brazilian Journal of Medical and Biological Research, 2006, 39:1575–1580. Cançado RD et al. Analysis of 8. HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload. Sao Paulo Medi- cal Journal, 2006, 124:55–60. Jazayeri M et al. Frequency of HFE gene mutations in Iranian 9. beta-thalassaemia minor patients. European Journal of Haema- tology, 2003, 71:408–411. Brissot P et al. Clinical aspects of hemochromatosis. 10. Transfu- sion Science, 2000, 23:193–200. Candore G et al. Frequency of the HFE gene mutations in five 11. Italian populations. Blood Cells, Molecules & Diseases, 2002, 29:267–273. Bomford A. Genetics of haemochromatosis. 12. Lancet, 2002, 360:1673–1681. Mura C, Raguenes O, Férec C. HFE mutations analysis in 711 13. hemochromatosis probands: evidence for S65C implication in mild form of hemochromatosis. Blood, 1999, 93:2502–2505. Ǻ14. sberg A et al. Hereditary hemochromatosis: the clinical signif- icance of the S65C mutation. Genetic Testing, 2002, 6:59–62. Agostinho MF et al. Mutation analysis of the HFE gene in Bra-15. zilian populations. Blood Cells, Molecules & Diseases, 1999, 25:324–327. Wick M, Pinggera W, Lehmann P. 16. Iron metabolism, anemias, diagnosis and therapy, 4th ed. New York, Springer, Berlin Hei- delberg, 2000. Miller SA, Dykes DD, Polesky HF. A simple salting out proce-17. dure for extracting DNA from human nucleated cells. Nucleic Acids Research, 1988, 16:1215. Panigrahi I et al. Evidence for non-HFE linked hemochroma-18. tosis in Asian Indians. Indian Journal of Medical Sciences, 2006, 60:491–495. Roth M et al. Absence of the hemochromatosis gene 19. Cys282Tyr mutation in three ethnic groups from Algeria (Mzab), Ethiopia, and Senegal. Immunogenetics, 1997, 46: 222–225. Settin A et al. C282Y and H63D hemochromatosis alleles in 20. Egyptian patients with cirrhosis. Arab Journal of Gastroenterol- ogy, 2006, 7:59–63. Pietrangelo A. Hereditary hemochromatosis–a new look 21. at an old disease. New England Journal of Medicine, 2004, 350:2383–2397. Moirand R et al. Clinical features of genetic hemochromatosis 22. in women compared with men. Annals of Internal Medicine, 1997, 127:105–110. Cicilano M et al. Recurrent mutations in the iron regulatory 23. element of L-ferritin in hereditary hyperferritinemia-cataract syndrome. Hematologica, 1999, The HINARI Access to Research in Health Programme HINARI Programme set up by WHO together with major publishers, enables developing countries to gain access to one of the world's largest collections of biomedical and health literature, including full-text journals and databases. More than 7,500 information resources (in 30 different languages) are now available to health institutions in 105 countries,  areas and territories benefiting many thousands of health workers and researchers, and in turn, contributing to improve world health. More information on eligibility, registration, etc. is available on the HINARI homepage at: http://www. who.int/hinari/en/index.html. Book 17-6.indb 551 6/6/2011 9:45:06 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 552 Report Social consequences of infected haemophilia cases in the Islamic Republic of Iran A.M. Cheraghali,1,2 P. Eshghi 1,3 and H. Abolghasemi 1,2 ABSTRACT The unintentional contamination of haemophilia patients with HIV in the early 1980s raised serious questions about the safety of blood product supplies worldwide. The events initiated a cascade of consequences for both infected patients and the national health systems of many countries, including the Islamic Republic of Iran. Lawsuits have been filed in the courts mostly in developed countries, leading to the establishment of some kind of reimbursement programme for haemophilia patients who acquired viral infections. In the late 1990s the courts ordered the Iranian Ministry of Health, in addition to providing free care with the latest treatments, to pay compensation to the haemophilia patients. The adverse consequences of these events on the equitable distribution of resources in the Iranian health care system are discussed in this paper. 1Iranian Blood Transfusion Organization Research Centre, Tehran, Islamic Republic of Iran (Correspondence to A.M. Cheraghali: Cheraghali @ibto.ir). 2Faculty of Medicine, Baqiyatallah University of Medical Sciences, Tehran, Islamic Republic of Iran. 3Mofid Hospital, Shaheed Beheshti University of Medical Sciences, Tehran, Islamic Republic of Iran. Received: 16/11/09; accepted: 22/12/09 ةيملاسلإا ناريإ ةيروهجم في روعانلا ضىرم ينب ىودعلا تلاالح ةيعماتجلاا بقاوعلا يمساقلا وبأ نسح ،يقشع نمايب ،ليعغارج ديجلما دبع ةيرطخ تلاؤاست ،مصرنلما نرقلا نم تانينماثلا ةيادب في يشربلا يعانلما زوعلا سويرفب روعانلا ضىرم ىدل دوصقلما يرغ مدلا ثولت راثأ :ةصلالخا ،ىودعلاب ينباصلما ضىرلما نم ٍّلك ىدل بقاوعلا نم ةلسلس لىإ ثادحلأا هذه ْت َّدأ ْذإ ؛لماعلا ءاحنأ في مدلا تاجتنم نم تادادملإا ةملاس لوح لىإ ىدأ امم ةمدقتلما نادلبلا في مكاحلما مامأ ىواعدلا تعفُر دقو .ةيملاسلإا ناريإ ةيروهجم اهنمو ،نادلبلا نم ديدعلا في ةينطولا ةيحصلا مظنلا ىدلو ضيقي ًماكح مكاحلما تردصأ ،تانيعستلا ةيانه فيو .يشربلا يعانلما زوعلا سويرف ىودعب اوبيصأ نيذلا روعانلاب ينباصلما ضيوعتل جمانرب ءاشنإ شقانتو .زديلإاب نيدَعْنُلما روعانلا ضىرلم تاضيوعت عفدبو ،تالجاعلما ثدحأب ةيناجلما ةياعرلا ميدقتب ةيملاسلإا ناريإ ةيروهجم في ةحصلا ةرازو لىع .ةيملاسلإا ناريإ ةيروهجم في ةيحصلا ةياعرلا ماظن في دراوملل لداعلا عيزوتلا لىع ثادحلأا هذله ةرئاضلا بقاوعلا ةقرولا هذه Conséquences sociales de la contamination des patients hémophiles en République islamique d’Iran RÉSUMÉ La contamination non intentionnelle des patients hémophiles par le VIH au début des années 1980 a soulevé de graves questions relatives à la sécurité des approvisionnements en produits sanguins dans le monde. Les événements ont déclenché des conséquences en chaîne, à la fois pour les patients infectés et pour le système de santé national de nombreux pays, notamment la République islamique d’Iran. Des procès ont été intentés principalement dans les pays développés, conduisant à l’établissement d’une sorte de programme d’indemnisation pour les patients hémophiles ayant contracté des infections virales. À la fin des années 1990, la justice a condamné le Ministère de la santé iranien à verser des indemnités aux patients hémophiles, en plus de la fourniture de soins gratuits incluant les traitements les plus récents. Les conséquences négatives de ces événements sur la distribution équitable des ressources du système de santé iranien sont détaillées dans le présent article. Book 17-6.indb 552 6/6/2011 9:45:06 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 553 Introduction Despite a long history of attempts to treat patients using human or animal blood products, modern transfusion medicine only started in the second half of the last century. With the increas- ing use of these new interventions, it rapidly became clear that these thera- peutic approaches also had side-effects such as the incompatibility of red blood cells and plasma between donor and recipient and the risk of transmission of bloodborne pathogens to the recipient. Current strategies implemented by transfusion services in countries with up-to-date health care systems have significantly reduced the possibility of transfusion-transmitted infections. These include recruiting voluntary non-remunerated donors, donor ex- clusion criteria, specific and sensitive screening tests, implementing good manufacturing practices in blood handling establishments and in some cases pathogen reduction procedures. While such measures have not been able to completely eliminate all risks of transfusion-transmitted infections from known and, more importantly, emerg- ing pathogens the estimated risk for viral transmission especially in developed countries has been significantly reduced [1]. Unfortunately, due to lack of access  in low-resource countries to most of the sensitive and specific screening tests, the safety of blood products in these countries is still a major concern. In some developing countries paid and/ or replacement donors are the main pool of donors and substantial numbers of donations in these countries remain unscreened for viral markers [2,3]. The possibility of transmission of pathogens via blood transfusion had been known since the catastrophic events  of  the  early  1980s,  when  it  emerged that there had been accidental infection of haemophilia patients with human immunodeficiency virus (HIV). This experience began to raise ques- tions about the safety of blood products worldwide and initiated a cascade of consequences for both infected patients and for national health systems in many countries. The Islamic Republic of Iran was no an exception. Since the early 1980s all transfusion  services in the country have been con- centrated under a single organization, the Iranian Blood Transfusion Organi- zation (IBTO), which is an integral part of the Iranian national health system. In order to meet the country’s blood demands  in 2008,  the  IBTO collected  more than 1.8 million units of blood from 100% voluntary  and non-remu- nerated donors. This indicates a blood donation index of 25 per 1000 popula- tion. The IBTO has been successful in improving the national blood safety profile. Screening of blood donations for hepatitis B surface antigen (HBsAg) became mandatory in 1974. Screening of blood units for HIV and hepatitis C virus (HCV) started in 1989 and 1996 respectively. Anti-HIV 1/2  antibody  testing was changed to HIV antigen/ antibody combination  in 2005.  Imple- mentation of a highly efficient donor selection programme, including donor interviews, establishment of a confi- dential unit exclusion programme and laboratory screening of donated bloods by the IBTO, have led to seroprevalence rates of 0.41%, 0.12%, and 0.004%  for  hepatitis B virus (HBV), HCV and HIV respectively in donated blood [4,5]. Although the tragedy of infection of Iranian haemophilia patients ignited ac- tions which resulted in improvements to the national transfusion services, it has had grave social and economic con- sequences for the Iranian health care sector, as discussed in this paper. Historical background Following reports of accidental HIV in- fection of haemophilia patients in 1982  and other evidence indicating the risk of spread of HBV and HCV infection through contaminated blood products, the blood transfusion services and in- dustries manufacturing plasma-derived medicines underwent major changes worldwide. Cases of haemophiliacs infected with HIV following administration of contaminated clotting factors led to a number of lawsuits being filed in the courts, mostly in developed countries, against both pharmaceutical companies producing such products and health officials. Such litigation in the 1990s led  to the establishment of some kind of reimbursement programme in about 20 countries  for haemophilia patients  who acquired viral (mainly HIV) in- fections from tainted blood products supplied in the 1980s. However, despite  the attention paid to the consequences of HIV contamination in haemophilia patients, accidental HCV contamina- tion of transfused patients has received relatively little attention. In most of these countries criminal judicial investigations against government and private industry officials were also held. The results of such lawsuits have been discussed previ- ously [6,7]. Compensation has also been  paid to the infected patients or surviving family members of deceased patients for accidental HIV infection in about 28  countries  and  for HCV  infection  in 10 countries  [8]. To be eligible  for  financial compensation, litigants usually renounce their civil rights to any future action against government bodies [6]. In  the early 1980s  the  Islamic Re- public of Iran imported most of the clotting factors used in the country from Institut Mérieux, a French pharmaceuti- cal company which is now part of Sa- nofi-Aventis. Similar products were also sold by the company to other countries in the region, including Iraq. It has been reported that Iraqi officials are now ne- gotiating with the Mérieux and Immuno companies to settle a compensation for Iraqi haemophiliacs who contracted HIV from tainted products distributed by  the company  in  Iraq between 1982  and 1986  [9].  In  the  Islamic Repub- lic of  Iran  in  the early 1990s a  lawsuit  Book 17-6.indb 553 6/6/2011 9:45:06 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 554 was filed by a group of haemophilia patients against some of the Iranian of- ficials both in the IBTO and Ministry of Health (MOH), alleging negligence in the screening of blood and blood products. The court later convicted the MOH, requiring them to provide free treatment for patients and also to pay compensation. Although the former head of the IBTO and 3 others officials were also convicted by the court, they have never been indicted. The Islamic Republic of Iran may be the only devel- oping country faced with such a verdict, and it has led to grave consequences for the national transfusion system and public health sector. Financial consequences The Islamic Republic of Iran is a devel- oping country with limited resources available in its health sector. Total per capita expenditure on health in the country  is  about  $US  700  [10]  and  this budget is supposed to provide health services for a population of over 70 million with  a  high prevalence of  communicable and noncommunicable diseases  including  “rare” diseases  that  only affect a small proportion of the population. Treatment for rare diseases is very expensive and usually takes an unfair slice of the financial resources available in any health care sector. Therefore, in view of national economic constraints and the high rate of seri- ous health problems such as infectious diseases and malnutrition that affect much of the population in developing countries, diseases such as haemophilia are not given priority [11]. Currently  there  are  about  7000  haemophilia patients in the Islamic Republic of  Iran [12]. Despite  limited  resources available in the health sector, Iranian haemophiliacs had access to commercial concentrated coagulation factors shortly after the introduction of these medicines. Due to governmental support, these medicines have always been free of charge. Since the Islamic Republic of Iran did not have a local plasma fractionation facility, except for a very short period in the early 1990s, the  country has to rely on imported clotting factors. Therefore the Iranian national health care system has to spend a con- siderable portion of its limited resources to finance these medicines. Average per capita consumption of factor VIII clot- ting factor is rising in the country and is now about 1.8 IU [5]. Accidental viral contamination among haemophilia patients around the world has attracted considerable attention to the issue of safety of blood and blood products. Published reports confirm that up to 60% of haemophilia  patients in the developed world con- tracted HIV through administration of  contaminated blood products  [6].  However, despite drastic responses to the spread of HIV infection among hae- mophiliacs and a very high incidence of HCV infection among people with haemophilia, which is reported to be up to 90% [7], national responses to HCV  contamination of blood supply were fairly mute. In contrast to the exam- ple of HIV, no public health official or manager of blood fractionation facilities in the world has been found guilty of criminal charges for HCV contamina- tion of  the blood supply  in  the 1980s.  The factors that influenced the different responses of policy-makers to these twin epidemics have been discussed previ- ously [7]. It  is argued that the financial  consequences for health care are serious if compensation is paid whenever a pa- tient has been treated properly but may later  suffer  from side-effects  [13]. This  perhaps has been one the rationales for not convicting officials for decisions related to HCV contamination of the blood supply. Although there are no published data about the national prevalence of vi- ral markers in multi-transfused patients, including haemophilia and thalassae- mia patients, in the Islamic Republic of Iran, the reported data indicates a lower prevalence of these markers in Iranian patients compared with other countries. The prevalence of HIV in Iranian haemophiliacs is reported to be  0.76%–2.3%  [14,15].  According  to a World Federation of Hemophilia report, while 3.6% of  Iranian haemo- philiacs contracted HIV, the prevalence of HCV among these patients is about 41% [8]. Despite  the  relatively  low  in- cidence of HIV and HCV infection in Iranian haemophilia patients compared with those living in developed countries, since  the  1990s  about  3000 haemo- philia patients (42%) have filed lawsuits  against the Iranian national health care system claiming compensation for HIV and HCV infection. According to the published data the average amount of compensation awarded to infected patients in coun- tries with developed economies ranges from US$ 37 000  to US$ 400 000  for  HIV-infected haemophiliacs and from US$ 36 000  to US$ 50 000  for HCV- infected haemophiliacs [7]. Compensa- tion paid to patients is usually funded through a joint fund established by the government and pharmaceutical com- panies involved in manufacturing the blood products. On average the value of compensation paid to each patient in developed economies  is  about 1–2  and 2–14 times the gross national prod- uct (GDP) per capita for HCV and HIV respectively. However, this figure was more  than 10  times GDP  in  the  Islamic Republic of Iran. Comparison between the ratio of compensation and’ per capita GDP for the Islamic Republic of Iran and some developed countries is illustrated in Figure 1 [6,16]. Up to now  the courts have ordered the Iranian na- tional health care sector to provide full treatment free of charge for haemophilia patients with HIV or HCV and also to pay compensation equal to US$ 31 million  to about 1120 patients. About  2000 plaintiffs are still waiting to receive  court orders for possible compensation. Although confirmation of the source of contamination in Iranian patients has Book 17-6.indb 554 6/6/2011 9:45:06 AM طسوتلما قشرل ةيحصلا ةلجلماشرع عباسلا دلجلما سداسلا ددعلا 555 never been the concern of the courts, recent publication on the genotype of HIV of Iranian haemophilia patients has raised questions about the source of contamination in these patients and its correlation to blood products produced in the country. The results of studies conducted by the Pasteur Institute of the Islamic Republic of Iran indicated that Iranian hemophilia patients are affected by HIV type B, whereas the HIV patients in the general population of the country are affected by type A virus. Therefore, it may be concluded the HIV affected hemophiliacs in the Islamic Republic of Iran were infected by imported clotting factors [17]. Unfortunately the Iranian MOH has used the national health care budget to pay compensation to the patients. According to the court order, the MOH has to use the most recently available medicines for treatment of haemophilia patients with HIV and/or HCV, re- gardless of their cost–effectiveness. For  example, despite the proven efficacy of conventional interferon to treat HCV infection, the Iranian MOH is cur- rently using a very expensive pegylated interferon preparation, at no cost to the patients. It is expected that implement- ing costly but not highly cost–effective  procedures or policies in countries with limited resources may result in con- straints in other areas of health care and loss of previously realized benefits to a greater number of the population. This might ultimately compromise the golden  role  of  “bringing  the  greatest  good to the greatest number”, at least in  the field of haemophilia. The court verdict against the Iranian MOH and IBTO has also compromised people’s trust in the national transfusion services. Blood transfusion, as one of the most effective medical interventions, is a unique technology that blends science with altruism. Though the collection, processing and use of blood are tech- nical, its availability depends entirely on the extraordinary generosity of the blood donor who donates the gift of life. Safe transfusion not only requires the application of science and technol- ogy to blood processing and testing but also social mobilization to promote voluntary blood donation  [3]. There- fore any inappropriate reactions to such activities will reduce volunteers’ trust in the national transfusion organiza- tions and the provision of the necessary services to countless patients in need of blood and blood components. Comment Viral contamination of Iranian haemo- philia patients through administration of tainted blood products in the 1990s had  grave consequences both for the patients and the Iranian national health care system. On the national health care sec- tor side, the MOH has to pay compensa- tion from the national health budget. Obviously this has reduced the per capita share of the budget for all patient groups, including haemophiliacs. Shortage of available resources for investment into some important treatment interventions, such as immune tolerance induction, secondary and target joint prophylaxis and orthopaedic reconstruction surgery, could compromise patients’ quality of life. Shifting the national health care budget toward a specific patient group 10.0 1.4 4.5 1.5 6.9 8.0 10.7 0.0 1.6 0.0 1.0 0.0 2.8 10.7 0 2 4 6 8 10 12 Japan Ireland USA UK France Canada Islamic Republic of Iran R at io o f c o m p en sa ti o n /G D P HIV HCV Country Figure 1 Ratios of compensations paid to haemophilia patients accidentally infected with HIV and/or HCV through contaminated blood products and per capita gross domestic product (GDP) for the Islamic Republic of Iran and some developed countries Book 17-6.indb 555 6/6/2011 9:45:07 AM EMHJ  •  Vol. 17  No. 6  •  2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 556 may also compromise national health equity and ultimately skew the equity distribution curve. Provision of the most expensive medicines and therapies for haemophiliacs in the Islamic Republic of Iran both for treatment of their blood disorder and for viral contamination has increased the share of the national health care budget of these patients to more than 23-fold that of other patients.  This might contradict the moral point of view that no community member can claim that his/her interests be advanced to a greater degree than those of any other community member. It is argued that investing substantial amounts of resources for rare conditions does not optimize the benefit to society [18]. In countries with limited resources available to the health care sector, a strategy of lower cost treatment and a holistic approach to patient care with cost–effective utilization of  limited  re- sources provides a viable standard of care, especially in the expensive field of haemophilia treatment. The Iranian MOH now spends its limited resources on  less cost–effective  interventions  for  haemophiliacs in order to avoid further confrontation with the courts. The court order against the MOH in the mid- 1990s  led  to  the  closure  of  the  only  national plasma fractionation facility present in the country, which now relies on importation of the expensive coagu- lating factors to meet patients’ needs. This has obviously put new constraints on the limited resources available in the Iranian national health care sector. Currently the Iranian MOH has to support treatment of all AIDS patients regardless of the cause of the infection. These patients receive all care, including anti-retroviral treatment, free of charge. Therefore the system is also committed to treatment of HIV-infected haemo- philia patients. Unfortunately today hae- mophilia in the Islamic Republic of Iran is flagged as a problematic and challenging area which most of the time will termi- nate in a lawsuit. Therefore, few physi- cians even dare to provide care for these patients. It seems that some of the patient groups in the country, instead of focusing on interventions to improve the quality of life of haemophilia patients, mainly concentrate on filing lawsuits against national health officials. This has caused a lifelong fear of transfusion-transmitted infections regardless of the real risk in comparison with other problems and complications of caring for haemophilia patients. That is why currently more that 45% of haemophiliacs in the country are  in the courts as plaintiffs. Unfortunately this has caused a stand-off between the haemophiliacs and the national health care system, which is supposed to be the main caregiver to these patients. There is no doubt that patients, and their qual- ity of life, will be the main losers of such struggle. Recent published reports indicate that legal interventions and verdicts have not contributed to patients’ qual- ity of life, and in fact the quality of life of Iranian haemophiliacs has been compromised  [19–21]. Meanwhile,  interventions such as immune toler- ance induction, secondary and target joint prophylaxis and orthopaedic re- construction surgery have been totally ignored by both patient groups and the national health system. References Bihl F et al. Transfusion-transmitted infections. 1. Journal of Trans- lational Medicine, 2007, 5:25. Gabriel AS et al. Safety of blood supply for infectious diseases 2. in Latin American countries, 1994–1997. American Journal of Tropcial Medicine and Hygiene, 2001, 65:924–930. Universal access to safe blood transfusion3. ., Geneva, World Health Organization, 2008 (WHO/EHT/08.03). Abolghasemi H et al. Introduction to Iranian Blood Transfusion 4. Organization and blood safety in Iran. Iranian Journal of Public Health, 2009, 38(Suppl. 1):82–87. Cheraghali AM. Availability of blood components and plasma 5. derived medicines in Iran. Transfusion and Apheresis Science, 2007, 37:3–7. Weinberg PD et al. Legal, financial, and public health conse-6. quences of HIV contamination of blood and blood products in the 1980s and 1990s. Annals of Internal Medicine, 2002, 136:312–319. Angelotta C et al. Legal, financial, and public health conse-7. quences of transfusion-transmitted hepatitis C virus in persons with haemophilia. Vox Sanguinis, 2007, 93:159–165. Report on the annual global survey 20048. . Montreal, World Fed- eration of Hemophilia, 2005, Zelbauer P. Iraqis infected by HIV tainted blood try new tool: 9. a lawsuit. New York Times, September 2006. World health statistics 2008: Iran (Islamic Republic of).10. World Health Organization [website] (http://www.who.int/coun- tries/irn/en/, accessed 27 April 2011). DiMichele D et al. Ethical issues in haemophilia. 11. Haemophilia, 2006, 12(Suppl. 3):30–35. Mehdizadeh M et al. Occurrence of haemophilia in Iran. 12. Hae- mophilia, 2009, 15:348–351. Dyer C. Justice versus equity for haemophiliacs with AIDS. 13. Brit- ish Medical Journal, 1990, 301:776. Rezvan H, Abolghassemi H, Kafiabad SA. Transfusion-transmit-14. ted infections among multitransfused patients in Iran: a review. Transfusion Medicine (Oxford, England), 2007, 17:425–433. Sharifi-Mood B et al. Hepatitis B and C virus infections in pa-15. tients with hemophilia in Zahedan, southeast Iran. Saudi Medi- cal Journal, 2007, 28:1516–1519. World statistics. 16. NationMaster [website] (www. nationmaster. com, accessed 27 April 2011). Sarrami-Forooshani R et al. Molecular analysis and phyloge-17. netic characterization of HIV in Iran. Journal of Medical Virol- ogy, 2006, 78:853–863. doi:10.1002/jmv.20634. Hughes18. DA, Tunnage B, Yeo ST. Drugs for exceptionally rare disease: do they deserve special status for funding? Quarterly Journal of Medicine, 2005, 98:829–836. Karimi19. M et al. Health status in Iranian haemophilic patients. Haemophilia, 2008, 14:615–617. Hoorfar20. H, Mobaraky G. Quality of life in severe hemophilia in Esfahan. Haemophilia, 2006, 12(Suppl. 2):122 [abstract]. Karimi21. M et al. Substance dependency in Iranian patients with hemophilia. Addictive Behaviors, 2007, 32:365–369. Book 17-6.indb 556 6/6/2011 9:45:07 AM طسوتلما قشرل ةيلماعلا ةحصلا ةمظنلم ةيميلقلإا ةنجللا ءاضعأ نادلبلا ةيملاسلإا ناريإ ةيروهجم . ةيبيللا ةيبرعلا ةييرهمالجا . سنوت . نيرحبلا . ناتسكاب . ةدحتلما ةيبرعلا تاراملإا . ناتسناغفأ . ندرلأا صرم . نانبل . تيوكلا . رطق . ينطسلف . نماُع . قارعلا . لاموصلا . نادوسلا . تيوبيج . ةينميلا ةيروهملجا . ةيروسلا ةيبرعلا ةيروهملجا ةيدوعسلا ةيبرعلا ةكلملما . برغلما Subscriptions and Distribution Enquiries regarding subscriptions and distribution of the print edition of EMHJ should be addressed to: Printing and Marketing of Publications at: email: pam@emro.who.int; tel: (+202) 2276 5000; fax: (+202) 2670 2492 or 2670 2494 Permissions Requests for permission to reproduce or translate articles, whether for sale or non-commercial distribution should be addressed to EMHJ at: emhj@emro.who.int Members of the WHO Regional Committee for the Eastern Mediterranean Afghanistan . Bahrain . Djibouti . Egypt . Islamic Republic of Iran . Iraq . Jordan . Kuwait . Lebanon Libyan Arab Jamahiriya . Morocco . Oman . Pakistan . Palestine . Qatar . Saudi Arabia . Somalia Sudan . Syrian Arab Republic . Tunisia . United Arab Emirates . Republic of Yemen Membres du Comité régional de l’OMS pour la Méditerranée orientale Afghanistan . Arabie saoudite . Bahreïn . Djibouti . Égypte . Émirats arabes unis . République islamique d’Iran Iraq . Jamahiriya arabe libyenne . Jordanie . Koweït . Liban . Maroc . Oman . Pakistan . Palestine . Qatar République arabe syrienne . Somalie . Soudan . Tunisie . République du Yémen Correspondence Editor-in-chief EMHJ WHO Regional Office for the Eastern Mediterranean P.O. Box 7608 Nasr City, Cairo 11371 Egypt Tel: (+202) 2276 5000 Fax: (+202) 2670 2492/(+202) 2670 2494 Email: khayat@emro.who.int/emhj@emro.who.int EASTERN MEDITERRANEAN HEALTH JOURNAL IS the official health journal published by the Eastern Mediterranean Regional Office of the World Health Organization. It is a forum for the presentation and promotion of new policies and initiatives in health services; and for the exchange of ideas, con‑ cepts, epidemiological data, research findings and other information, with special reference to the Eastern Mediterranean Region. It addresses all members of the health profession, medical and other health educational institutes, interested NGOs, WHO Col‑ laborating Centres and individuals within and outside the Region. LA REVUE DE SANTÉ DE LA MÉDITERRANÉE ORIENTALE EST une revue de santé officielle publiée par le Bureau régional de l’Organisation mondiale de la Santé pour la Méditerranée orientale. Elle offre une tribune pour la présentation et la promotion de nouvelles politiques et initiatives dans le domaine des ser‑vices de santé ainsi qu’à l’échange d’idées, de concepts, de données épidémiologiques, de résultats de recherches et d’autres informations, se rapportant plus particulièrement à la Région de la Méditerranée orientale. Elle s’adresse à tous les professionnels de la santé, aux membres des instituts médicaux et autres instituts de formation médico‑sanitaire, aux ONG, Centres collabora‑ teurs de l’OMS et personnes concernés au sein et hors de la Région. EMHJ is a trilingual, peer reviewed, open access journal and the full contents are freely available at its website: http://www/emro.who.int/emhj.htm EMHJ is abstracted/indexed in the Index Medicus and MEDLINE (Medical Literature Analysis and Retrieval Systems on Line) and the ExtraMed‑Full text on CD‑ROM, the Cumulative Index to Nursing and Allied Health Literature (CINAHL), CAB International, Lexis Nexis, Scopus and the Index Medicus for the WHO Eastern Mediterranean Region (IMEMR). ©World Health Organization 2011 All rights reserved Disclaimer The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned. All reasonable precautions have been taken by the World Health Organization to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either express or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall the World Health Organization be liable for damages arising from its use. The named authors alone are responsible for the views expressed in this publication. ISSN 1020‑3397 Cover designed by Diana Tawadros Internal layout designed by Emad Marji and Diana Tawadros Printed by WHO Regional Office for the Eastern Mediterranean ميدقتل برنم ىهو .ةيلماعلا ةحصلا ةمظنمب طسوتلما قشرل ىميلقلإا بتكلما نع ردصت ىتلا ةيمسرلا ةلجلما ىه ةيئابولا تايطعلماو ميهافلماو ءارلآا لدابتلو ،اله جيوترلاو ةيحصلا تامدلخا فى ةديدلجا تاردابلماو تاسايسلا لك لىإ ةهجوم ىهو .طسوتلما قشر ميلقإب اهنم قلعتي ام ةصاخو ،تامولعلما نم كلذ يرغو ثاحبلأا جئاتنو زكارلماو ،ةينعلما ةيموكلحا يرغ تماظنلما اذكو ،ةيميلعتلا دهاعلما رئاسو ةيبطلا تايلكلاو ،ةيحصلا نهلما ءاضعأ .هجراخو ميلقلإا فى ةحصلاب ينمتهلما دارفلأاو ةيلماعلا ةحصلا ةمظنم عم ةنواعتلما طسوتلما قشرل ةيحصلا ةلجلما Cover 17-8.indd 2 8/8/2011 10:11:18 AM Contents V olum e 17 N um ber 6 June 2011 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale Volume 17 / No. 6 June / Juin 2011 6 ددع / شرع عباسلا دلجلما وينوي / ناريزح Letter from the Editor ........................................................................................................................................................467 Research articles Climate change and predicted trend of fungal keratitis in Egypt ............................................................................468 Hepatitis B virus infection among staff in three hospitals in Khartoum, Sudan, 2006–07 ....................................474 Rising bacterial resistance to common antibiotics in Al Ain, United Arab Emirates ..............................................479 Epidemiological profile of health-care-associated infections in the central-east area of Tunisia .........................485 Assessment of liver function among nickel-plating workers in Egypt .....................................................................490 Acute kidney injury after cardiac surgery in eastern Saudi Arabia ..........................................................................495 Effect of nutritional intervention on the prevalence of metabolic syndrome and heart disease risk factors in urban Tehran (Tehran Lipid and Glucose Study) ...............................................................................501 Factors associated with breast self-examination among Malaysian women teachers ...........................................509 Evaluating success of no-scalpel vasectomy by ligation and excision with fascial interposition in a large prospective study in Islamic Republic of Iran ..........................................................................................................517 Prevalence and predictors of smoking among adolescent schoolchildren in Monastir, Tunisia ..........................523 Sociocultural contexts of attempting suicide among Iranian youth: a qualitative study .......................................529 Public attitude towards biomedical research at outpatient clinics of King Abdulaziz medical city, Riyadh, Saudi Arabia..................................................................................................................................................536 Role of HFE gene mutations on developing iron overload in β-thalassaemia carriers in Egypt ............................546 Report Social consequences of infected haemophilia cases in the Islamic Republic of Iran ...........................................552 Donors and transfusion service staff at WHO annual blood drive Adequate stocks of safe blood can only be assured by regular donation by voluntary unpaid donors because the prevalence of bloodborne infections is lowest among these donors. Periodic blood drives in workplaces can increase the number of donors Cover 17-6.indd 1 6/5/2011 12:11:51 PM

Основные сведения
Тип документа Journal articles
Дата принятия
Источник Всемирная организация здравоохранения