Expression, Purification of DENV-2 Nonstructural Protein 3 (NS3) and Production of the Polyclonal Antibody for NS3 Yanping Tiana, Junlei Zhanga, Zongtao Chena, Tao Penga, Xiaofeng Xua, Wen Jianga and Jing Anb a b
Department of Microbiology, The Third Military Medical University, Chongqing 400038, PR China
Department of Microbiology, School of Basic Medical Sciences, Capital University of Medical Sciences, Beijing 100069, PR China
Abstract Dengue virus type 2 (DENV-2) NS3, a multifunctional protein, has a serine protease domain that requires the conserved hydrophilic domain of NS2B for protease activity in cleavage of the polyprotein precursor and a RNA helicases/NTPases domain, which plays an important role in RNA replication. It is also an important target for human T cells and is able to elicit specific antibodies. In this study, it is reported that the plasmid of pQE-NS3 was constructed; and NS3 precursor was expressed in Escherichia coli as a fusion protein with a histidine tag at the N terminus. The precursor was purified from insoluble inclusion bodies by Ni2+-affinity chromatography under denaturing conditions. The denatured precursor was refolded to yield a purified protein. The recombined NS3 protein showed strong immunogenicity. Antiserum with high level of specific antibodies for NS3 was obtained when rabbits were immunized with this purified protein. Indirect immunofluorescence staining analysis demonstrated that this antibody could recognize native NS3 protein. The results suggested that these antibodies might be a useful tool, not only to study the replicative process of DENV but also to generate specific diagnostic tools for DENV infection. Keywords: Dengue virus, nonstructural protein 3, polyclonal antibody.
Introduction Dengue virus (DENV), belonging to the family of Flaviviridae, is one of the most widespread mosquito-borne human pathogens worldwide. About 40% of the world population living in tropical and subtropical regions is at risk of infection, an estimated 2.5 billion people are threatened by DENV infection.[1] Infection with DENV may be asymptomatic or may cause a variety of symptoms ranging from mild dengue fever (DF) to the more severe form of dengue haemorrhagic fever or dengue shock syndrome anjing60@yahoo.com.cn 146
(DHF/ DSS). These diseases have emerged as significant threats to human health in affected areas. There are four serotypes of DENV (DENV1 to DENV-4). They contain a positive-strand genomic RNA consisting of one single openreading frame (ORF) (10173 nucleotides in length for DENV-2 New Guinea C strain).[2] The genomic RNA encodes a single polyprotein precursor, NH2-C-prM-E-NS1-NS2A-NS2B-NS3NS4A-NS4B-NS5-COOH, which is post- and co-translationally cleaved by both host and viral
Dengue Bulletin – Volume 30, 2006
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
proteases to yield mature proteins. The polyprotein precursor is processed to yield three structural proteins (C, prM, and E) that are assembled into the virion and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5), which are expressed in infected cells.[3,4] DENV-2 NS3 is a multifunctional protein of approximately 69 kDa involved in polyprotein processing, RNA replication and capping of the viral genomic RNA. NS3 serine protease domain is contained within the Nterminal 180 amino acids and requires the protein NS2B for protease activity.[4,5] The conserved hydrophilic domain of NS2B alone is sufficient for activation of the protease domain of NS3.[5] The C-terminal region of NS3 contains RNA helicases/NTPases. It is demonstrated that both DENV-2 NS3 and NS5 are capable of converting the replicative form RNA (RF) to replicative intermediate (RI). The NS3 is acting as a helicase unwinding doublestranded RF to partially single-stranded RI.[6] RNA helicase activity of NS3 has also been demonstrated for Japanese encephalitis virus, Langat virus, hepatitis C virus and pestivirus proteins.[7-10] DENV-2 NS3 is also an important target for human T cells and able to elicit specific antibodies. The NS3 protein appears to be a dominant target for DENV-specific CD4+ and CD8+ T cells, and most DENV NS3-specific T cells are serotype cross-reactive. The abundance of T cell epitopes on the flavivirus NS3 protein is not well explained, although multiple human T cell epitopes on the NS3 protein have been identified.[11,12] The NS3 protein is also able to elicit specific antibodies. It is reported that monoclonal antibodies to NS3 of DENV-1 are able to increase the survival time of mice challenged with a lethal dose of DENV-1, although the mechanism remains to be defined.[13] In DENV-2 infections, the presence of NS3 antibodies in acute phase samples from Dengue Bulletin – Volume 30, 2006
primary and secondary cases was reported.[14] It suggests the possibility of implementing ancillary diagnostic assays with higher sensitivity for NS3 antigen detection in some DF and DHF/ DSS cases. To further investigate the role of NS3 protein in pathogenesis of DENV infections and develop a new diagnostic assay with NS3 antigen detection, in this study we reported the cloning, expressing of DENV-2 NS3 protein, and purifying under denaturing condition. Rabbits were immunized with the NS3 protein and then polyclonal antibodies (PAbs) were generated. Our results showed that the production of PAbs were specific to NS3 protein of DENV-2 and could recognize native NS3 protein in infected ECV304 cells, suggesting that these antibodies might be a useful tool, not only to study the replicative process of DENV but also to generate specific diagnostic tools for DENV infection.
Materials and methods Cell lines, virus and other reagents Aedes albopictus mosquito cells (C6/36) were grown at 28 °C in Dulbecco’s modified Eagle’s minimum essential medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS). ECV304 cells (European Collection of Cell Culture) were cultured at 37 °C in DMEM and used for immunofluorescence staining. DENV2 (strain TR1751) isolated from a patient with DF was kindly provided by Dr Oya A (National Institute of Infectious Disease, Japan) and was propagated in C6/36 cells. T-vector pMD19-T and T4 ligase were purchased from Takara Ltd. (Dalian, China). Restriction enzymes were purchased from MBI (Lithuania). The plasmid pQE-31 and Ni2+-nitrilotriacetic acid (NTA)agarose resin were purchased from Qiagen (Chatworth, CA).
147
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
Table: Primers used for RT-PCR amplification and cloning of DENV NS3 Gene (RT) NS3 NS3 Name DEN (−) P1 (+) P2 (−) Sequence (5’–3’) CTCCCGCTCATCAAGAATAA cgggatccgGCTGGAGTATTGTGGGACG cccaagcttctaTTTCTTCCGGCTGCGA Location 6583-6602 4522-4540 6359-6375
The primer used for reverse transcription (RT) is also listed. Sense and anti-sense primers are denoted as (+) and (–), respectively. Underlined letters indicate engineered restriction sites. Positions of primers correspond to the published sequences of DENV-2 (GenBank accession numbers M84728).
Construction of 6×His-NS3 expression plasmid Viral RNA was isolated from DENV-infected C6/36 cells using Biozol reagent (Bioflux, Japan) and reverse transcribed to cDNA using primer DEN (-) and AMV reverse transcriptase (Bioflux). Primers for amplification and cloning of DENV genes are listed in the Table. With the primers of P1 (+) and P2 (–), coding gene of protein NS3 was amplified from DENV cDNA template. In this pair of primer, a restriction enzyme site, BamHI (G*GATCC), was added to the 5’-terminal of P1 (+); HindIII (A*AGCTT) and stop codon (CTA) were added to the reverse primer P2 (–). The BamHI and HindIII were designed to ligate PCR fragments into the expression vector pQE-31. After enzyme digestion, the PCR fragments were separated by 1.0% gel electrophoresis, purified and ligated into pMD19-T vector at 16 °C for 16 h. 10 μl of the ligation mixture was transformed into E. coli strain JM109 competent cells (100 μl), which were grown on LB plate containing ampicillin, β-isopropyl thiogalactoside (IPTG), and chromogenic substrate 5-bromo-4-chloro-3-indolyl β-Dgalactopyranoside (X-gal) for blue-white screening. The recombinant pMD19-NS3 plasmid was confirmed by directly DNA sequencing. A BamHI/HindIII fragment from pMD19-NS3 that contained NS3 sequence was subcloned into pQE-31 vector and named as 148
pQE-NS3. By this strategy, the DENV NS3 gene was fused in-frame with pQE-31 plasmid with the 6×His purification tag (Figure 1).
Expression of DENV NS3 protein E. coli JM109 with pQE31-NS3 expression vectors was inoculated in LB medium (containing 100 μg/ml ampicillin) and allowed to grow overnight. 6 ml of this culture was incubated with 600 ml of LB medium shaking at 37 °C until the absorbence of the culture at 600 nm reached 0.6. Then the cells were induced with 1mM IPTG and harvested at 10 h after induction by centrifugation at 7000 g for 20 min at 4 °C. The target protein was detected directly by boiling the cell pellet and electrophoresing in SDS-PAGE and visualizing after Coomassie Blue staining, with normal JM109 lysate as control. The recombinant NS3 protein were identified by Western blotting analysis after transferring the proteins onto a polyvinylidene difluoride (PVDF) membrane and probed with mouse anti-His antibody.[15]
Purification and renaturation of DENV NS3 protein The induced-expression cells were washed with buffer A (50 mM Tris-HCl, pH 7.9; 50 mM NaCl; 0.5 mM EDTA; 5% glycerol) and then resuspended in sonication buffer (50 mM TrisDengue Bulletin – Volume 30, 2006
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
Figure 1: Construction strategy of pQE-NS3 vector
HCl, pH 7.9; 50 mM NaCl; 0.5 mM EDTA; 5% glycerol; 1 mM PMSF). The cells were disrupted by sonication in an ice-water bath for 40 min. The inclusion bodies were isolated by 14 000 g centrifugation for 30 min at 4 °C. The pellet was washed three times with washing buffer (50 mM Tris-HCl, pH 7.9; 50 Dengue Bulletin – Volume 30, 2006
mM NaCl; 0.5 mM EDTA; 5% glycerol; 1% Triton X-100) and then dissolved in denaturing buffer (8M urea; 10 mM Tris; 100 mM NaH2PO4·2H2O and 0.1% 2-mercaptoethanol; Ph 8.0). Protein solution was filtrated with polyvinylidene difluoride membrane (0.22 μm) and the supernatant was applied to a Ni2+-NTA 149
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
agarose column, which was charged with Ni2+ to purify His-tagged fusion protein. The column with the protein was washed with buffer B (8M urea; 10 mM Tris, pH 7.6; 100 mM NaH2PO4·2H2O; pH 6.3) and buffer C (8M urea; 10 mM Tris, pH 7.6; 100 mM NaH2PO 4·2H2O; pH 4.5). The elute with buffer C, which contained NS3 fusion protein, was collected and stored at 4 °C until the next processing. The purified recombinant NS3 was separated by 12% SDS-PAGE and then transferred onto a PVDF membrane and probed with mouse anti-His antibody followed by horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG.[16] To remove urea, denatured proteins were refolded by successive dialysis with buffer D (2M urea; 20 mM Tris; 0.1 mM GSSG; 0.9 mM GSH; pH 8.0), buffer E (0.5M urea; 20 mM Tris; 0.1 mM GSSG; 0.9 mM GSH; pH 8.0) and 0.1M phosphate buffer saline (PBS).
infected with DENV-2 and uninfected ECV304 cells were also used in the analysis of PAbs against recombinant NS3. Briefly, ECV304 cells were infected with DENV-2. At 48 h after infection, the cells were fixed with 4% paraformaldehyde in PBS (pH 7.2), and then incubated with the rabbit anti-recombinant NS3 protein PAbs followed by rhodamineconjugated goat anti-rabbit IgG. The cells were observed under fluorescence microscopy (Olympus BX51). Titer of the NS3 antibody was detected by an enzyme-linked immunosorbent assay (ELISA). In brief, 96-well tissue culture plate was coated with recombinant NS3 solution (about 3 μg/well), then probed with antiserum and developed with HRP-conjugated goat antirabbit IgG. Positive binding was detected with O-Phenylenediamine (OPD). Absorbencies (absorbance) were determined at 490 nm with a microplate reader (Bio-RAD model 550). Normal rabbit serum was used as negative control for ELISA.
Preparation and identification of NS3 antiserum Rabbits were immunized firstly subcutaneously with approximately 0.5 ml solution of NS3 (about 1 mg renatured NS3 protein) mixed with 0.5 ml of complete Freund’s adjuvant, the same protein dosage secondly with incomplete Freund’s adjuvant, and thirdly with PBS. After three-times immunization, the antiserum was taken and the characteristic of this NS3 antibody was analysed. To confirm the specificity of our PAbs against recombinant NS3 protein, the following experiments were performed. The recombinant NS3, DENV-infected C6/36 and uninfected cell lysates were run in 12% SDSPAGE respectively, and then transferred onto a PVDF membrane and probed with rabbit antirecombinant NS3 serum followed by HRPconjugated goat anti-rabbit IgG. ECV304 cells 150
Results Gene construction In order to produce DENV NS3 protein, viral RNA was isolated from DENV-infected C6/36 cells and reverse transcribed to cDNA using primer DEN(–). The gene of NS3 protein was amplified by PCR with primers P1 (+) and P2 (–) from cDNA and was cloned into pMD19-T vector to produce pMD19-NS3. A BamHI/ HindIII fragment (about 1854 bp) from pMD19-NS3 was subcloned into pQE-31 vector to give the recombinant pQE-NS3. The recombinant pQE-NS3 was digested with BamHI and HindIII and confirmed by PCR. As shown in Figure 2, a fragment about 1854 bp from pQE-NS3 and PCR products amplified by the P1 (+) and P2 (–), which were the NS3 gene, were clearly seen in the 1% agarose gel Dengue Bulletin – Volume 30, 2006
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
Figure 2: Identification of pQE-NS3
Expression of the recombinant proteins After the recombinant expression plasmid were constructed and proved to be correct, it was used for expressing fusion proteins in E. coli JM109. The transformant with pQE-NS3 was cultivated in 600 ml LB medium and the expression was induced by 1 mM IPTG. The protein fractions were fractionated by SDSPAGE and the gels were stained by Coomassie Blue. As shown in Figure 3, E. coli JM109 strains harbouring pQE-NS3 could express the expected fusion proteins when induced by 1 mM IPTG. A band of about 70 kDa proteins appeared, but not in normal JM109 lysates. The specific characteristic bands were confirmed by Western blotting using anti-His monoclonal antibody (MAb) (Figure 4).
A specific fragment about 1854 bp was obtained from the recombinant expression plasmid pQE-NS3 by enzyme digestion and PCR. Lane M, 1 kb DNA ladder (10 000–250 bp); lanes 1, pQE-NS3; lanes 2, pQE-NS3 digested with BamHI restriction endonucleases; lanes 3, pQE-NS3 digested with HindIII restriction endonucleases; lanes 4, pQE-NS3 digested with BamHI and HindIII; lanes 5, PCR product amplified from pQE-NS3.
Purification and renaturation of NS3 protein The SDS-PAGE analysis showed that the target protein was expressed as inclusion bodies in E. coli, because the supernatant of cells lysate after sonication had no obvious expressed protein.
electrophoresis stained with 5 μg/ml ethidium bromide: The DNA sequencing also showed that the gene sequences of interest were authentic.
Figure 3: SDS–PAGE analysis of expressed proteins
Conditions for growth of E. coli transformed by His-tagged NS3 expression plasmid were described under “Materials and methods”. E. coli JM109 strains harboring pQE-NS3 could express the expected fusion proteins, A band of about 70 kDa proteins appeared, but controls was not seen. Lane 1, protein markers; lane1-7, E. coli JM109 strains harbouring pQE-NS3 induced by 1mM IPTG at 1 h, 3 h, 5 h, 7 h, 9 h, 11 h, 13 h, respectively; lane8, normal JM109 induced by 1mM IPTG at 13 h.
Dengue Bulletin – Volume 30, 2006
151
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
Figure 4: Western blotting analysis of recombinant NS3 protein
Figure 5: SDS-PAGE analysis of purified NS3 from E. coli
The recombinant NS3 was analysed by SDS-PAGE and transferred to PVDF membrane, probed with mouse anti-His tag MAb and developed with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG. M: protein marker; Lane 1: E. coli JM109 strains harbouring pQE-NS3 induced by 1mM IPTG at 13 h; lane2: normal JM109 cell induced by 1mM IPTG at 13 h.
Purification by using Ni2+-NTA affinity column chromatography is described under “Materials and methods”. Denatured proteins were refolded by successive dialysis to remove urea as described under “Purification and renaturation of NS3 protein”. Lane M, protein marker (kDa); lane 1, precipitation after sonication; lane 2, nonbinding fraction of Ni2+-NTA-agarose; lane 3, fraction eluted from the Ni2+-NTA column with buffer B; lane 4, fraction eluted from the Ni2+-NTA column with buffer C containing recombinant proteins NS3; lane 5, refolded protein NS3 (arrow).
Figure 6: Western blotting analysis of PAbs against recombinant NS3 protein
The inclusion bodies were completely dissolved in 8M urea and the fusion proteins could also be captured by Ni2+-NTA affinity chromatography. The protein fractions were fractionated by SDSPAGE and the gels were stained by Coomassie blue (Figure 5). The result showed that purified proteins were greater than 80% homogeneous and that about 20% impurities had masses less than NS3 protein (70kDa). These smaller proteins reacted positively with anti-His monoclonal antibodies as visualized by Western blotting . The urea was removed from denatured proteins by successive dialysis.
The recombinant NS3, DENV-infected C6/36 and uninfected cell lysates were analysed by SDS-PAGE (12%) and transferred to PVDF membrane, probed with PAbs against recombinant NS3 protein and developed with HRP-conjugated goat anti-rabbit IgG. M: protein marker; lane 1: recombinant NS3 protein, lane2, DENV-infected C6/36 cell lysates, lane3, uninfected cell lysates.
152
Dengue Bulletin – Volume 30, 2006
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
Preparation and identification of NS3 antiserum The antiserum against our NS3 protein was collected from immunized rabbits. Western blots analysis showed that the PAbs were specific for recombinant NS3 protein and native NS3 protein using DENV-2-infected C6/36 lysates. The specific characteristic bands that define the NS3 protein were observed, but
not in the control of uninfected cell lysates (Figure 6). Likewise, immunostaining showed that intense fluorescing clusters were noted in peri-nuclear of infected ECV304 cells and diffuse fluorescence with some speckling was seen in the cytoplasm (Figure 7A). The same distribution pattern of fluorescence was also observed in infected ECV304 cells, which were stained with mouse anti-DENV serum (Figure 7B). Infected cells incubated with the pre-
Figure 7: Immunofluorescence analysis of PAbs against recombinant NS3 protein
ECV304 cells were infected with DENV-2. At 48 h after infection, the cells were incubated with the rabbit antirecombinant NS3 protein PAbs followed by rhodamine-conjugated goat anti-rabbit IgG. (bar = 10 μm).A: infected cells incubated with the rabbit anti-recombinant NS3 protein PAbs; B: infected ECV304 cells stained with mouse anti-DENV serum; C: infected cells incubated with the pre-vaccinated rabbit serum; D: uninfected cells incubated with the rabbit anti-recombinant NS3 protein PAbs.
Dengue Bulletin – Volume 30, 2006
153
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
vaccinated rabbit serum (Figure 7C) and uninfected cells incubated with the rabbit antirecombinant NS3 protein PAbs (Figure 7D) showed no specific fluorescence.
Determination of antiserum titers by ELISA NS3 antiserum preparations were titrated by an ELISA assay. 96-well tissue culture plate was coated with recombinant NS3 solution, then probed with antiserum at various dilutions and developed with HRP-conjugated goat antirabbit IgG. Positive binding was detected with OPD. Typical results obtained from the ELISA titration of antisera was more than 1:12 800. Only a low degree of non-specific binding was detected when normal rabbit serum were tested.
Interestingly, the above-mentioned distribution pattern of fluorescence was similar to that seen in infected ECV304 cells stained with antiDENV serum. Our results implied that the purifying NS3 protein had strong immunogenicity and its PAbs could recognize the native protein. There is currently no effective vaccine or antiviral drug to protect against dengue. Our results indicated that these antibodies might be an available tool, not only to study the replicative process of DENV but also to generate ancillary diagnostic tools for some DENV infection. The pQE31 vector is used for high-level expression of N-terminal hexa-histidine-tagged recombinant proteins in E. coli strains containing repressor (lacIq) plasmid. E. coli JM109 strains harbouring different expression vectors can express high levels of proteins with various molecular weights after being induced. This strain harbours the lacIq mutation that can produce enough lac repressor to efficiently block the basic transcription of pQE-31 plasmid, and is ideal for storing and propagating this plasmid. The form of expression protein is mainly insoluble inclusion. Eukaryotic proteins expressed intracellularly in E. coli are frequently insoluble inclusion bodies if no leading peptide is constructed with the protein of interest. The intermolecular association of hydrophobic domains is believed to be the reason for the formation of bodies.[17] In addition, the factor of culture environment also effect forms of insoluble inclusion. The inclusion usually is formed with high temperature and high concentration of IPTG. The form of inclusion is profitable to raise the quantity of protein. Therefore, according to our preliminary experiment, we cultured E. coli JM109 at 37 °C and 1 mM IPTG for 10 h in order to obtain more protein. The recombinant NS3 proteins were purified by affinity chromatography with Ni2+NTA agarose resin. Purified protein analysed Dengue Bulletin – Volume 30, 2006
Discussion As a multifunctional protein, NS3 plays an important role in the replication of dengue viruses. The N-terminal region of NS3 interacts with NS2B and functions as a two-component serine protease involved in processing the viral polyprotein precursor. The C-terminal region of NS3 contains RNA helicases/NTPases. It is demonstrated that both DENV-2 NS3 and NS5 are capable of converting the RF RNA to RI. Moreover, the NS3 protein is also able to elicit specific antibodies. To further elucidate the rules of NS3 in the pathogenesis of DENVmediated diseases, in this study we reported the cloning, expressing of the DENV-2 NS3 protein, and purifying it under denaturing conditions. Rabbits were immunized with the NS3 protein and PAbs were generated. Western blot analysis showed that our PAbs against the NS3 protein of DENV-2 were specific. Using immunostaining, a strong positive response was observed in peri-nuclear of infected ECV304 cells, which probed with our anti-NS3 antibody. 154
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
showed that the NS3 proteins were greater than 80% homogeneous and that about 20% impurities had masses less than NS3 protein. These smaller proteins reacted positively with anti-His monoclonal antibodies. How do these impurities appear? It is well known that these truncations were not the product of proteolysis via endogenous bacterial proteases or by autoproteolysis of NS3 protein. The impurities were more likely to be the products of premature translation termination and/or proteolytic degradation during protein expression. They had examined the codon usage for the genesencoding DENV NS2B and NS3 as a potential problem that might limit expression of these proteins in E. coli . Although a significant number of E. coli-biased rare codons are present in DENV-2 NS3, preliminary expression studies clearly demonstrated that these biased codons were not overly restrictive because high yields of recombinant protein were obtained. It is possible that ribosomal slippage at these rare codon positions may occur, resulting in frame-
shifts and premature terminations when outof-frame termination codons are encountered. This possibility is currently under investigation.[18] The purpose of this study was expression and purification of a recombinant DENV NS3 protein and production of the polyclonal antibody against NS3 protein. Our results indicated that the recombine NS3 protein showed strong immunogenicity and its specific PAbs could recognize native NS3 protein, suggesting this work might be helpful for further studying the pathogenesis of DENV infection.
Acknowledgments This work was supported by the grants from the National Natural Science Foundation of China (Nos.30471552 and 30671853). We thank Xiaodong Shen, Ming Li, Rui Hou and Xiaomei Hu for technical assistance.
References [1] Leyssen P , De Clercq E, Neyts J. Perspectives for the treatment of infections with Flaviviridae. Clin Microbiol Rev 2000 Jan;13(1):67-82. [2] Irie K, Mohan PM, Sasaguri Y, Putnak R, Padmanabhan R. Sequence analysis of cloned dengue virus type 2 genome (New Guinea-C strain). Gene 1989 Feb 20;75(2):197-211. [3] Chambers TJ, Hahn CS, Galler R, Rice CM. Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 1990;44:649-88. [4] Chambers TJ, Weir RC, Grakoui A, McCourt DW, Bazan JF, Fletterick RJ, Rice CM. Evidence that the N-terminal domain of nonstructural protein NS3 from yellow fever virus is a serine protease responsible for site-specific cleavages in the viral polyprotein. Proc Natl Acad Sci U S A 1990 Nov;87(22):8898-902. [5] Falgout B, Miller RH, Lai CJ. Deletion analysis of dengue virus type 4 nonstructural protein NS2B: Identification of a domain required for NS2B-NS3 protease activity. J Virol 1993 Apr;67(4):2034-42. [6] Raviprakash K, Sinha M, Hayes CG, Porter KR. Conversion of dengue virus replicative form RNA (RF) to replicative intermediate (RI) by nonstructural proteins NS-5 and NS-3. Am J Trop Med Hyg 1998 Jan;58(1):90-5. [7] Utama A, Shimizu H, Morikawa S, Hasebe F, Morita K, Igarashi A, Hatsu M, Takamizawa K, Miyamura T. Identification and characterization of the RNA helicase activity of Japanese encephalitis virus NS3 protein. FEBS Lett 2000 Jan 7;465(1):74-8. [8] Wengler G, Wengler G. The NS 3 nonstructural protein of flaviviruses contains an RNA triphosphatase activity. Virology 1993 Nov;197(1):265-73. 155
Dengue Bulletin – Volume 30, 2006
Expression, Purification of DENV-2 Nonstructural Protein 3 and Production of its Polyclonal Antibody
[9] Gwack Y, Kim DW, Han JH, Choe J. Characterization of RNA binding activity and RNA helicase activity of the hepatitis C virus NS3 protein. Biochem Biophys Res Commun 1996 Aug 14;225(2):654-9. [10] Warrener P , Collett MS. Pestivirus NS3 (p80) protein possesses RNA helicase activity. J Virol 1995 Mar;69(3):1720-6. [11] Kurane I, Zeng L, Brinton MA, Ennis FA. Definition of an epitope on NS3 recognized by human CD4+ cytotoxic T lymphocyte clones cross-reactive for dengue virus types 2, 3, and 4. Virology 1998 Jan 20;240(2):16974. [12] Spaulding AC, Kurane I, Ennis FA, Rothman AL. Analysis of murine CD8(+) T-cell clones specific for the Dengue virus NS3 protein: flavivirus cross-reactivity and influence of infecting serotype. J Virol 1999 Jan;73(1):398403. [13] Tan CH, Yap EH, Singh M, Deubel V, Chan YC. Passive protection studies in mice with monoclonal antibodies directed against the non-structural protein NS3 of dengue 1 virus. J Gen Virol 1990 Mar;71 (Pt 3):745-9.
[14] Valdes K, Alvarez M, Pupo M, Vazquez S, Rodriguez R, Guzman MG. Human dengue antibodies against structural and nonstructural proteins. Clin Diagn Lab Immunol 2000 Sep;7(5):856-7. [15] Rao XC, Li S, Hu JC, Jin XL, Hu XM, Huang JJ, Chen ZJ, Zhu JM, Hu FQ. A novel carrier molecule for high-level expression of peptide antibiotics in Escherichia coli. Protein Expr Purif 2004 Jul;36(1):11-8. [16] Rao X, Hu J, Li S, Jin X, Zhang C, Cong Y, Hu X, Tan Y, Huang J, Chen Z, Zhu J, Hu F. Design and expression of peptide antibiotic hPABbeta as tandem multimers in Escherichia coli. Peptides 2005 May;26(5):721-9. [17] Villaverde A, Carrio MM. Protein aggregation in recombinant bacteria: biological role of inclusion bodies. Biotechnol Lett 2003 Sep;25(17):1385-95. [18] Arakaki TL, Fang NX, Fairlie DP , Young PR, Martin JL. Catalytically active Dengue virus NS3 protease forms aggregates that are separable by size exclusion chromatography. Protein Expr Purif 2002 Jul;25(2):241-7.
156
Dengue Bulletin – Volume 30, 2006