Eastern Mediterranean Health Journal [2013; Vol.19, Issue 11]

Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale Volume 19 / No. 11 November / Novembre ¼¼Ø{L PL…HnšUÐ{dœCÐ FeRŽi ©n›UÐŒxP>2013 Immunizing against polio Polio has re-emerged in some countries in the Region that had previously been polio-free for years, emphasising the urgent need to ensure vaccination of all children. EASTERN MEDITERRANEAN HEALTH JOURNAL IS the official health journal published by the Eastern Mediterranean Regional Office of the World Health Organization. It is a forum for the presentation and promotion of new policies and initiatives in health services; and for the exchange of ideas, con- cepts, epidemiological data, research findings and other information, with special reference to the Eastern Mediterranean Region. It addresses all members of the health profession, medical and other health educational institutes, interested NGOs, WHO Col- laborating Centres and individuals within and outside the Region. LA REVUE DE SANTÉ DE LA MÉDITERRANÉE ORIENTALE EST une revue de santé officielle publiée par le Bureau régional de l’Organisation mondiale de la Santé pour la Méditerranée orientale. Elle offre une tribune pour la présentation et la promotion de nouvelles politiques et initiatives dans le domaine des ser-vices de santé ainsi qu’à l’échange d’idées, de concepts, de données épidémiologiques, de résultats de recherches et d’autres informations, se rapportant plus particulièrement à la Région de la Méditerranée orientale. Elle s’adresse à tous les professionnels de la santé, aux membres des instituts médicaux et autres instituts de formation médico-sanitaire, aux ONG, Centres collabora- teurs de l’OMS et personnes concernés au sein et hors de la Région. EMHJ is a trilingual, peer reviewed, open access journal and the full contents are freely available at its website: http://www/emro.who.int/emhj.htm EMHJ information for authors is available at its website: http://www.emro.who.int/emh-journal/authors/ EMHJ is abstracted/indexed in the Index Medicus and MEDLINE (Medical Literature Analysis and Retrieval Systems on Line), ISI Web of knowledge, the Cumulative Index to Nursing and Allied Health Literature (CINAHL), CAB International, Lexis Nexis, Scopus and the Index Medicus for the WHO Eastern Mediterranean Region (IMEMR). ©World Health Organization 2013 All rights reserved Disclaimer The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by the World Health Organization in preference to others of a similar nature that are not mentioned. All reasonable precautions have been taken by the World Health Organization to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either express or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall the World Health Organization be liable for damages arising from its use. The named authors alone are responsible for the views expressed in this publication. ISSN 1020-3397 Cover designed by Diana Tawadros Internal layout designed by Emad Marji and Diana Tawadros Printed by WHO Regional Office for the Eastern Mediterranean ‹x{bšUFfYwíphCn_UÐp[UÐpe^fe=ƒHŽšCÐçPUehdSüÐošcCÐŒLÚ{[>šUÐpheH}UÐpdœCЏw phýn=ŽUÐ Ónh]_CÐí ‹hwnaCÐí ÊÐÚùÐ éØn˜šUí ºn4 sxíGUÐí ph[UÐ ÓnY{#Ð ;Ò{x{!Ð ÓÐÚØn˜CÐí ÓnHnh—UÐ ŠTOÎpg@ŽYwíƒHŽšCÐ ç ‹hdSl= ngfYˆd_šx nY pÉnBíºÓnYŽd_CÐ ŒY‰UÙEQíÔn=úÐsýnšií ~TÐ}CÐí ºphf_CÐ phYŽc"Ð EQÓ5^fCÐ Ð|Tíºphehd_šUÐ {wn_CÐ }ýnHíph˜]UÐ ÓnhdcUÐí ºph[UÐ ŒgCÐ Ên\LÌ @ÚnBí‹hdSüÐ;p[Un=NešgCÐØÐ}RúÐíphCn_UÐp[UÐpe^fY…Ypiín_šCÐ ‚G™BÐçOTogœZTÐoc›BÐ Contents La Revue de Santé de la Méditerranée orientale Eastern Mediterranean Health Journal Vol. 19 No. 11 11 ددع شرع عساتلا دلجلما•  2013  • Editorial An ancient scourge triggers a modern emergency Bruce Aylward ..............................................................................................................................................................................................................................................................................................903 Research articles Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study V.K. Sharma, S. Durrani, M. Sawa, J.R .M. Copeland, M.T. Abou-Saleh, S. Lane and P. Lepping ...................................................................................................................................905 Predictors of smoking among male college students in Saudi Arabia Y.S. Almogbel, S.M. Abughosh, F.S. Almogbel, I.A. Alhaidar and S.S. Sansgiry .....................................................................................................................................................................909 Salt intake in Eastern Saudi Arabia A.M. Alkhunaizi, H.A. Al Jishi and Z.A. Al Sadah .........................................................................................................................................................................................................................915 Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees S. Garg , R . Hasan, S. Scahill and Z. Ud-Din Babar ........................................................................................................................................................................................................................919 Pharmacovigilance in Qatar: a survey of pharmacists K. Wilbur ........................................................................................................................................................................................................................................................................................................930 Isolation and identification of Legionella pneumophila from drinking water in Basra governorate, Iraq A.A. Al-Sulami, A.M.R. Al-Taee and A.A. Yehyazarian ................................................................................................................................................................................................................936 Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients A.A. Al-Mahbashi, M.M. Mukhtar and E.S. Mahgoub .................................................................................................................................................................................................................942 High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt L. Metwally, N. Gomaa, M. Attallah and N. Kamel ........................................................................................................................................................................................................................947 Prognostic factors of Atractylis gummifera L. poisoning, Morocco S. Achour, N. Rhalem, S. Elfakir, A. Khattabi, C. Nejjari, A. Mokhtari, A. Soulaymani and R . Soulaymani ..............................................................................................................953 Case report Case of acquired lobar emphysema mimicking pneumothorax in a neonate F. Firinci, N. Duman, O. Ates, E. A. Ozer, A. Kumral, A. Erdemir and H. Ozkan ................................................................................................................................................................960 Dr Ala Alwan, Editor-in-chief Editorial Board Professor Zulfiqar Bhutta Professor Mahmoud Fahmy Fathalla Professor Rita Giacaman Dr Ziad Memish Dr Sameen Siddiqi Professor Huda Zurayk International Advisory Panel Dr Mansour M. Al-Nozha Professor Fereidoun Azizi Professor Rafik Boukhris Professor Majid Ezzati Dr Zuhair Hallaj Professor Hans V. Hogerzeil Professor Mohamed A. Ghoneim Professor Alan Lopez Dr Hossein Malekafzali Professor El-Sheikh Mahgoub Professor Ahmed Mandil Dr Hooman Momen Dr Sania Nishtar Dr Hikmat Shaarbaf Dr Salman Rawaf Editors Fiona Curlet, Guy Penet Eva Abdin, Alison Bichard, Marie-France Roux Graphics Suhaib Al Asbahi, Hany Mahrous, Diana Tawadros Administration Nadia Abu-Saleh, Yasmeen Sedky طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 903 Editorial An ancient scourge triggers a modern emergency Bruce Aylward 1 aFor the first time in history, all polio cases detected in Afghanistan in 2013 have been due to imported viruses (originating in Pakistan’s Federally Administered Tribal Areas or FATA). 1Assistant Director-General, Polio, Emergencies and Country Collaboration, World Health Organization, Geneva, Switzerland. The Eastern Mediterranean – crossroads of the world. Sitting for millennia on ancient, vital trade and travel routes, leaders here have faced a twofold chal- lenge in protecting their people from the ravages of infectious diseases: first, the control of pathogens native to these lands and, secondly, the elimination of those pathogens which gain entry with travellers, traders and pilgrims. The most dangerous of this latter group are those organisms that enter the region silently, then spread widely before suddenly emerging with terrible consequences for the most vulnerable populations. This past month, an ancient virus again re-emerged in the Middle East, more than a decade after most health leaders thought it had been vanquished there forever. On 28 October 2013,  the Minister  of Health of the Syrian Arab Republic announced to his counterparts from 22  countries of the Eastern Mediterranean Region of the World Health Organiza- tion,  that after a 15-year absence, polio  was again paralysing and killing chil- dren in his country. Genetic sequencing showed that the virus had originated in Pakistan and already travelled to Egypt, Israel, the Gaza Strip and the West Bank over the previous 12 months.  Within  24  hours,  the  assembled  Ministers declared this re-infection of the Middle East an emergency for the entire Eastern Mediterranean Region, calling for extraordinary joint action to combat this ancient scourge [1]. The Minister of Oman announced US$ 5  million in new financing for the effort, Saudi Arabia declared it would mobilize religious leaders to ensure that all par- ents understood their obligation to vac- cinate their children, the United Arab Emirates  reconfirmed  their US$ 120  million pledge for polio made earlier this year; most striking, 7 countries im- mediately agreed to coordinate the vaccination of 22 million children over  the  subsequent 3 weeks,  and again  in  December, to again vanquish polio in the Middle East. All countries called on Pakistan to rapidly access and vaccinate all of its children as a matter of urgency to stem the international spread of its viruses. This decisive leadership and rapid emergency action builds on a long and illustrious history of infectious disease control, vaccination and, especially, po- lio eradication in the Eastern Mediter- ranean Region. A few examples reinforce the strik- ing accomplishments of this Region on its road to becoming polio-free. When poliovirus roared out of northern Nigeria 10 years ago  follow- ing the temporary suspension of oral poliovirus vaccine (OPV)  in 2  states,  nearly  2  dozen  previously  polio-free  countries became re-infected and thousands of children were needlessly paralysed; Saudi Arabia led the world in boldly introducing new polio vac- cination requirements for all travellers from polio-infected countries to protect pilgrims, travellers and Saudi Arabians alike [2]. When it appeared impossible  to interrupt polioviruses in Egypt due to the very high population density, particularly in the mega-city of Cairo/ Giza, that country led the world in innovation by commissioning the fast- track development and use of a new monovalent OPV (mOPV1); polio transmission there stopped almost im- mediately. In Afghanistan, the Ministry of Public Health courageously support- ed the painstaking work of negotiating vaccinator access to every corner of Kandahar and Helmand provinces; as of November 2013, the country passes  its first anniversary with no child hav- ing been paralysed by an indigenous poliovirusa. As importantly, major regional in- stitutions – including the Organization of Islamic Cooperation and the Islamic Development Bank – have brought their voices and resources to the effort to secure a polio-free world. Religious leaders, led by the Grand Imam of Al Azhar, have formed an Islamic Advisory Group for the Global Polio Eradication Initiative to ensure parents know that they are obligated to ensure all children are vaccinated and to ensure communi- ties assure the safe passage and work of vaccinators. This central role of the Eastern Mediterranean in polio eradication led global leaders in philanthropy, develop- ment and vaccinology to gather in Abu Dhabi in April 2013 to launch the new  Polio Eradication & Endgame Strategic Plan 2013–2018 [3] and pay tribute to  the commitment of the Region’s leaders to immunization and disease eradica- tion. The major unresolved threat to the Region’s deep commitment to complete polio eradication is now the decision by a handful of local leaders in EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 904 parts of north-west Pakistan and south/ central Somalia to withhold vaccina- tion and protection from the devastat- ing effects of this disease. As national and regional leaders launch their new emergency eradication effort to again eliminate polio in the Middle East, they must at the same time rapidly reconcile the concerns of local leaders in Pakistan and Somalia to restart vaccination in those areas. 2014 must be the year in which the  Eastern Mediterranean conquers this ancient menace by backing this emer- gency response with the leadership, gen- erosity, innovation, determination and diligence that has been characteristic of this Region’s work in polio eradication and which continues to inspire the en- tire Global Polio Eradication Initiative. The first recorded image of polio in the world is from the Eastern Mediter- ranean, where the consequences of this disease were captured  in a 5000 year- old stele from Egypt. There is absolutely no reason why the last image of polio should be from this Region. References 1. WHO Regional Committee for the Eastern Mediterranean Resolution EM/RC60/R.3. Escalating Polio Emergency in the Eastern Mediterranean Region (http://applications.emro. who.int/docs/RC60_Resolutions_2013_R3_15136_EN.pdf, ac- cessed 30 November 2013). 2. International travel and health. Geneva, World Health Organi- zation (www.who.int/ith, accessed 30 November 2013). 3. Polio eradication and endgame strategic plan 2013–2018. Ge- neva, Global Polio Eradication Initiative, 2013 (http://www. polioeradication.org/Resourcelibrary/Strategyandwork.aspx, accessed 30 November 2013). طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 905 Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study V.K. Sharma,1 S. Durrani,2 M. Sawa,3 J.R.M. Copeland,4 M.T. Abou-Saleh,5 S. Lane 6 and P. Lepping 7 ABSTRACT Mental health services are far from satisfactory in the Eastern Mediterranean Region. The Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC) is a semi-structured, computerized clinical assessment tool that was developed to assist health workers in making quick, convenient and comprehensive standardized mental health assessments. A study was carried out in the United Arab Emirates to evaluate the validity and feasibility of the Arabic version of the GMHAT/PC. Mental health nurses administered the GMHAT/ PC Arabic version to 50 patients in mental health and rehabilitation settings and their GMHAT/PC diagnosis was compared with the psychiatrist’s independent ICD-10 based clinical diagnosis on the same patients. The nurses found GMHAT/PC easy to administer in an average of 16 minutes. The GMHAT/PC-based diagnosis had a good agreement with the psychiatrist’s diagnosis (kappa = 0.91) and a high sensitivity (97%) and specificity (94%). 1Faculty of Health and Social Care, University of Chester, Chester, United Kingdom; Consultant Psychiatry Practice, Cheshire and Wirral Partnership NHS Foundation Trust, United Kingdom (Correspondence to V.K. Sharma: v.sharma@chester.ac.uk; v.k.sharma@liv.ac.uk). 2Behavioural Science Pavillion, Shiekh Khalifa Medical City, Dubai, United Arab Emirates. 3Consultant Psychiatry Practice, Kent and Medway Mental Health and Social Care Partnership Trust, United Kingdom. 4University of Liverpool, Liverpool, United Kingdom. 5Qatar Addiction Treatment and Rehabilitation Centre Project, Doha, Qatar. 6Institute of Translational Medicine, University of Liverpool, Liverpool, United Kingdom. 7Consultant Psychiatry Practice, Betsi Cadwaladr University Health Board, Wrexham, North Wales, United Kingdom; Bangor University, United Kingdom. Received: 04/07/12; accepted: 24/09/12 اهمادختسا ةيناكمإو اهتحص لوح ةسارد :ةيلولأا ةياعرلا ةخسن – ةيسفنلا ةحصلا مييقتل ةيلماعلا ةادلأا نم ةيبرعلا ةخسنلا غنبيل تريب ،ينل نفيتس ،حلاص وبأ دممح ،دنلابوك نوج ،اوس ويثام ،نيارود ايزاش ،امراش لمايف ةادأ يه ةيلولأا ةياعرلا ةخسن – ةيسفنلا ةحصلا مييقتل ةيلماعلا ةادلأا تناك المو .طسوتلما قشر ميلقإ في ةيسفنلا ةحصلا تامدخ صقنلا بوشي :ةـصلالخا نوثحابلا ىرجأ دقف ؛ةيرايعمو ةلماشو ةمئلامو ةعيسر تماييقت ءارجإ لىع ينيحصلا ينلماعلا دعاست يك تدعأ ،يريسرلا مييقتلل ًايئزج ةلكيهمو ةبسومح ةرماتسلاا هذه ةيسفنلا ةحصلا تاضرمم تقّبط دقو .ةادلأا هذله ةيبرعلا ةخسنلا مادختسا ةيناكمإو ىودج مييقتل ةدحتلما ةيبرعلا تاراملإا في ةساردلا هذه دنتسي يذلا لقتسلما سيفنلا بطلا في يريسرلا صيخشتلاب ميهدل صيخشتلا نوثحابلا نراق مث ؛سيفنلا ليهأتلاو ةيسفنلا ةحصلا عقاوم في ًاضيرم ينسخم لىع كانه ناكو ،ةقيقد 16 قرغتستو ،قيبطتلا في ةلوهس رثكأ ةادلأا نأ تاضرملما تدجوو .متهاذ ضىرملل ضارملأل ليودلا فينصتلا نم ةشراعلا ةعبطلا لىع .)%94( ةعفترم ةيعونلاو ،)%97( ةعفترم ةيساسلحا تناكو ،)0.91 = اباك( ينيسفنلا ءابطلأا صيخشت ينبو ةادلأا لىع دنتسلما صيخشتلا ينب دّيج قفاوت Version en langue arabe de l’outil d’évaluation mondial de la santé mentale dans le monde – soins primaires : étude de validité et de faisabilité RÉSUMÉ Les services de santé mentale sont loin d’être satisfaisants dans la Région de la Méditerranée orientale. L’outil d’évaluation mondial de la santé mentale – version pour les soins primaires – est un instrument d’évaluation clinique semi-structuré assisté par ordinateur qui a été élaboré pour permettre aux agents de santé d’établir rapidement et facilement des évaluations de santé mentale standardisées et exhaustives. Une étude a été menée aux Émirats arabes unis afin d’évaluer la validité et la faisabilité de la version en langue arabe de cet outil d’évaluation. Des infirmières en santé mentale ont utilisé la version en langue arabe de cet outil d'évaluation sur 50 patients en milieu de psychiatrie et de réadaptation. Les diagnostics issus de l'évaluation ont été comparés aux diagnostics cliniques établis à l’aide de la CIM-10 par des psychiatres indépendants pour les mêmes patients. Les infirmières ont trouvé que l’outil d’évaluation mondiale de la santé mentale – version pour les soins primaires – était facile à administrer ; la tâche prenait 16 minutes en moyenne. Le diagnostic établi à l’aide de cet outil d’évaluation avait un degré de concordance satisfaisant avec le diagnostic du psychiatre (kappa = 0,91) et avait une sensibilité (97 %) et une spécificité (94 %) élevées. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 906 Introduction Mental health services are far from sat- isfactory in the Eastern Mediterranean Region (EMR). The World Health Or- ganization’s (WHO) recent report [1] highlighted limited resources available for the care of people with mental ill- ness, poor utilization of these resources and as a consequence a significant treatment gap of up to 85%. The report  concluded that mental health resources were scarce, inequitably distributed and inefficiently used; community-based mental health services were underde- veloped; and collaboration between the mental health system and other health and non-health sectors was generally weak in the Region. Similar to more developed coun- tries, between 20% and 34% of  con- sultations with primary health care facilities in the EMR are due to mental health problems  [2]. Health officials  need to understand and appreciate the harmful effects of mental illness and give attention to prevention, treatment and rehabilitation of mental disorders at the primary care level as well as other levels of care [3]. It  is high time to re- duce the gap between the needs and the services offered. To address the is- sue of low detection rates of psychiatric disorders in Arab cultures, screening instruments have been translated and validated into Arabic language: the General Health Questionnaire and the Self-Reporting Questionnaire [4] and new screening instruments have been developed  [5]  including  a  culture- oriented screening scale for anxiety and depression [6]. One pragmatic way to reduce the treatment gap for mental illness in the EMR and other parts of the world is by providing front-line workers with the skills to recognize and manage common mental illness and to iden- tify patients with severe illness at their earlier stage so that they can be helped through specialist services. Based on their extensive clinical and research experience Sharma, Copeland and oth- ers have spent over 15 years developing  the Global Mental Health Assessment Tool—Primary Care version (GM- HAT/PC), a computer-assisted clini- cal tool to assess and diagnose and treat mental illness in primary and general health care settings. This has been fur- ther refined by trials in routine clinical practice in different settings, with input from general practitioners, patients and carers. GMHAT/PC was subjected to reliability and validity studies in primary care as well as in medical set- tings including among older people [7–11]. The aim of the present study was to validate the Arabic version of the GMHAT/PC and to examine its feasibility and acceptability in an Arab population. Methods Description of the GMHAT/PC The GMHAT/PC is a semi-structured, computerized clinical assessment tool that is developed to assist health work- ers in making quick, convenient and comprehensive standardized mental health assessments in both primary and general health care. The program starts with basic instructions giving details of how to use the assessment tool and rate the symptoms. The first 2 screens help in get- ting brief background details including present, past, personal and social history including history of trauma, epilepsy and learning disorders. The following screens consist of a series of questions leading to a comprehensive yet quick mental state assessment. They start with 2 screening questions about every ma- jor symptom complex followed by ad- ditional questions only if the screening questions are positive. The questions cover the following symptom areas: worries, anxiety and panic attacks, con- centration, depressed mood, includ- ing suicidal risk, sleep, appetite, eating disorders, hypochondriasis, obsessions and compulsions, phobia, mania, psychotic symptoms, disorientation, memory impairment, alcohol misuse, il- legal drug misuse, personality problems and stressors. The questions proceed in a clinical order along a tree-branch structure. Many of the GMHAT/PC items have been adapted for the full adult range from the Geriatric Mental State (GMS/AGECAT) schedule [12],  which is extensively used worldwide in numerous epidemiological studies. Ratings are made by the interviewer using his or her clinical skills to judge the severity of each symptom, thus making the GMHAT/PC a semi-structured interview. The computer-assisted diagnostic algorithm takes account of clinical di- agnostic practices based on presence of symptoms. The printable output summary report includes background descriptive details, a list of symptoms with their severity as well as their scores, risk of self-harm, the GMHAT/ PC main diagnosis and additional diagnoses. The additional diagnoses or comorbid states, are based on the presence of other mental illness symp- toms and disorders. Clinicians who used GMHAT/PC found the list of all possible mental health diagnoses very useful, as it helped them in their overall understanding of the patients’ mental health issues and for planning their treatments. The program contains evidence- based management guidelines for most disorders, and for most psychotic disorders recommends referral to mental health services. If interviews are repeated over time on a patient, the program also produces a summary table of symptom ratings of all interviews, providing a clear indication of progress between interviews Study design The Arabic version of GMHAT/PC was developed using the standard method used in the translation of GMHAT/PC into other languages. The GMHAT/ طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 907 PC questions were translated into standard Arabic language by a clinician with a sound knowledge of Arabic. An independent translator translated back from Arabic to English. The English back translation was compared with the original GMHAT/PC questions by the GMHAT/PC steering group. The Arabic version was used in this study for interviews. We also assessed whether the tool was acceptable in this culture. Data collection The study was carried out in 2 settings  in Abu Dhabi, as follows. Mental health setting One trained psychiatric nurse used GMHAT/PC for assessment of all patients attending the outpatient clinic in the Behaviour Science Pavilion, Abu Dhabi, United Arab Emirates. Patients were informed and included after ob- taining their consent to take part in the study. One qualified psychiatrist made clinical assessment independently and arrived at clinical diagnosis based on the International Statistical Clas- sification of Diseases and Related Health Problems, 10th  revision (ICD-10). The psychiatrist was unaware of the com- puter (GMHAT/PC) diagnosis and of any previous mental health problems. Patients were referred to this clinic by general practitioners, liaison psychiatry teams or other health teams, and had varying degrees of mental illness. Rehabilitation setting In the rehabilitation unit another com- munity nurse used GMHAT/PC and the psychiatrist attached to the unit made an independent clinical assess- ment, as described above. Most of the patients included had a history of mental health problems. The rehabilita- tion setting included a day centre and community care mental health team. Patients were referred to this service from outpatients, inpatients to help early discharge and home care teams. Results A total of 50 patients were  interviewed  (23 men and 27 women). The age range  was 19–69 years, with  a mean age of  37 years. The mean  time  taken  for  the  interviews was 16 minutes. None of the  patients declined to be interviewed. A total of 17 patients were identified by the psychiatrist has having no mental health  illness, while  33 patients were  identified has having mental health ill- ness. There were no significant differ- ences  in  ages  between  the  2  groups:  mean  ages were  38.4  and  36.2  years  respectively. Similarly there was also no significant difference in the sex distribu- tion between the 2 groups. Of 33 patients diagnosed as having  mental  illnesses by  the psychiatrist 32  were also diagnostic cases of mental ill- ness according to nurses administering the GMHAT/PC. Of the 17 cases with- out mental illness diagnosis by the psy- chiatrist, 16 were correctly diagnosed  as having no illness by GMHAT/PC, thus giving a kappa value for diagnostic agreement of 0.91 (95% CI: 0.79–1.00)  with sensitivity of 97% (95% CI: 91%– 100%) and specificity of 94% (95% CI:  83%–100%). For anxiety and depression the kappa value for diagnostic agreement was 0.75  (95% CI: 0.56–0.96), with  a  sensitivity  of  86%  (12/14)  (95%  CI: 67%–100%)  and a  specificity of  92% (33/36) (95% CI: 83%–100%).  For psychosis, the diagnostic agree- ment kappa value was 0.76 (95% CI:  0.52–0.96), with a  sensitivity of 71%  (10/14)  (95% CI:  47%–95%)  and  specificity of 97% (35/36) (95% CI:  91%–100%) The cross-tabulation of psychia- trist’s ICD-10 based clinical diagnoses and GMHAT/PC diagnoses is given in Table 1. Finally, basic feedback was also ob- tained from the patients and interview- ers. All patients were asked how they felt about the interview and whether they understood the questions. The nurses who administered GMHAT/PC were asked about their feedback on using the tool. The patients easily understood the questions and readily accepted the in- terview. The feedback from the nurses’ interviews was generally very positive, Table 1 Cross-tabulation of the number of patients diagnosed by the psychiatrist based on clinical judgement and by the nurse using the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC) Psychiatrist clinical diagnosis Nurse GMHAT/PC diagnosis No mental illness Organic mental disorder Psychosis Depression Anxiety/ neurosis Eating disorder Total No mental illness 16 0 0 0 0 1 17 Organic mental disorder 0 1 0 0 0 0 1 Psychosis 0 3 10 1 0 14 Depression 0 0 9 0 1 10 Anxiety/ neurosis 1 0 1 1 3 1 7 Eating disorder 0 0 0 1 0 0 1 Total 17 4 11 12 3 3 50 EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 908 except that they wished that they had more training in using the GMHAT/ PC-based interview. Discussion The findings were very encouraging as the nurses could easily administer the GMHAT/PC interview in the Arabic population in a reasonable time frame of approximately 16 minutes. The pa- tients easily understood the questions and readily accepted the interview. The feedback from the nurses’ interviews was generally very positive, except that they wished that they had more train- ing in using the GMHAT/PC based interview. Good agreement was found be- tween the psychiatrist’s ICD-10 based clinical diagnosis and the GMHAT/PC interview diagnosis, with good sensitiv- ity and specificity, which makes GM- HAT/PC a practical clinical tool for health professionals in Arabic-speaking regions. Mental health treatment needs of the population remain neglected in the EMR due to inadequate resources but more importantly due to lack of awareness, training and knowledge of health professionals to deal with men- tal health problems in their communi- ties. Easy access to computers even in remote regions makes it feasible to use computers for routine assessments. GMHAT/PC could therefore fill an important gap in equipping health workers with the skills for diagnosing mental illness in their populations and directing them towards appropriate treatments. The study had some limitations, particularly in that the number of pa- tients interviewed was small and the interview setting was a hospital setting. Further work is therefore needed in as- sessing the feasibility and psychomet- rics of the Arabic version of GMHAT/ PC in the primary care and general health setting. However, this small pi- lot study demonstrates the feasibility and applicability for using GMHAT/ PC to diagnose mental illness in this population. Acknowledgements The GMHAT/PC will be available for free download from: http://www. gmhat.org. Funding: No specific grant. Competing interests: None declared. References 1. Mental health systems in the Eastern Mediterranean Region. Re- port based on the WHO assessment instrument for mental health systems. Cairo, World Health Organization Regional Office for the Eastern Mediterranean, 2010 (EMRO Technical Publica- tions Series No. 37). 2. Gender and women’s mental health. Geneva, World Health Organization, 2006. 3. Daradkeh TK, Eapen V, Ghubash R. Mental morbidity in pri- mary care in Al Ain (UAE): Application of the Arabic translation of the PRIME-MD (PHQ) Version. German Journal of Psychiatry, 2005, 8:32–35. 4. Ghubash R et al. A comparison of the validity of two psychiatric screening questionnaires: the Arabic General Health Ques- tionnaire (AGHQ) and Self-Reporting Questionnaire (SRQ-20) in UAE, using Receiver Operating Characteristic (ROC) analy- sis. European Psychiatry, 2001, 16:122–126. 5. Daradkeh TK et al. The rationale, development and reliability of a new screening psychiatric instrument. Social Psychiatry and Psychiatric Epidemiology, 1999, 34:223–228. 6. El-Rufaie OE, Absood GH, Abou-Saleh MT. The primary care anxiety and depression (PCAD) scale: a culture-oriented screening scale. Acta Psychiatrica Scandinavica, 1997, 95:119–124. 7. Sharma VK et al. The Global Mental Health Assessment Tool— Primary Care Version (GMHAT/PC). Development, reliability and validity. World Psychiatry, 2004, 3:115–119. 8. Sharma VK et al. Mental health diagnosis by nurses using the Global Mental Health Assessment Tool: a validity and feasibility study. British Journal of General Practice, 2008, 58:411–416. 9. Krishna M et al. Epidemiological and clinical use of GMHAT- PC (Global Mental Health Assessment Tool— primary care) in cardiac patients. Clinical Practice and Epidemiology in Mental Health, 2009, 13:5–7. 10. Sharma VK et al. Validation and feasibility of the Global Mental Health Assessment Tool—Primary Care Version (GMHAT/PC) in older adults. Age and Ageing, 2010, 39:496–499. 11. Sharma VK et al. The global mental health assessment tool- validation of GMHAT/PC in Hindi: a validity and feasibility study. Indian Journal of Psychiatry, 2010, 52:349–352. 12. Copeland JR, Dewey ME, Griffiths-Jones HM. A computer- ized psychiatric diagnostic system and case nomenclature for elderly subjects: GMS and AGECAT. Psychological Medicine, 1986, 16:89–99. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 909 Predictors of smoking among male college students in Saudi Arabia Y.S. Almogbel,1 S.M. Abughosh,1 F.S. Almogbel,2 I.A. Alhaidar 3 and S.S. Sansgiry 1 ABSTRACT Identifying the predictors of smoking in one of the top cigarette-consuming countries in the world is a vital step in smoking prevention. A cross-sectional study assessed the predictors of smoking in a cohort of male students in 3 universities in Saudi Arabia. A pre-tested, validated questionnaire was used to determine sociodemographic characteristics, academic performance, peers’ smoking, and presence of a smoker within the family. Of the 337 participants, 30.9% were current smokers (smoked 1 or more cigarettes within the last 30 days). Lower academic performance (OR = 2.29, 95% CI: 1.02–5.17), peer smoking (OR = 4.14, 95% CI: 1.53–11.3) and presence of other smokers in the family (OR = 2.77, 95% CI: 1.37–5.64) were the significant predictors of smoking status identified using multiple logistic regression analysis. These findings highlight the influence of family and peer pressure in initiating cigarette use among the youth of Saudi Arabia. 1Department of Clinical Sciences and Administration, College of Pharmacy, University of Houston, Houston, Texas, United States of America (Correspondence to S.S. Sansgiry: ssansgiry@uh.edu). 2Department of Community and Family Medicine, College of Medicine, King Saud University, Riyadh, Saudi Arabia. 3Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal University, Al-Ahsa, Saudi Arabia. Received: 04/09/12; accepted: 04/11/12 ةيدوعسلا ةيبرعلا ةكلملما في تاعمالجا بلاط ينب ينخدتلاب تائبنلما ييرجسناس تيجوس ،رديلحا ميهاربإ ،لبقلما لصيف ،شوغ وبأ نسوس ،لبقلما سراي نم ةياقولا في ةيهملأا ةغلاب ةوطخ لماعلا في رئاجسلا ينخدت في ةمقلا لتتح يتلا نادلبلا نم ٍدحاو في ينخدتلاب تائبنلما لىع ف ُّرعتلا برتعي :ةـصلالخا .ةيدوعسلا ةيبرعلا ةكلملما في تاعماج ثلاث في بلاطلا نم ٍروكذ ٍبارتأ ىدل ينخدتلا تائبنم مييقتل ةضرعتسم ةسارد نوثحابلا ىرجأ دقو .ينخدتلا ينخدتو ،يميداكلأا ءادلأاو ،ةيفارغوميدلاو ةيعماتجلاا صئاصلخا لىع ف ُّرعتلا لجأ نم هرابتخاو هتحص نم ققحتلا مت ًانايبتسا نوثحابلا مدختساو رثكأ وأ ةدحاو ةراجيس اونخد( ًايلاح يننخدلما نم مهنم %30.9 ناكو ،ًاكراشم 337 ةساردلا تلمش دقو .ةسرلأا نمض يننخدم دوجوو ،ءلامزلا ليلتح مادختساب ينخدتلا ثيح نم عضولل ةبسنلاب اهيلع فرعتلا مت يتلاو ًايئاصحإ ابه دتعي يتلا تائبنلما تناكو ،)ةمصرنلما ينثلاثلا مايلأا للاخ ينخدتو ،)5.17و 1.02 ينب تاسايقلا حواترت ،%95 ةقثلا ةترف ،2.29 ةيحجرلأا ةبسن( ضفخنلما يميداكلأا ءادلأا :يه تا ِّريرغتلما ددعتم يتسجول فيوتح ةقثلا ةترف ،2.77 ةيحجرلأا ةبسن( ةسرلأا نمض يننخدم دوجوو ،)11.3 – 1.53 ينب تاسايقلا حواترت ،%95 ةقثلا ةترف ،4.14 ةيحجرلأا ةبسن( ءلامزلا .ينيدوعسلا بابشلا ينب رئاجسلا ينخدتب ءدبلا لىع ءلامزلاو ةسرلأا طغض يرثأت جئاتنلا هذه حضوتو .)5.64و 1.37 ينب تاسايقلا حواترت ،%95 Facteurs prédictifs de tabagisme chez des étudiants de sexe masculin en Arabie saoudite RÉSUMÉ Identifier les facteurs prédictifs de tabagisme dans l’un des premiers pays consommateurs de cigarettes au monde est une étape essentielle dans la prévention du tabagisme. Une étude transversale a évalué les facteurs prédictifs du tabagisme dans une cohorte d’étudiants de sexe masculin dans trois universités en Arabie saoudite. Un questionnaire validé et prétesté a été utilisé pour recueillir des données sur les caractéristiques sociodémographiques des répondants, leurs résultats universitaires, la présence de fumeurs parmi leurs pairs et dans leur famille. Sur 337 participants, 30,9 % étaient des fumeurs actifs, c’est-à-dire qu’ils avaient fumé au moins une cigarette au cours des 30 derniers jours. Des résultats universitaires plus faibles (O.R. = 2,29 ; IC à 95 % : 1,02–5,17), la présence de fumeurs parmi leurs pairs (O.R. = 4,14 ; IC à 95 % : 1,53–11,3) et dans leur famille (O.R. = 2,77 ; IC à 95 % : 1,37–5,64) étaient les facteurs prédictifs de tabagisme significatifs identifiés à l’analyse de régression logistique multiple. Ces résultats soulignent l’influence exercée par les membres de la famille et la pression placée par les pairs sur les jeunes d’Arabie saoudite pour qu'ils se mettent à fumer. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 910 Introduction Smoking is the leading prevent- able cause of death, responsible for 5.6 million deaths  around  the world  [1–3]. Saudi Arabia  is one of  the  top  10 cigarette-importing countries in the  world  [3]. The  estimated  economic,  social and health costs associated with all tobacco use in the country was estimated  to be $1.3 billion  in 2010,  with males contributing the most to this estimate [4]. The prevalence of smoking in Saudi Arabia has been reported  to be  as high  as 52.3%,  and  among school and university students it has reached an alarming rate of 30%  and 50% respectively [5]. Furthermore,  comparison of Global Youth Tobacco Surveys  of  13–15-year-olds  found  a  30%  increase  in  smoking prevalence  in Saudi Arabian males between 2001  to 2007 [6]. The majority of  smokers  in Saudi Arabia start smoking before the  age of  15  years  [5]. The price of  cigarettes makes them affordable to most children, and there is no strict ap- plication of the minimum legal age for purchasing cigarettes [7]. The reported prevalence among men (13%–38%) is  much higher than that among women (1%–16%) [8], presumably due to the  local culture and traditions in Saudi Arabia whereby smoking by females is considered shameful [9]. Addressing factors associated with smoking is a crucial strategy for reducing the number of smokers and improving the health of a nation. A considerable amount of literature has been published on the predictors of smoking, but not specifically within the Saudi Arabia pop- ulation. Variables such as age, income, academic performance, peer pressure and family members smoking have been shown to be significant predictors of smoking around the world [10–15].  In particular, smoking by young adults was a strong predictor of smoking be- haviour in adulthood [11]. A study of 1200 young American adults  reported  that initiation of cigarette smoking at an early age was associated with higher cigarette consumption, greater nicotine dependence and longer duration of smoking [16]. Cigarette smoking is a major health concern in the male population of Saudi Arabia and the government needs to consider addressing it using behavioural and/or educational interventions. Due to the lack of adequate research in Saudi Arabia on the predictors of smoking behaviour, and considering the cultural differences compared with other nations as well as the high preva- lence of smoking in young males, our study sought to identify the predictors of smoking in a cohort of young male Saudi Arabian university students. The goal was to inform strategies that would improve resource allocation to anti- smoking interventions. Methods Study design and data source An observational, cross-sectional study was made to predict smoking among a sample of Saudi Arabian male col- lege students. Data were collected from December 2011 to January 2012 using  a pretested, validated, self-administered survey [17]. The survey was distributed in 3 government universities  in Saudi  Arabia. Two of the selected universities provide general higher education (un- specialized) opportunities. The third institute is a technical college that fo- cuses on computer, engineering and in- dustrial sciences. One of the universities is located in the east of Saudi Arabia (Al Hassa). The second university and the technical college are in the Al Qassim region, which is located in the central part of Saudi Arabia. The total number of  students within  the 3  institutes was  about 70 000. Convenience sampling strategy with a goal of at  least 400 participants  was considered in this study. Within the universities, 4 health and 1 computer school agreed to assist in data collection. The teaching faculty at each institute assisted in distributing the surveys. Surveys were administered to students during  the  last 15–20 minutes of  their  lecture. Students were requested by teachers to participate by anonymously filling out a survey about their smoking behaviour and to drop the completed survey in a box that was available in each lecture room. All boxes were collected after the lectures ended. Participation in the study was voluntary, and an informed consent letter was provided before proceeding with the data col- lection. The survey was approved by the institutional review board at the University of Houston. Survey design The questionnaire was developed in English and translated into Arabic language using a translation and back- translation method [18]. The translated  survey was validated with the help of 3 bilingual  experts  and was pretested  for reliability using the test–retest reli- ability method  for 10  subjects before  commencing the data collection. The variables considered in this study were part of a larger survey that consisted of 56 questions divided  into  7 sections in a 4-page-long survey. In this study, the variables considered were smoking status, age, age first initiated smoking, income, marital status, aca- demic performance, peer smokers and presence of smokers within the family, such as mother, father, brother or any other family member (non-first-degree relative). Smoking status was the main outcome variable evaluated, and a participant was considered a current smoker if he had smoked 1 cigarette or more within  the  last 30 days. Age  was divided  in 4 groups,  from 18–20  years  to > 26 years. Participants were  also asked to report age of initiation of smoking.  Income was divided  into 2  categories according to maximum fi- nancial aid for Saudi students: > 12000  Saudi  riyals/year  (US$ 3200/year)  طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 911 and ≤ 12000 Saudi  riyals/year (US$  3200/year). The marital  status  vari- able was classified as single or married. Students’ academic performance was measured by asking the participant what grade they received in school, with 4 choices: A, B, C or D. For peer smokers, respondents were asked if any of their friends were smokers (yes or no). The presence of a smoker within the family was categorized using 4 variables: mother, father, brother or any other smoker at home (non- first-degree relative). Participants were asked if any of their family members were smokers or former smokers (yes or no). These variables were selected based on previous studies and through pilot testing [10–15]. Statistical analysis Descriptive statistics and bivariate analy- sis was used to identify the predictors of smoking. Any variable with a probability of 0.2 or less in the bivariate analysis was  retained in the final multiple logistic re- gression. A multiple logistic regression model was performed to determine the predictors of smoking. Data were coded and entered using Microsoft Excel 2010,  and data was analysed using SAS, ver- sion 9.3. Results A total of 467 out of 920 surveys were  received from students at the 3 universi- ties, a net  response  rate of 50.8%. Due  to data missing for the main outcome variable, 130 surveys were excluded pro- viding a net response rate of 36.6%. The  mean age was 22.2 (SD 2.2) years. The  majority (66.5%) of participants were  between 21 and 23 years old and single  marital status (96.3%) (Table 1). Near- ly  two-thirds of  participants  (77.4%)  were receiving ≤ US$ 3200/year. Most  respondents (79.5%) had scored A or B  throughout their academic life. About 78.2% of participants reported that they  had at least 1 smoker friend and 33.4%  had at least 1 smoker brother. About 34% of participants  indicated that  they  had 1 or more other smoker members of their family at home (non-first-degree relative). Almost one-third of participants (104,  30.9%) were  current  smokers.  The average reported age for initiating the  smoking habit was 15.0  (SD 4.7)  years, with a median of 16 and a range  of 8–30 years. The results of the bivariate analy- sis of smoking status are summarized in Table 1. Significantly more smok- ers  (29.8%) had a  reported  income >  US$ 3200/year  than did non-smokers  (19.3%) (P = 0.033). Smokers had sig- nificantly lower educational grades that non-smokers,  e.g. 29.7% had achieved  grade A versus 44.8% of non-smokers  (P = 0.004). Significantly more  smok- ers than non-smokers reported having at  least  1  friend who  smoked  (92.9%  versus 72.3%)  (P  < 0.001),  having  at  least 1  smoker brother  (43.7% versus  29.3%)  (P  =  0.017)  and having  1  or  more smoker non-first-degree relatives at  home  (48.2%  versus  28.4%)  (P = 0.001). Table 2 presents  the  results of  the  multiple logistic regression of smoking status with all variables that had a signifi- cant  level of 0.2 or  less  in  the bivariate  analysis. The risk of smoking increased about 2-fold (OR = 2.29, 95% CI: 1.02– 5.17) with  low academic performance  (grades C to D). The risk of being a smoker was higher for respondents with friends who smoked (OR = 4.14, 95%  CI: 1.53–11.3) and with other smokers  in the family (non-first-degree relatives) (OR = 2.77, 95% CI: 1.35–5.64). Discussion In our cohort of male university students, the percentage of current smokers, i.e. individuals who smoked at least 1 cigarette during the last month, was 30.9%. This was consistent with 2  other studies that were conducted in similar geographic areas to our study. One  carried  out  in  2003  on  2203  secondary-school male students in Al Qassim, Saudi Arabia found that 29.8%  of respondents were smokers [19]. The second study in 2006 on 1652 second- ary male students in Al Hassa, Saudi Arabia  found  that 30.3% were current  smokers  [20].  In  the  current  study,  the influence of peers and families on smoking behaviour was apparent. Peer smokers such as friends and the presence of other smokers (other than father, mother or brother) at home were significant predictors of smoking status for male college students in Saudi Arabia. Academic performance was associated with smoking status, as low grades increased the risk of smoking. Smoking in American adolescence and young adulthood has been reported as a predictor of adult smoking [11]. In the current study, age was not associ- ated with smoking status because most smokers in Saudi Arabia begin smoking at an early age (mostly below 15 years)  [21–23] and our sample had a narrow  focused cohort of only university stu- dents. The average age of this sample was 22 years,  as  the entire  sample was  recruited from the undergraduate col- lege student population. Thus, the age effect was not, or might not be, captured in this study. Income in our study was associated with an increase in risk of smoking in the bivariate analysis but was insignificant after controlling for potential confound- ers in the multiple logistic regression model. This result differs from a survey by Khader  et  al.  in 2005 on 712 uni- versity  students  in  Jordan  [10]. They  found that income increased the risk of smoking among students. Academic performance was a signif- icant predictor of smoking in our study. Students with lower grades (C to D) were  found to have a 2.3  times greater  likelihood of being smokers compared with those who had higher (A) grades. The academic performance variable was used  in 2 previously  reported smoking  EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 912 predictor studies [12,14]. Both of these  studies found a strong association between low academic performance and smoking, which was consistent with our study findings. The first study was conducted on American students in 1992, and  found  that  lower grades  increased the likelihood of smoking status  by  2.6-fold  [10]. The  second  study was done  in 2005 on Jordanian  students and reported that having grade C was associated with a 4-fold risk of smoking compared with having grade A [12]. Consistent with the reported lit- erature, our study found that having at least 1 smoker friend increased the risk of being a smoker 4-fold. A study in  2006 on middle-  and high-school  students in Cyprus reported that the strongest predictor of smoking during Table 1 Demographic characteristics and bivariate analysis of smoking status among Saudi Arabian male college students Characteristic Total (n = 337)a Non-smokers (n = 233) Smokers (n = 104) P-value No. % No. % No. % Age group (years) 18–20 50 15.7 39 17.3 11 11.7 0.132 21–23 212 66.4 150 66.7 62 66.0 24–26 42 13.2 24 10.7 18 19.1 > 26 15 4.7 12 5.3 3 3.2 Marital status Married 12 3.7 7 3.1 5 5.0 0.391 Unmarried 316 96.3 221 96.9 95 95.0 Income (US$/year) > 3200 76 22.6 45 19.3 31 29.8 0.033 ≤ 3200 261 77.4 188 80.7 73 70.2 Academic performance Grade A 133 40.2 103 44.8 30 29.7 0.004 Grade B 130 39.3 90 39.1 40 39.6 Grades C to D 68 20.5 37 16.1 31 30.7 Having a smoker friend Yes 233 78.2 154 72.3 79 92.9 < 0.001 No 65 21.8 59 27.7 6 7.1 Current or former smoker in the family All (as a family) Yes 116 38.0 90 41.5 26 29.5 0.052 No 189 62.0 127 58.5 62 70.5 Mother Yes 60 19.9. 43 20.1 17 19.3 0.890 No 242 80.1 171 79.9 71 80.7 Father Yes 119 39.4 80 37.0 39 45.4 0.182 No 183 60.6 136 63.0 47 54.7 Brother Yes 101 33.4 63 29.3 38 43.7 0.017 No 201 66.6 152 70.7 49 56.3 Any other smokers in the family Yes 99 34.0 59 28.4 40 48.2 0.001 No 192 66.0 149 71.6 43 51.8 aThe numbers may not total 337 for some variables due to missing values. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 913 both early and late adolescence was peers’ smoking status, as it increased the smoking risk by 20-fold [14]. Addition- ally, a study conducted in 2010 on male  Saudi Arabian school students aged 16–18 years  reported  that having peer  smokers increased the risk of smoking by 3.5-fold [24]. A longitudinal study conducted between 1991 and 1994 on 3rd to 8th  grade students in the United States reported that having a family member who smoked at home was a significant predictor of smoking at an early age [15]. In our study having 2 smokers in  the family, i.e. brother and any other (non-first-degree relative), was signifi- cant in the bivariate analysis. But after adjusting for confounders in the mul- tiple logistic regression model, only 1 variable (other smokers in the family) was significantly associated with the risk of smoking. This suggests that par- ticipants in our study were influenced by other members of the family or brothers, namely individuals they could related to in their social context, rather than their father. A number of limitations need to be considered before applying the findings of this study. Cross- sectional study designs can identify Table 2 Multiple logistic regression results of smoking status among Saudi male college students Variable OR (95% CI) P-value Age group (years) 18–21 1 21–23 1.40 (0.59–3.35) 0.448 24–26 1.43 (0.47–4.29) 0.527 > 26 1.11 (0.23–5.29) 0.897 Income(US$/year) > 3200 1.57 (0.81–3.07) 0.186 ≤ 3200 1 Academic performance Grade A 1 Grade B 1.40 (0.71–2.76) 0.328 Grades C to D 2.29 (1.02–5.17) 0.045 Having a smoker friend Yes 4.14 (1.53–11.3) 0.005 No 1 Current or former smoker mother Yes 0.56 (0.22–1.39) 0.209 No 1 Current or former smoker father Yes 1.58 (0.80–3.13) 0.185 No 1 Current or former smoker brother Yes 0.91 (0.44–1.87) 0.8 No 1 Any other current or former smoker in the family Yes 2.77 (1.37–5.64) 0.005 No 1 OR = odds ratio; CI = confidence interval. the association between a predicted variable and the predictors, but cannot establish causality. The generalizability of these findings is limited to similar populations of college students in Saudi Arabia. Finally, this study was done using a convenience sample. Therefore, non-participants were not characterized and the influence of non-participation due to possible reporting of smoking behaviour was not captured. The results suggest that an educa- tional and consultation programme for families could be effective in reducing the number of smokers. Furthermore, educating students on the harm of smoking and the impact of peers could aid in the prevention of smoking. Start- ing such educational campaigns at an early age may influence students to not initiate smoking. Educational advertise- ments that highlight the role of fam- ily and the role that friends play in the process can provide added benefit in reducing smoking behaviour in Saudi Arabia. Conclusions This study identified predictors of smoking in male college students in Saudi Arabia. We found that lower academic performance, peer smoking and the presence of other smokers in the family were significant predictors of smoking status. Despite application of the WHO Monitor Protect Offer Warn Enforce Raise (MPOWER) framework recommendations in Saudi Arabia, more efforts should be made to protect the youth population in areas where youth reside such as universities. Acknowledgements Funding: None. Competing interests: None declared. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 914 References 1. Leung CM et al. Fighting tobacco smoking—a difficult but not impossible battle. International Journal of Environmental Re- search and Public Health, 2009, 6:69–83. 2. Tobacco fact sheet. World Health Organization [on- line factsheet] (http://www.wpro.who.int/mediacentre/ factsheets/fs_201203_tobacco/en/index.html, accessed 12 September 2013). 3. Mackay J, Eriksen M. The tobacco atlas. Geneva: World Health Organization; 2002. 4. Munif MA. Report on tobacco control program of Ministry of Health in Saudi Arabia. Riyadh, Saudi Arabia, Ministry of Health, 2009 (http://www.tcp-sa.info/photos/files/REPORT_ ON_TCP.pdf, accessed 12 September 2013). 5. Bassiony MM. Smoking in Saudi Arabia. Saudi Medical Journal, 2009, 30:876–881. 6. Al-Bedah AM et al. The Global Youth Tobacco Survey—2007. Saudi Medical Journal, 2010, 31:1036–1043. 7. Abdalla AM et al. Correlates of ever-smoking habit among adolescents in Tabuk, Saudi Arabia. Eastern Mediterranean Health Journal, 2009, 15:983–992. 8. [Highlights demographic survey 1428H (2007)]. Demographic research bulletin 1428. Saudi Arabia Central Department of Statistics and Information [online] (http://www.cdsi.gov. sa/english/index.php?option=com_docman&task=cat_ view&gid=43&Itemid=113, accessed 12 September 2013) [in Arabic]. 9. Jarallah JS et al. Prevalence and determinants of smoking in three regions of Saudi Arabia. Tobacco Control, 1999, 8:53–56. 10. Murthy P, Subodh BN. Current developments in behavioral interventions for tobacco cessation. Current Opinion in Psy- chiatry, 2010, 23:151–156. 11. Weekley CK, Klesges RC, Reylea G. Smoking as a weight- control strategy and its relationship to smoking status. Addictive Behaviors, 1992, 17:259–271. 12. Khader YS, Alsadi AA. Smoking habits among university stu- dents in Jordan: prevalence and associated factors. Eastern Mediterranean Health Journal, 2008, 14:897–904. 13. Dusenbury L et al. Predictors of smoking prevalence among New York Latino youth. American Journal of Public Health, 1992, 82:55–58. 14. Christophi CA et al. Main determinants of cigarette smoking in youth based on the 2006 Cyprus GYTS. Preventive Medicine, 2009, 48:232–236. 15. Johnson CC et al. Fifth through eighth grade longitudinal predictors of tobacco use among a racially diverse cohort: CATCH. Journal of School Health, 2002, 72:58–64. 16. Breslau N, Fenn N, Peterson EL. Early smoking initiation and nicotine dependence in a cohort of young adults. Drug and Alcohol Dependence, 1993, 33:129–137. 17. Wu IH et al. Cigarette smoking among Taiwanese adults. Epide- miology, 2011, 1:107. doi:10.4172/2161-1165.1000107. 18. Brislin RW. Back-translation for cross-cultural research. Journal of Cross-Cultural Psychology, 1970, 1:185–216. 19. Al-Damegh SA et al. Cigarette smoking behavior among male secondary school students in the Central region of Saudi Ara- bia. Saudi Medical Journal, 2004, 25:215–219. 20. Al-Mohamed HI, Amin TT. Pattern and prevalence of smok- ing among students at King Faisal University, Al Hassa, Saudi Arabia. Eastern Mediterranean Health Journal, 2010, 16:56–64. 21. Saeed AA, Al-Johali EA, Al-Shahry AH. Smoking habits of students in secondary health institutes in Riyadh City, Saudi Arabia. Journal of the Royal Society of Health, 1993, 113:132–135. 22. Al-Faris EA. Smoking habits of secondary school boys in rural Riyadh. Public Health, 1995, 109:47–55. 23. Saeed AA, Khoja TA, Khan SB. Smoking behaviour and atti- tudes among adult Saudi nationals in Riyadh city, Saudi Arabia. Tobacco Control, 1996, 5:215–219. 24. Al Ghobain MO et al. Prevalence and characteristics of ciga- rette smoking among 16 to 18 years old boys and girls in Saudi Arabia. Annals of Thoracic Medicine, 2011, 6:137–140. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 915 Salt intake in Eastern Saudi Arabia A.M. Alkhunaizi,1 H.A. Al Jishi 2 and Z.A. Al Sadah 2 ABSTRACT High salt intake has been associated with adverse side-effects such as hypertension and cardiovascular disease. The amount of salt intake among the population of Saudi Arabia is not known. The objective of this study was to estimate the salt intake among residents of the Eastern region of Saudi Arabia by measuring 24-hour urinary sodium excretion. Urine samples were collected from 130 individuals aged over 14 years for measurement of levels of sodium and other electrolytes. A total of 87 samples met the criteria for accuracy and were analysed. Total mean 24-hour sodium excretion for the group was 140 (SD 49) mEq [153 (SD 52) mEq for males and 118 (SD 37) mEq for females]. These values exceed the recommended daily intake of sodium and may contribute to the risk of developing hypertension and cardiovascular disease in Saudi Arabia. 1Internal Medicine Services Division, Nephrology Section; 2Department of Nursing, Dhahran Health Centre, Dhahran, Saudi Arabia (Correspondence to A.M. Alkhunaizi: aalkhunaizi@hotmail.com; ahmed.khunaizi@aramco.com). Received: 09/04/12; accepted: 14/10/12 ةيدوعسلا ةيبرعلا ةكلملما قشر في حللما لوانت ةداسلا يولع بنيز ،شيلجا يدالها دبع ةلاه ،يزينلخا روصنم دحمأ ةيمك فورعلما يرغ نمو .ةيعولأاو بلقلا ضارمأو مدلا طغض عافترا لثم ةرئاض ةيبناج تايرثأت حللما نم ةيربك ريداقم لوانت قفاري :ةـصلالخا ةكلملما في ةيقشرلا ةقطنلما ناكس ينب حللما نم لوانتلما ةيمك ريدقت لىإ ةساردلا هذه فدتهو .ةيدوعسلا ةيبرعلا ةكلملما في ناكسلا الهوانتي يتلا حللما قوف مهرماعأ ًاصخش 130 نم لوبلا تانيع نوثحابلا عجم دقو .ةعاس 24 للاخ لوبلا في غرفلما مويدوصلا ةيمك سايق للاخ نم ةيدوعسلا ةيبرعلا مويدوصلا غارفإ يطسو ناكو .اهليلتح متف ،ةقدلا يرياعمب تفو دق ةنيع 87 نأ حضتاو .ىرخلأا تايلرهكلاو مويدوصلا تايوتسم اوساقو ،ًاماع 14 ئفاكم لييم 118 ثانلإلو ،)52 يرايعم فارحناب( 153 روكذلل[ ،)ئفاكم لييم 49يرايعم فارحناب( ئفاكم لييم 140 ةسوردلما ةئفلا في ةعاس 24 في ضرلماو مدلا طغض عافتراب ةباصلإا رطخ في مهاست دقو ،مويدوصلا نم ًايموي هلوانتب صىولما رادقلما ميقلا هذه زواجتتو .])37 يرايعم فارحناب( .ةيدوعسلا ةيبرعلا ةكلملما في يئاعولا يبلقلا Apport en sel dans l’est de l’Arabie saoudite RÉSUMÉ Un apport élevé en sel a été associé à des effets secondaires indésirables tels que l’hypertension et des maladies cardio-vasculaires. La quantité de sel consommée par la population d’Arabie saoudite n’est pas connue. L’objectif de la présente étude était d’estimer l'apport en sel chez des résidents de la région est d’Arabie saoudite en mesurant leur excrétion urinaire de sodium en 24 heures. Des échantillons d’urine ont été recueillis auprès de 130 personnes âgées de plus de 14 ans afin de mesurer les concentrations de sodium et d’autres électrolytes. Au total, 87 échantillons ont satisfait aux critères de précision et ont été analysés. L’excrétion de sodium moyenne totale en 24 heures pour le groupe était de 140 mEq (E.T. 49) (153 mEq [E.T. 52] pour les hommes et 118 mEq [E.T. 37] pour les femmes). Ces valeurs sont supérieures à celles recommandées pour l'apport en sodium quotidien et représentent un risque de survenue d’hypertension et de maladies cardio- vasculaires dans la population saoudienne. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 916 Introduction High levels of salt intake in the form of sodium chloride are associated with adverse events such as the development of hypertension, cardiovascular events and strokes [1–4]. Reducing dietary salt intake could substantially reduce cardiovascular events and strokes and may increase people’s lifespan and re- duce national health-care expenditures [5–9]. The World Health Organiza- tion (WHO) has recommended salt reduction as a top priority for tackling noncommunicable diseases and has considered this a public health target [10]. Similarly, the Institute of Medicine  (IOM) in the United States has issued recommendations to decrease sodium intake [11]. There is a great variation in salt intake between different populations, ranging from 1 mEq/day among the Yanomamo Indians in the Amazon valley in Brazil to 299 mEq/day  in  some parts of China  [12–15]. The  amount  of  salt  intake  among the population of Saudi Arabia is not known. The aim of this study was to measure 24-hour urinary sodium excre- tion in order to estimate the sodium intake and to measure some other es- sential electrolytes among citizens in the Eastern region of Saudi Arabia. Methods Sample A  total of 130 citizens  from Eastern  Saudi Arabia above the age of 14 years were recruited. The participants included healthy volunteers, healthy potential kidney donors and patients who underwent work-up for nephro- lithiasis. Data collection Sodium intake was estimated by meas- uring 24-hour urinary  sodium excre- tion. Samples were collected between October and March for 4 consecutive years  between 2009  and 2012. Due  to the hot climate in this area during the summer months and the possibil- ity of excessive sodium loss in sweat, the samples were collected during the season of temperate climate between October and March. The study was approved by the institutional review board at Saudi Aramco Medical Ser- vices Organization. The participants were given clear instructions about urine collection for a  total  of  24  hours.  All  participants  were instructed not to modify their diet during the study period. Patients with chronic kidney disease, those receiving diuretics and patients with gastrointestinal disorders were ex- cluded. To guard against over- and under-collection, urinary creatinine was measured in all samples. A daily creatinine excretion of 20–25 mg/kg  and 15–20 mg/kg  lean body weight  was expected for males and females respectively. Samples with a total cre- atinine excretion outside these ranges were rejected. In addition to urinary sodium, other electrolytes including potassium and magnesium were also measured. Blood pressure (BP), weight, and body mass index (BMI) were deter- mined for all participants. Casual (in office, resting) BP was measured using automatic oscillometric devices fol- lowing the standardized National Joint Commission protocol [16]. The mean  of  3 BP measurements  at  3  different  encounters was recorded. The electrolytes were measured by dry chemistry methods using Vitros 350 Chemistry System (Ortho Clinical  Diagnostics). Data analysis The software Microsoft Excel 2010 and  Graphpad Prism,  version 2.0 were used  for the statistical analysis. Data were expressed as mean values with standard deviation (SD). Pearson correlation coefficient (r) was used to analyse the association between electrolytes excre- tion and the various variables of the study population. P-values  of  <  0.05  were considered significant. Results The 24-hour urinary collection was per- formed on a total of 130 participants; 43  samples were excluded from the analy- sis due to incorrect collection. Analysis was performed on a total of 87 samples  (54 from males and 33 from females).  The mean age of the participants was 44 (SD 18),  range 14–83 years. The  mean ages were 45 (SD 18) years and  41 (SD 17) years for males and females respectively. Table 1 shows the demographic data of the participants and the meas- ured electrolyte excretion in male and female participants. The sodium excretion of the male participants was particularly high (153 mEq/day),  and  much higher than that of the female participants (118 mEq/day).  Correlations between 24-hour sodi- um excretion and age, BMI and systolic and diastolic BP are shown in Table 2.  Among the male participants there was a negative correlation between sodium excretion and age, and a positive cor- relation with body weight. This did not reach statistical significance, however, for the female participants. Discussion The WHO recommends that all coun- tries assess the sodium consumption of the population [17]. Most of the sodium in the diet is ingested in the form of sodium chloride. The WHO recommends an intake of no more than 5 g of  sodium chloride or 2 g of  sodium (85 mEq) per day, while  the  IOM recommends that adults should not consume more than 2.3 g of sodium  (100 mEq) per day [11,17]. Based on  these recommendations and due to the adverse health effects of dietary salt, many countries have adopted policies طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 917 to regulate salt consumption through educating people to reduce the use of salt in cooking and by persuading the food industry to minimize the use of salt in their products. Estimating salt intake by measuring salt excretion is an essential step towards formulat- ing these policies. There are differ- ent methods for estimating sodium consumption,  including  24-hour  urinary collection, casual spot urine collection and timed spot urine col- lection. Among these methods, the first is the most accurate. In an earlier report  in 2007,  the WHO suggested  that as  few as 100 individuals  from a  representative sample, with each par- ticipant carrying out a single 24-hour  urine collection, would be sufficient to provide an estimate of the sodium intake of a population [18]. The daily intake of sodium has not been officially documented in the Saudi population. As a result of lifestyle changes in the country, dia- betes and hypertension have reached epidemic levels [19]. The hot climate during the summer months in East- ern Saudi Arabia may result in large losses of water and salt in the sweat. To avoid any substantial sodium loss in the sweat, we conducted the study during the season of moderate cli- mate between October and March. The main bulk of the study sample was healthy adult individuals. Sodium intake,  as  reflected  in  the mean 24- hour sodium excretion rate, was 140  (SD 49) mEq, which is higher than recommended by both WHO and IOM [10,11]. This was  true  for both  males and females, with mean values of 153 (SD 52) mEq and 118 (SD  37) mEq  respectively. There was  a  negative correlation between sodium excretion and age, and a positive correlation with BMI among the male participants, most likely as a result of the overall high calorie intake among the young and overweight individuals. This was not observed in the female participants, probably due to the small sample size. We did not find a cor- relation between sodium excretion and either systolic or diastolic blood pressure. This may be attributed to the relatively young age of the cohort. Besides sodium intake, low potas- sium intake has also been associated with the development of cardiovascu- lar disease and stroke [20]. Adequate  potassium intake is recommended to counteract the adverse effects of sodium chloride. The IOM recom- mended a daily potassium intake of 4.7 g (120 mEq) for adults [21]. Simi- lar to sodium, potassium homeostasis is mainly regulated by the kidneys. The amount of potassium loss in the sweat and through the gastrointes- tinal tract is minimal under normal conditions. Therefore, and similar to sodium, urinary excretion of potas- sium is considered a surrogate for potassium intake. Our data showing a 24-hour mean excretion of 56 (SD  22) mEq  indicated  that  potassium  intake was low in the total group and in both sexes of the sample popula- tion [60 (SD 24) mEq and 50 (SD  16) mEq  in males  and  females  re- spectively]. This, in addition to high sodium intake, puts our population at an increased risk for the develop- ment of hypertension, cardiovascular disease and stroke. Table 2 Correlation between 24-hour urinary sodium excretion and several variables among male and female participants Sex/variable r 95% CI P-value Males Age –0.33 –0.55 to –0.07 0.015 BMI 0.27 –0.01 to –0.50 0.05 Mean SBP 0.01 –0.26 to –0.28 0.94 Mean DBP 0.19 –0.08 to –0.44 0.167 Females Age –0.01 –0.35 to –0.34 0.96 BMI –0.07 –0.41 to –0.28 0.68 Mean SBP –0.08 –0.41 to –0.27 0.66 Mean DBP 0.05 0.30 to –0.39 0.78 r = correlation coefficient; CI = confidence interval; BMI = body mass index; SBP = systolic blood pressure; DBP = diastolic blood pressure. Table 1 Demographic data and 24-hour urinary electrolyte excretion of the study participants Sex No. of people Mean (SD) values Age (years) BMI (kg/m2) BP (mmHg) Electrolytes Systolic Diastolic Na+ (mEq) K+ (mEq) Mg2+ (mg) Total 87 44 (18) 27 (5) 129 (15) 75 (8) 140 (49) 56 (22) 81 (37) Male 54 45 (18) 28 (5) 132 (15) 75 (8) 153 (52) 60 (24) 88 (41) Females 33 41 (17) 27 (6) 125 (14) 74 (6) 118 (37) 50 (16) 70 (25) BMI = body mass index; BP = blood pressure; SD = standard deviation. Na+ = sodium; K+ = potassium; Mg2+ = magnesium.. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 918 Magnesium is another mineral that has vital biological functions. The recommended dietary allowances of magnesium are 320 mg and 420 mg  for adult women and men respectively [22].  Balance  studies  have  shown  that the net magnesium absorption is  around  50%,  with  a  range  from  10%–65% of  the  total  intake depend- ing on the diet [23,24]. In the absence  of diarrhoea, most of the absorbed magnesium will be excreted in the kidneys. Based on this, our data of 24-hour magnesium excretion [mean  81  (SD 37) mg] may not necessar- ily reflect magnesium intake, and we can only speculate that the intake of magnesium in our cohort is lower than what is recommended by the IOM. However, that can only be confirmed by quantification of the actual content of magnesium in the diet. This study gives insight into the amount of sodium intake in this re- gion of Saudi Arabia, and suggests that measures should be adopted to improve the dietary habits of the population with the hope to decrease the associated adverse health effects of high salt intake. The results of this study could very well be extrapolated to other neighbouring regions where people share similar cultures and di- etary habits. Acknowledgements The authors acknowledge the use of Saudi Aramco Medical Services Organization (SAMSO) facilities for research data used in this article. Opinions expressed in this article are those of the authors and not necessarily of SAMSO. The authors also thank Mrs Fatimah A. Alkhunaizi from the Krieger School of Arts and Sciences at the Johns Hopkins University, Baltimore, USA for reviewing the manuscript and for her valuable comments. Funding: The study was funded by Saudi Aramco Medical Services Or- ganization, Saudi Arabia. Competing interests: None declared. References 1. Conlin PR. Eat your fruits and vegetables but hold the salt. Cir- culation, 2007, 116:1530–1531. 2. He J et al. Long-term effects of weight loss and dietary sodium reduction on incidence of hypertension. Hypertension, 2000, 35:544–549. 3. Cook NR et al. Long term effects of dietary sodium reduction on cardiovascular disease outcomes: observational follow-up of the trials of hypertension prevention (TOHP). British Medical Journal, 2007, 334:885–888. 4. He FJ, MacGregor GA, McCarron DA. Salt intake and cardio- vascular disease. Nephrology, Dialysis, Transplantation, 2008, 23:3382–3384. 5. Bibbins-Domingo K et al. Projected effect of dietary salt reduc- tions on future cardiovascular disease. New England Journal of Medicine, 2010, 362:590–599. 6. He FJ, MacGregor GA. Effect of longer-term modest salt re- duction on blood pressure. Cochrane Database of Systematic Reviews, 2004, (3):CD004937. 7. He FJ, MacGregor GA. Salt reduction lowers cardiovascular risk: meta-analysis of outcome trials. Lancet, 2011, 378:380– 382. 8. Strazzullo P et al. Salt intake, stroke, and cardiovascular dis- ease: meta-analysis of prospective studies. British Medical Journal, 2009, 339:b4567. 9. He FJ, MacGregor GA. How far should salt intake be reduced? Hypertension, 2003, 42:1093–1099. 10. Beaglehole R et al.; Lancet NCD Action Group; NCD Alliance. Priority actions for the non-communicable disease crisis. Lan- cet, 2011, 377:1438–1447. 11. Institute of Medicine of the National Academies. Strategies to reduce sodium intake in the United States. Washington DC, National Academy Press, 2010. 12. Oliver WJ, Cohen EL, Neel JV. Blood pressure, sodium intake, and sodium related hormones in the Yanomamo Indians, a “no-salt” culture. Circulation, 1975, 52:146–151. 13. Elliott P et al.; Intersalt Cooperative Research Group. Intersalt revisited: further analyses of 24 hour sodium excretion and blood pressure within and across populations. British Medical Journal, 1996, 312:1249–1253. 14. Stamler J et al.; INTERMAP Research Group. INTERMAP: back- ground, aims, design, methods, and descriptive statistics (non- dietary). Journal of Human Hypertension, 2003, 17:591–608. 15. Rose G, Stamler J; INTERSALT Co-operative Research Group. The INTERSALT study: background, methods and main results. Journal of Human Hypertension, 1989, 3:283–288. 16. Chobanian AV et al.; National High Blood Pressure Education Program Coordinating Committee. Seventh report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension, 2003, 42:1206–1252. 17. Strategies to monitor and evaluate population sodium consump- tion and sources of sodium in the diet. Report of a joint technical meeting convened by WHO and the Government of Canada. Geneva, World Health Organization, 2010. 18. Salt intakes around the world: implications for public health. Ge- neva, World Health Organization, 2007. 19. Al-Khader AA. Impact of diabetes in renal diseases in Saudi Arabia. Nephrology, Dialysis, Transplantation, 2001, 16:2132– 2135. 20. O’Donnell MJ et al. Urinary sodium and potassium excretion and risk of cardiovascular events. Journal of the American Medi- cal Association, 2011, 306:2229–2238. 21. Institute of Medicine of the National Academies. Dietary ref- erence intakes for water, potassium, sodium, chloride, and sulfate. Washington DC, National Academy Press, 2005. 22. Institute of Medicine of the National Academies. Dietary refer- ence intakes for calcium, phosphorus, magnesium, vitamin D, and fluoride. Washington DC, National Academy Press, 1997. 23. Schwartz R, Spencer H, Welsh JJ. Magnesium absorption in human subjects from leafy vegetables, intrinsically labeled with stable 26Mg. American Journal of Clinical Nutrition, 1984, 39:571–576. 24. Fine KD et al. Intestinal absorption of magnesium from food and supplements. Journal of Clinical Investigation, 1991, 88:396–402. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 919 Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees S. Garg,1 R. Hasan,1 S. Scahill 1 and Z. Ud-Din Babar 1 ABSTRACT There are few studies that explore inspection practices of pharmaceutical facilities from the viewpoint of inspectors and industry employees. In this descriptive, cross-sectional study, inspectors and quality assurance staff from 4 Arab countries — the United Arab Emirates, Saudi Arabia, Egypt and Jordan — were surveyed about their inspection practices and views. There was considerable variation in inspection practices across countries and between the inspectorate and quality assurance staff within countries. Divergence was found in views associated with payment mechanisms. There was mutual agreement by both groups that inspectors were in short supply and that they needed to be better trained. Inspectors appeared to have less authority than expected in order to control pharmaceutical manufacturing and marketing activities. Compounding this was a dearth of policy which would support a more uniform and systematic approach to the inspection process within and across countries. 1School of Pharmacy, University of Auckland, Auckland, New Zealand (Correspondence to Z. Babar: z.babar @auckland.ac.nz). Received: 22/02/12 accepted: 03/09/12 تاكشر يفظومو ينشتفلما ءارآ :ةيبرعلا نادلبلا ضعب في ةينلاديصلا تاضرحتسلما ةعانص قفارم لىع شيتفتلا تاسرامم ةسارد ةينلاديصلا تاضرحتسلما ةعانص راباب نيدلا يرهز ،ليهاس ناش ،نابعش اينار ،جراج يجناس رظن ةهجو نمو ينشتفلما رظن ةهجو نم ةينلاديصلا تاضرحتسلما ةعانص قفارم لىع شيتفتلا تاسرامم لوح تاساردلا نم ليلق ددع كانه :ةـصلالخا ةيمان نادلب ةعبرأ في ةدولجا نماض في ينلماعلاو ينشتفلما لوانت ًاحسم ةيفصولا ةضرعتسلما ةساردلا هذه في نوثحابلا ىرجأ دقو .قفارلما كلت في ينفظولما يربك ردق كانه ناك دقو .مهرظن تاهجو نعو شيتفتلا في متهاسرامم نع لاؤسلل ،ندرلأاو صرمو ةيدوعسلا ةيبرعلا ةكلملماو ةدحتلما ةيبرعلا تاراملإا يه عم قفاتري رظنلا تاهجو في دعابتلا ناكو .دحاولا دلبلا نمض ةدولجا نماض فيو شيتفتلا في ينلماعلا ينبو رخآو ٍدلب ينب شيتفتلا تاسرامم في توافتلا نم .لضفأ بيردت لىإ ةجاحب منهأ لىعو ،ميهدل تادادملإا رفاوت ةلق لىع ينشتفلما ينبو قرفلا نم لك ينب لدابتم قفاوت كانه ناك دقو .روجلأل عفدلا تايلآ كلذ ديزيو ،قاوسلأا في ةطشنلأاو ةينلاديصلا تاضرحتسلما ةعانص ةبقارم لجأ نم عقوتم وه امم لقأ تايحلاص ميهدل ينشتفلما نأ ينثحابلل ادب دقو .ةيمانلا نادلبلا في رخآو ٍدلب ينب ام فيو ،دلب لك نمض شيتفتلا ةيلمع في ةيرايعمو ةيجهنمو ًاماجسنا رثكأ بولسأ عابتا معدت يتلا تاسايسلا ةلق ًاءوس Enquête sur les pratiques d’inspection des établissements de production pharmaceutique dans des pays arabes sélectionnés : opinions des inspecteurs et des employés de l’industrie pharmaceutique RÉSUMÉ Les études sur les pratiques d’inspection des établissements pharmaceutiques du point de vue des inspecteurs et des employés de l’industrie sont rares. Dans la présente étude transversale descriptive, des inspecteurs et des membres du personnel de l’assurance qualité de quatre pays arabes, à savoir l’Arabie saoudite, l’Égypte, les Émirats arabes unis et la Jordanie, ont été interrogés sur leurs pratiques en matière d’inspection et sur leurs opinions. Les écarts entre les différentes pratiques d’inspection étaient considérables entre les pays mais aussi entre les équipes d’inspecteurs et de l’assurance qualité dans un même pays. Des divergences ont été constatées dans les opinions sur les mécanismes de paiement. Il a été établi par les deux groupes que les inspecteurs étaient en nombre insuffisant et qu’ils avaient besoin d’une meilleure formation. Les inspecteurs semblaient avoir moins d’autorité que prévu dans le contrôle des activités de production et de marketing de l’industrie pharmaceutique. Ce problème était encore aggravé par l'absence de politiques qui permettraient d’appuyer une approche plus uniforme et systématique du processus d’inspection à l'intérieur des pays et entre les pays. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 920 Introduction Despite being profit-making businesses, the first priority of pharmaceutical com- panies should be to assure the quality of the products they manufacture [1,2].  The process of inspection of pharma- ceutical facilities is an activity that is expected to assist with compliance by the industry with internationally rec- ognized guidelines that support good manufacturing practice (GMP). There are many types of audits and inspec- tions (routine or formal, concise or ab- breviated, follow-up, special inspections and quality system reviews) and varying roles of individuals within regulatory agencies and the pharmaceutical in- dustry [3,4]. The approaches to inspec- tions can be centred on the process, the product or the system or all of these [3]. Within high-income countries, as- sessing compliance with GMP is well established and there are set protocols for  approaching  inspections  [5–8].  Inspection has become normal prac- tice and audits are accepted as routine and an important aspect of the supply chain process, as GMP verification is required in order to meet the inspection requirements of export markets. Many pharmaceutical companies in Eastern Europe, the Middle East and Africa are undergoing rapid development in order to meet the requirements of industrial- ized nations. It is common practice for these companies to consult with inde- pendent professionals, either privately or through European Union-funded initiatives, in order to obtain GMP certi- fication. This is required for pharmaceu- tical companies to submit applications for international authorization, enabling them to progress to export business. There is some dialogue suggesting a lack of trained inspectors in developing countries and consequently that the local pharmaceutical companies face difficulties and delays obtaining GMP certification [4,9]. There have been few studies of this issue, but one conducted in Egypt [9] and a commentary from China [10] suggested that, when avail- able, inspection procedures in devel- oping countries are less common and more variable relative to inspections in developed countries. Our study was founded on the need to better understand inspection practices, specifically in the context of developing countries in the Arab world. We are not aware of any previous stud- ies that explored dual-stakeholder views (of inspectorate and industry staff) in a single study. The objective of this study was to describe inspection practices in 4 developing countries from the view- point of inspectors and pharmaceutical industry staff. Methods Sampling frames Four developing countries were select- ed from the Arab Middle East, including 2 high-income countries – United Arab Emirates (UAE) and Saudi Arabia – and 2 low- to middle-income countries  – Egypt and Jordan. The rationale for selecting these nations was based on their having an interest in development within Arab nations and having likely access to participants and organizations by the lead researchers and a broad range of current practices which were anecdotally known to occur in these countries. A purposive sampling strategy was adopted in order to understand the viewpoints of those conducting the inspections and those subjected to the inspection process [11]. Two groups of participants were sampled: inspectors from health regulatory authorities and quality assurance (QA) staff working within pharmaceutical companies. Survey design This was a descriptive study carried out  from September  2008  to Febru- ary 2009 and a  cross-sectional  survey  design was implemented in order to collect predominantly quantitative data [12,13]. Additional qualitative data was  collected from inspectors within the 4 countries sampled. It was believed that this survey design would provide optimal data collection and could also help to identify issues for more in-depth future research [14]. Ethical approval was obtained from the University of Auckland human participant ethics committee (reference 2009/003). Data collection Survey instruments Two survey instruments were devel- oped from an initial list of questions that this study aimed to answer, as well as through a synthesis of the relevant literature. Question numbers were re- duced via an iterative process involving the research team, with each question critically reviewed. Questions that did not directly contribute to answering the research question were omitted. Effort was made to set out the questionnaire as clearly as possible. This included the use of non-ambiguous instructions, along with a simple, clear and attractive layout [15]. Both survey instruments were de- veloped in English; however, Arabic versions were developed in order to be able to engage more respondents in their native tongue. The survey in- struments were predominantly quan- titative, although open questions were included in order to be able to explore individual opinion about some aspects of inspection practices [12,15]. The sur- veys were expected to take between 15  and 30 minutes to complete. The layout  involved tick boxes outlining a range of responses for each question. The survey instrument for inspec- tors  contained  37  questions  divided  into 9 main sections: demographics, including minimum qualifications and experience; available training and education programmes and satisfac- tion with these and funding; inspection planning and strategies as well as fac- tors influencing duration of the visit; financial considerations; approaches طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 921 to visit, recording observations and in- spector authority; guideline use; correc- tive actions, final inspection reporting, approaches to communication of cor- rective action and follow-up; communi- cation obstacles that could compromise inspections; and recommendations and suggestions (open question). The survey instrument for pharma- ceutical  industry QA staff  included 20  questions  divided  into  5 main  parts:  preparation planning for an inspection visit; financial budgets for inspections; internal auditing, areas of usual inspec- tion, frequency of self-inspection and format of inspection reports; external auditing, types of communication with regulatory body and final report for- mats; and an open question asking the respondents for recommendations for increasing the inspection efficiency. Procedures Surveys were provided to participants either at the time of the country visit by one of the authors (R.H.) or were posted. Different methods were used to engage participants. A covering letter explained the purpose of the research, and the survey questions were concise and specific. Weekly reminder emails and telephone calls were also made to encourage participants to complete the surveys and to return them as soon as possible [12,15]. Definitions Although the terms are used inter- changeably, for the purposes of this study the term “inspection” [2] was used  rather than “audit”, because it is the term more commonly used in the countries that participated in this research. For the purposes of this study, the process of a GMP inspection was deemed to be a systematic and method- ical  review of  a  facility  [3]. The GMP  Institute’s standard auditing procedure was adopted as the reference standard for this paper [16]. The  3 main  approaches  used  by  inspectors in the developing world are: (a) forward approaches, i.e. tracing forwards from the raw materials and following the system through the fac- tory to the dispatch warehouse—this is a hypothetical exercise that focuses on physical systems; (b) backward ap- proaches, i.e. tracing backwards from the finished product in the warehouse to review the entire history back through the system—this is a fact-based exercise that focuses on documentation; and (c) random approaches, i.e. starting from points around the factory that appear to be significant and working either back- wards or forwards as necessary [3]. Data management and analysis All data collected from participants who responded in Arabic were translated into English by R.H. and checked as part of the data management QA process. Data entry and analysis was conducted using SPSS, version 17 software. All original English and translated data was entered into a single database (in English format), for ease of analysis. Data entries were double checked by statisticians from the Student Learning Centre at the University of Auckland and from the University of the United Arab Emirates to ensure accurate data entry. SPSS was used to calculate the frequency and percentage of responses to each question, as appropriate. Results were presented as tables and graphs within SPSS. Responses to open-ended questions were analysed and broad themes identified, and the frequency of each theme quantified. Results Country of domicile Completed surveys were received from 32  inspectors: 16  in  the UAE, 9  in Egypt,  6  in  Saudi Arabia  and  1  in  Jordan. Survey responses were collected via personal interviews in the UAE and by post or in a few cases by email in the other countries. In addition 23 QA  staff within pharmaceutical facilities participated  in  this  study: 10  in Egypt,  8  in Saudi Arabia and 5  in  the United  Arab Emirates (UAE). Surveys were collected from 15 QA staff by post, from  5 by face-to-face interviews and from 3  by email. Regulatory context Inspectors reported that the UAE Ministry of Health  [17,18],  Jordanian  Food and Drug Administration [19] and Egyptian Ministry of Health [9] each have 1 regulatory health authority. Conversely, Saudi Arabia has several (Ministry of Health, Saudi Food and Drug Administration and the Gulf Cen- tral Committee for Drug Registrations) [20]. Inspectors’ views on roles, process, and delegated authority Qualification and roles The majority of inspectors specified that a bachelor of pharmacy degree should be required for the job (n = 23, 71.8%) and 9 participants (28.1%)  suggested that inspectors should be required to pass a national examination of pharmacy or an equivalent certificate. Three  respondents  (9.3%) noted  that  there were no specific requirements to become an inspector in their coun- tries. Along similar lines 4 respondents (12.5%) indicated that no specific quali- fication was required for inspectors; the caveat being the need to have 2–5 years  of experience of conducting inspections and the appropriate level of training. Inspectors’ own work experience Most of the respondents from Egypt, UAE and Saudi Arabia had up to 5 years  of experience (n = 19, 59.4%), while the  single respondent from Jordan reported more  than 15 years of experience. The  large majority of respondents saw their main role as policing (n = 28, 87.5%),  as well as the review of required cor- rective actions (n = 25, 78.1%). Nearly  two-thirds (n = 21, 65.6%) suggest that  providing advice and/or consultation and cooperation with industry staff was a key part of their role. A similar EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 922 response pattern was seen from repre- sentatives in Egypt, although the role of the inspector working with industry staff was given more emphasis than in the UAE. The most common response from respondents from Saudi Arabia was the policing role, followed by work- ing with the industry to improve quality. The inspector from Jordan indicated that all 4 roles were important. Inspection plans and procedures Nearly half of the inspectors (n = 29,  48.2%) reported a warning period of up  to 1 month prior to inspection, while al- most one-third (n = 9, 31.0%) reported  that no announcement was made at all. Extended warnings of up to 12 months  occurred less commonly (n = 3, 10.3%).  Inspectors from Saudi Arabia showed the widest range of time frames from up to 1 month (30.0%), 3 months (33.3%)  and 6 months (16.6%). In terms of  in- fluencers of the duration of inspection visits, most inspectors reported that the purpose of the visit (n = 26, 81.2%)  and the size of the company being in- spected (n = 16, 81.2%) were the main  influencers. Other factors important to the inspectors included distance of pharmaceutical facility from main cen- tres and the extent to which “negative” issues were observed during the visit. Close to two-thirds of inspectors (n = 20, 64.5%) reported that an informa- tion pack was supplied by the company prior to inspection. Inspectors in the UAE were more likely to have addi- tional information provided by health authorities (n = 10, 62.5%). Access  to  inspection records from previous visits was less common, particularly in Saudi Arabia where none of the respondents suggest this occurs. With respect to the inspection visit, the backward and forward approaches were used by similar proportions of in- spectors (46.9% and 50.0% respective- ly), while the random approach was less commonly used (25.0%).  Respondents could provide more than one answer to this question and the UAE inspec- tors reported use of all approaches in equal measure. Saudi Arabia inspec- tors reported that the forward approach was the only one used. The majority of inspectors from Egypt preferred to take a backward approach to the inspection process. The respondent from Jordan reported that the backward approach was the only one taken (Table 1). Nearly two-thirds of the inspec- tors (n = 19, 59.3%)  indicated that  the  purpose of the inspection visit was the most important factor when deciding which approach to adopt. The inspec- tion history was also deemed important (n = 12, 37.5%), followed by inspector’s  personal choice (n = 8, 25.0%), while  some suggested all of the above reasons influenced the decision (n = 5, 15.6%).  During the inspection, checklists were most commonly used (n = 26, 81.2%),  but note-taking (n = 9, 28.1%) and still  cameras were also used by some in- spectors (n = 9, 28.1%) and a few used  flow-charts (n = 2, 6.3%) and video (n = 4, 12.5%). There was some variation  across countries, with inspectors from UAE using the whole range of available methods. Corrective actions and final reporting The majority of inspectors reported that they supplied a description of the inspection list (n  =  21,  65.6%)  and  included negative and positive observa- tions in their reports (n = 20, 62.5%).  Approximately half (n  =  15,  46.8%)  of the respondents included recom- mendations for improvements (n = 16,  50.0%), required corrective actions and  the time-frame for required response (n = 15, 46.8%) as part of their normal  practice. It would appear that inspectors from UAE and Egypt provided the broad- est range of information in their final reports; Saudi Arabia and Jordan less so. Three-quarters of respondents use formal written letters as inspection fol- low-up on required corrective actions (n  =  24,  75%).  Email was  used  least  often (n = 3, 9.3%);  telephone and  fax  were used to the same degree (n = 12,  37.0%). Similar patterns of communica- tion methods were reported across the countries studied. The great majority of inspectors reported using a combina- tion of written report and follow-up visit to check that corrective actions had been implemented (n = 23, 71.8%).  Close to half the inspectors reported us- ing a follow-up visit (n = 15, 46.8%) and  more than one-quarter (n = 9, 28.1%)  requested company reports; outlining that corrective actions had occurred. Table 1 Approaches to inspection of pharmaceutical manufacturing facilities used by inspectors in the 4 countries Country (no. of inspectors Forward approacha Backward approachb Random approachc responding) No. % No. % No. % United Arab Emirates (n = 16) 8 50.0 8 50.0 8 50.0 Saudi Arabia (n = 5) 5 100.0 0 0.0 0 0.0 Egypt (n = 9) 2 22.2 7 77.7 0 0.0 Jordan (n = 1) 0 0.0 1 100.0 0 0.0 Total (n = 32) 15 46.9 16 50.0 8 25.0 Respondents could provide more than 1 answer to this question. aTracing forward from raw materials and through the factory to end at the dispatch warehouse; bTracing backward from finished product in the warehouse to review history back through the system; cStarting from points around the factory that appear to be significant and working either backward or forward as necessary [6]. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 923 Inspector authority Just over half (n = 17, 53.1%) of  the  inspectors surveyed reported that they had the authority to delay the issue of  a GMP certificate  and 3  re- spondents  (9.3%)—1  from each of  UAE, Saudi Arabia and Jordan—re- ported the ability to revoke marketing authorization. Less than one-quarter (n = 7, 21.8%) of  inspectors were  in  a position to close a facility or delay approval of licenses or marketing au- thorizations. Guidelines from the Therapeutic Goods Administration in Australia were most commonly referred to (n = 18, 56.2%),  followed by  the European  Medicines Agency (n  =  13,  40.6%)  World Health Organization (n  = 10,  31.2%), United States Food and Drug  Administration (n = 7, 21.8%) and In- ternational Conference on Harmoniza- tion (n = 3, 9.3%). Inspection barriers and difficulties Only 12 of the 32 inspectors (37.5%)  responded to the question about communication with overseas in- spectors. Of these half (n = 6, 50.0%)  reported that they had poor commu- nication with international inspec- tors, the highest being in the UAE. Reported barriers from inspectors included: language (n = 15, 46.8%),  cultural differences (n = 10, 31.2%),  inappropriate body language (n = 5,  15.6%),  lack  of  communication between inspectors and pharmaceu- tical industry staff (n  = 16,  50.0%).  Inspectors identified with a long list of issues and difficulties associated with inspections and the more common ones (> 15%) are outlined  in Table  2. The most  common were  lack  of  training and education programmes, followed by transportation difficulties to the facilities, inadequate numbers of inspectors and insufficient time set aside to complete the requirements for a thorough inspection. Levels of response by QA staff to the question about inspection difficul- ties was very low; there being a single response for most categories. No warn- ing of inspection, no specific inspection plan, lack of allocated time, inspectors without appropriate background and imprecise questioning were highlighted as difficulties. QA staff views on preparation, process and recommendations Inspection visit preparation The majority of QA staff had experi- enced an inspection visit (n   =  21,  91.3%). A large majority of respondents  agreed that maintenance records (n = 18,  78.6%),  sanitation  and hygiene  records (n = 15, 65.2%) and standard  operating procedures (n = 14, 60.9%)  were the types of documents to be prepared prior to an inspection visit. A minority of respondents suggested that recall records (n = 9, 39.1%) and  manufacturing batch records (n  =  2,  8.7%) should be prepared. Levels of self inspection All QA staff noted that facilities had self- inspection plans and a great majority (n = 20, 87.0%) had completed written  self-inspection plans. Quality control procedures were seen as critical in the self-inspection procedure and there was a long list of them (Table 3). Table 2 Inspectors’ views on inspection issues and difficulties Issue or difficultya No. % (n = 32) Lack of training and education programmes 13 40.6 Inadequate numbers of inspectors 9 28.1 Transportation difficulties 9 28.1 Not enough time to complete the required inspection 7 21.9 Difficulties in arranging the time of inspection between inspectors and facility 5 15.6 Inadequate salary and benefits for inspectors from the regulatory authorities 5 15.6 No specific format for reporting observations and findings 5 15.6 aItems mentioned by > 15% of respondents. Table 3 Quality assurance staff responses to question about levels of self- inspection for good manufacturing practice (GMP) Aspects of GMP for self-inspection No. % (n = 23) Personnel working in the facility 19 82.6 Maintenance of the factory 14 60.9 Manufacturing and testing 17 73.9 Quality control procedure 22 95.7 Documentation preparation 19 82.6 Recall procedures 15 65.2 Follow-up to previous self-inspections 14 60.9 Validation and monitoring procedures 15 65.2 Control of printed components 16 69.6 EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 924 Monthly self-inspection was the most common system, followed by quarterly  then 6-monthly. Respond- ents suggested that corrective actions from a self-inspection were completed within a specified time-frame (n = 21,  91.3%); most  commonly within  2 weeks  to 1 month  (n  = 8,  34.7%),  although there was a broad range of responses. External inspections and recommen- dations QA staff views about the use of video or photographs was split relatively evenly between agreement (n = 11, 47.8%) and  refusal (n = 12, 52.2%). Written formal  letters were most commonly used to communicate with inspectors (n = 13,  56.5%), followed by telephone calls (n = 8, 34.8%), emails (n = 8, 34.8%) and fax  (n = 6, 26.1%). Participants’  responses  to a list of components included in a final inspection report are outlined in Table 4. Other items concerning observa- tions, recommendations, description of the inspection list and time-frames for the required response all had re- sponse rates > 85%. Just under half of  the respondents (n = 10, 43.4%) sug- gested that sharing of the final inspec- tion report was conditional and could depend on the results in the report and the reason why another authority had asked to view it. A minority of par- ticipants would share their inspection reports with other authorities (n = 4, 17.5%) and the rest would not (n = 9, 39.1%). Education and training Most of the inspectors reported that training sessions were available for them (n = 23, 71.9%). Half  suggested  an internship for new inspectors was available in some cases but that there were no practical aspects included with the theoretical sessions. Training pro- grammes are compulsory in the UAE and Jordan. The majority of inspectors from the UAE and Jordan were satis- fied or extremely satisfied with the QA training programmes. In contrast, the majority of respondents from the Saudi Arabia and Egypt were not satisfied or unsatisfied with the programmes in general (Figure 1). Inspectors without appropriate background and imprecise questioning were highlighted as difficulties associat- ed with inspections from the viewpoint of QA staff. Inspection fees From the viewpoint of inspectors, fees were most commonly of the fixed-fee type. From the viewpoint of QA staff, variable inspection fees were deemed to  be most  common  (Table  5). The  inspection fee was most commonly paid by the pharmaceutical company (Table 6). Table 4 Quality assurance staff responses to question about the components of a final inspection report Components No. % (n = 23) Brief summary 8 34.8 Report with commentary 6 26.1 Detailed report 11 47.8 Recommendations for improvements 22 95.7 Corrective plans for overcoming non conformity 21 91.3 A time-frame for required responses 20 87.0 Description of the inspection list 21 91.3 Negative and positive observations 20 87.0 Inspectee signature space when corrective action completed 0 0.0 Figure 1 Satisfaction of inspectors in the 4 countries with training sessions 6 4 2 0 Country Fr eq ue nc y (N o. ) Not satisfied Sparingly satisfied Satisfied Very satisfied Extremely satisfied United Arab Emirates Saudi Arabia Egypt Jordan طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 925 Only  3  QA  staff  from  different  countries reported that fees were set by government. One inspector from the UAE advised that the health authority paid the inspection fee and 1 inspector from Egypt responded that the cost was shared between the pharmaceutical company and the government regula- tor. Responses to the inspection fee question for QA staff were evenly split between being paid for by the phar- maceutical company or jointly by the company and the regulating health authority. Discussion This study set out to investigate the views of both inspectors and QA staff in the context of inspection of pharmaceu- tical manufacturing facilities in 4 Arab countries. Inspectors’ views It was expected that inspectors be phar- macists or have considerable experience. The main role was deemed to be “po- licing”. The level of practical training, approaches and satisfaction with these programmes varied markedly across the 4 Arab countries surveyed. Inspectors believed they had a reasonable level of authority/power and were able to delay GMP certification if they saw fit. The ability to cease manufacturing and product marketing outright was less common. A range of guidelines were used during the inspection but the Austral- ian Therapeutic Goods Administra- tion guidelines seemed to be most popular. Either fixed fees or fees that were confidential appeared to be commonplace. Inspection follow-up was generally in the form of letters and only half of the respondents made recommendations for improvement. There would appear to be significant variability in the information pro- vided in inspectors’ final reports; however, post-inspection follow-up visits appeared to be part of routine practice. Difficulties with inspection mentioned included lack of time, funding, transportation and stand- ardization of reporting. QA staff views There appeared to be consistency across countries in the perceived re- quirements for the preparation of inspection visits. Furthermore, self- inspection plans and practices were commonly reported and corrective actions were followed within a time- frame. Variable inspection fees were reported to be the most common type, followed by fixed fees. Letters were the most common form of commu- nication with inspection agencies. QA staff expected to receive recommen- dations for improvement, corrective plans, a time-frame for responding, description of the inspection list and both positive and negative observa- tions. Sharing of reports appeared to be conditional on the findings of the inspection. Difficulties with inspec- tions from the viewpoint of QA staff included: ad hoc visits, lack of specific pre-inspection plans, inadequate time spent conducting the inspection and inspectors lacking background about departments within the industry. Contribution made by this article Academic literature addressing phar- maceutical inspection processes with- in the developing world are scarce, despite an increasing trend toward the globalization of pharmaceutical regu- lation [21,22]. There  is  commentary  Table 5 Inspectors’ and quality assurance (QA) staff responses to question about inspection fees Type of fee Inspectors (n = 32) QA staff (n = 23) No. % No. % Contract (fixed fee) 10 31.3 8 34.8 Confidential or unknown 9 28.1 2 8.7 Variable fee 2 6.3 13 56.5 No specific fee – – 2 8.6 According to the regulatory body – – 1 4.3 Respondents could provide more than 1 answer to this question. Table 6 Inspectors’ and quality assurance (QA) staff responses to question about source of inspection fee payments Source of staff inspection fee payments Inspectors (n = 32) QA staff (n = 23) No. % No. % Pharmaceutical company 14 43.8 9 39.1 Regulating health authority 1 3.1 3 13.0 Joint payment by pharmaceutical company and regulators 1 3.1 9 39.1 No answer or don’t know 6 18.8 2 8.7 Respondents could provide more than 1 answer to this question. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 926 suggesting a lack of trained personnel and significant barriers to ensuring inspection processes are consistent within and across several develop- ing countries. The findings from this study reflect that rhetoric. We are also unaware of studies which compared the views of inspectors and representa- tives of pharmaceutical companies within the same study cohort; this manuscript adds to that understand- ing. There appears to be a level of disconnect between inspectors and QA staff with regards some aspects of inspection; both within and across the Arab countries studied. By taking this approach across countries and through key stakeholder viewpoints, misalignment of certain aspects of policy and/or practice have been uncovered which warrant further ex- ploration. For example, in this study divergence was found in viewpoints associated with payment mechanisms. Equally, inspectors needed to be better trained. Limitations of the research As with any research this paper has limitations and the results need to be interpreted in the light of these. The sample size was small for both surveys and the analysis was limited to basic descriptive statistics. Due to the small sample size, generalizability of the data may to other contexts not be appropri- ate because the respondents may not be representative of the populations of QA staff and inspectors. However, the data set was still useful as a descriptive analysis, uncovering issues for further in-depth study [14]. Another limitation was that some participants did not an- swer all of the questions and declined to provide a reason for their non-response. However the reason may have been concerns about providing confidential information, rather than lack of knowl- edge. To increase generalizability across all Arab countries and allow cross- country comparisons, future research could include more participants from a larger range of countries. This may require a longer period for data collec- tion and could be more expensive to conduct because of telephone calls and the requirement for personal visits to increase engagement. In addition, the involvement of participants from more countries may require translation into multiple other languages. Implications and recommendations The aim of this research was to ex- plore inspection practices within the context of 4 Arab countries in order to understand where changes need to be made to increase consistency, efficiency  and  effectiveness  [23].  It  is important to consider the implica- tions of the findings for policy, practice and any future research that may be required. Equally important is the need to outline recommendations which can be adopted by authorities and/ or the pharmaceutical industry within developing countries. Implications for policy and practice The findings of this study have impli- cations for policy and practice when considered from the viewpoint of both inspectors and QA staff (Tables 7 and 8). There  is  some policy which  supports more systematic approaches to inspection of pharmaceutical fa- cilities within the context of developing countries; however, our study showed there were major barriers to translat- ing this into transparent and consist- ent practice. What was striking was the variability both across and within countries involved in this study. Policy development and implementation should span collaborative approaches to education and training, delegated authority, payment mechanisms and remuneration and policies that support and stimulate the use of technology. In addition, more operational level poli- cies are required to inform and support technical aspects of the role including standard operating procedures and reporting templates. In terms of practice, there are expected “flow-on” effects from im- provements in policy development and implementation. For example, in the longer term, inspection practices are expected to be better supported through educational policies that at- tract pharmacy students and through providing basic training with a view to their continuing a career in this area. Local and international peer review and benchmarking practices will assist in standardizing practice and reducing the variability in approaches to the inspec- tion, reporting and follow-up. There were several inconsistencies between the views of inspectors and QA staff on consistent payment practices and the expectations of the inspection process and reporting. Further work is required to better understand and to minimize these differences through practices in- formed by policy. Implications for future research A future research agenda has been developed by identifying gaps in the academic literature alongside the findings of this study (Tables 7 and 8). The  following  research  streams  represent the broad concepts in this area of study which require further work. Stream 1: The influence of further pol- icy development and implementation Continued development of effective policy needs to occur and its influence evaluated. This would include edu- cational policy promoting the role of inspectors and QA staff, evaluation of training programmes for inspectors, and interventions to reduce variability of the inspection process in its entirety. The impact of international knowledge sharing and collaborations needs to be assessed. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 927 Table 7 Implications of the study for policy, practice and research: perspectives of inspectors Findings Implications for policy Implications for practice Implications for future research Inspectors should be pharmacists or have considerable experience. There is a shortage. Policy to be developed to reflect this view. Joint policy to be developed between health authorities and pharmacy schools Review of pharmacy degrees in developed countries to ensure the degree provides adequate basic training. Focus on attracting pharmacists to this role Need for demographic studies to determine the inspection workforce. Understanding the barriers and facilitators to being an inspector. Perceived as a policing role Policy to outline other important roles in addition to policing Change in practice to ensure that the role is not undertaken exclusively as a policing role The influence of a dominant focus on policing to be further explored in terms of the overall process Variable levels of practical training in addition to theoretical aspects Educational policy to be developed which outlines what constitutes effective theoretical and practical training Practice better supported through practical on job training in addition to the theoretical understanding required Evaluation of training interventions Approaches to inspection and process vary markedly along with information provided Policy to be developed which informs standard inspection Sharing of reports among inspectors to encourage learning and reduction in variability in amount and format of information delivered Implementation and evaluation of approaches to reduce inspection variability Inspectors believe they have adequate power/ authority Policy required around delegated authority and levels at which inspectors can act. Inability of inspectors to stop marketing authorization and close facilities in some countries negates the point of the inspection Local and international peer review of decisions regarding inadequate facilities to make the process more robust Audits of decision and decision-making processes to reduce variability Understand the power differential between inspectors and QA staff and higher management of pharmaceutical facilities and appropriate decision-making Inspection fees are mostly confidential or fixed: different from QA staff views Transparent payment policies are required Consistent and transparent payment practices required Wide-scale surveys to better understand current payment mechanisms within and across developed countries Communication: • by letter • language barrier when communicating abroad Inspection policies need to support the increased use of technology for communicating, producing checklists and reports. Development of cross- country policies for countries of a similar nature. Consistent policy around the use of video and photographs is required. Internationally recognized standards need to become common practice through interaction between inspectors and authorities in developed and developing countries Implementation and evaluation of cross-country information- sharing and experiential initiatives Difficulties with inspections • lack of training or variable training across countries • transportation • insufficient time • salary/reimbursement • no set format for inspection or report Development of SOPs and written report template formats needed. Training and development policy required to inform compulsory inspector training consistent across developing countries. Work towards international accreditation. Formal examination and licensing policies consistently required across all developing countries Comprehensive training and educational programmes implemented for inspectors. Periodic inspectors meetings to organize work, reduce deficiencies and outline responsibilities. Links needed between regulatory authority administrators and inspectors in terms of the process, reports and forms used and decision- making processes. Meetings between inspection team members before starting the visit to ensure the inspection team is well coordinated with regard to purpose and individual responsibilities. Evaluation of the impact of training policy implementation and practices in a before and after study QA = quality assurance; SOP = standard operating procedures. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 928 Stream 2: Understanding human factors A better understanding of the current workforce and future potential work- force is required. Alongside this, further work on remuneration packages for inspectors is required through local and international benchmarking. The rea- sons for the dominant policing culture and how other aspects of the process might be better integrated warrants further exploration. Understanding aspects of decision making and how inspectors rate sites and feedback to them will allow benchmarking to take place. Stream 3: System development, oper- ational research and audit evaluation Undertaking a content analysis of current inspection reports would provide a baseline for measurement of future policy implementation/ initiatives. Following on from this, wide-scale studies of the barriers and facilitators of change in this sector are required. Table 8 Implications of the study for policy, practice and research: perspectives of quality assurance staff Finding Implications for policy Implications for practice Implications for future research Visit preparation and self-inspection activities undertaken There is the belief that visit preparation and self-inspection activities are being undertaken, but is no policy around what these procedures should constitute Although staff believe this aspect is done relatively well, there is always room for improvement, and support of best-practice needed. More information may need to be provided by pharmaceutical facility visits undertaken by international inspectors Wider evaluation and audit of whether visit preparation and self inspection practices are in fact as common as this study suggests. Understanding what is undertaken and what contribution self-inspection makes so as to inform future best practice in the developing world Inspection fees are variable, followed by fixed-fees, and this is different from the inspectors Payment policies required Consistent and transparent payment practices required Further exploration of the different views of inspectors and QA industry staff with respect to payment is warranted Inspection communication and recommendations Policy to facilitate the use of IT required. QA staff have ideas about what they expect to receive and this needs to be considered for future policy development. Policy around inspection report sharing is required The gap between what QA staff expect to receive, what is policy and normal practice to be aligned Wide-scale evaluation of external inspection reports through content analysis would help to inform policy and improve current practice Difficulties with inspections • ad hoc visiting • planning • time • inspector insight/ experience Policy on ad hoc visiting required. Pros and cons need to be considered. Visits by inspectors from authorities outside of the country less likely to be ad hoc; joint policy may need to be developed in light of this. Training and development policy required to inform inspector training More information provided by the pharmaceutical facility prior to inspection, particularly with foreign inspectors. Health authorities websites needed for the industry staff to understand GMP requirements. This practice to be put in place and supported by regulatory policy. Workshops to be provided by regulatory authorities for pharmaceutical facilities to explain GMP compliance and marketing authorization requirements. Appropriate amounts of time needs to be allocated by inspectors and QA staff Wide-scale surveys of the barriers and facilitators to efficient and effective inspection practices needed based on the findings of this study QA = quality assurance; IT = information technology; GMP = good manufacturing practice. Stream 4: Better understanding of fiscal mechanisms and their influence There seems to be some misalign- ment with the experiences of QA staff and inspectors when it comes to fee payment mechanisms. Local and international benchmarking will be required. Conclusions This study set out to investigate in- spection practices of pharmaceutical طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 929 manufacturing facilities in 4 Arab countries through the viewpoints of inspectors and QA staff. The findings of this study have significant implica- tions for policy and practice. There seems to be considerable variation in the policies and practice of in- spection. A future research agenda is posed around 4 streams of work involving human factors, systems and processes alongside fiscal considera- tions. Acknowledgements Funding: This research received no grant from any funding agency in the public, commercial or not-for-profit sectors. Competing interests: None declared. References 1. Fisher J et al. A compliance management system for the phar- maceutical industry. In: Braunschweig B, Joulia X, eds. 18th European Symposium on Computer Aided Process Engineering. Oxford, Elsevier Science, 2008:949–945. 2. Kaplan WA et al. The impact of regulatory interventions on phar- maceutical access and quality: what is the evidence and where are the gaps in our knowledge? Boston, Massachusetts, Boston University Press, 2003. 3. McCormick K, ed. Pharmaceutical engineering series: quality. Oxford, Butterworth-Heinemann, 2002. 4. Willing SH. Good manufacturing practices for pharmaceuticals: a plan for total quality control from manufacturer to consumer, 5th ed. New York: Marcel Dekker, 2001. 5. Quality systems audits. United States Food and Drug Administra- tion [online manual] (http://www.fda.gov/MedicalDevices/ DeviceRegulationandGuidance/PostmarketRequirements/ QualitySystemsRegulations/MedicalDeviceQualitySystems- Manual/ucm122726.htm, accessed 29 July 2013). 6. European Medicines Agency [website] (http://www.emea. europa.eu/, accessed 29 July 2013). 7. Therapeutic Goods Administration. Guidance on the GMP clearance of overseas medicine manufacturers. Canberra, Aus- tralian Government, Department of Health and Ageing, 2008. 8. New Zealand Medicines and Medical Devices Safety Author- ity (http://www.medsafe.govt.nz/index.asp, accessed 29 July 2013). 9. Wahdan MA et al. Auditing in Egypt: a study of the legal frame- work and professional standards. Paper presented at MsM's Partners Conference. Maastricht, Maastricht School of Manage- ment, 2005. 10. China Food and Drug Administration [website] (http://www. sfda.gov.cn, accessed 29 July 2013) [in Chinese]. 11. Liamputtong P, Ezzy D. Qualitative research methods. Oxford, Oxford University Press, 2005. 12. Creswell JW. Research design: Qualitative, quantitative and mixed methods approaches. Thousand Oaks, California, Sage, 2009. 13. Hussey J, Hussey R. Business research: a practical guide for undergraduate and postgraduate students. Basingstoke, United Kingdom, Palgrave, 1997. 14. Lincoln YS, Guba EG. Naturalistic inquiry. Newbury Park, Cali- fornia, Sage, 1985. 15. Foddy N. Constructing questions for interviews and question- naires: theory and practice in social research. Cambridge, Cam- bridge University Press, 1993. 16. GMP Institute—the global leader for GMP training. International Society of Pharmaceutical Engineers [online resource centre] (http://www.gmp1st.com, accessed 29 July 2013). 17. Medical facility licensing. Health Authority Abu Dhabi (http:// www.haad.ae/haad/tabid/125/Default.aspx, accessed 29 July 2013). 18. Manufacturing licensing and GMP certification procedures and guidelines. Abu Dhabi, Ministry of Health, United Arab Emir- ates, 2009. 19. Jordanian Food and Drug Administration [website] (http:// www.jfda.jo/en/Departments/DeptInfo.aspx?id=614&Title, accessed 29 July 2013). 20. Al-Showaier I. Central Committee for Drug Regulation. Paper presented at the GCC Central Registration Conference, Saudi Arabia (http://www.ich.org/fileadmin/Public_Web_Site/ Meetings/C-GCG_Reports/Nov_2004_Yokohama/GCC_ presentation_Nov._04.pdf, accessed 29 July 2013). 21. Vogel D. The globalization of pharmaceutical regulation. In- ternational Journal of Policy and Administration, 1998, 11:1–22. 22. Juillet Y. Internationalization of regulatory requirements. Phar- maceuticals Policy and Law, 2007, 9:369–382. 23. Graetz F et al., eds. Managing organisational change. Milton, Queensland, John Wiley, 2002. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 930 Pharmacovigilance in Qatar: a survey of pharmacists K. Wilbur 1 ABSTRACT Active national pharmacovigilance programmes are needed to monitor adverse drug reaction (ADR) data in local populations. The objective of this study was to describe the knowledge, experiences, attitudes and perceived barriers to reporting of suspected ADRs by pharmacists in Qatar. A 27-item web-based survey was answered by 116 pharmacists (25% response rate). Knowledge of ADR terminology and reporting purpose was high, but only 29.3% had ever made a suspected ADR report in Qatar. Most respondents expressed positive attitudes towards the pharmacist’s role in pharmacovigilance. Inability to recognize a potential ADR or access a reporting form were perceived as barriers. Enhanced training and efficiency in report submissions were identified as facilitators to future participation. Hospital pharmacists were 7 times more likely to have reported a suspected ADR in Qatar. Pharmacists in Qatar are willing to engage in pharmacovigilance activities if supported by increased training and transparency in the reporting process. 1College of Pharmacy, University of Qatar, Doha, Qatar (Correspondence to K. Wilbur: kwilbur@qu.edu.qa). Received: 25/07/12; accepted: 01/10/12 ةلدايصلل نايبتسا :رَطَق في نيلاديصلا ظُّقيتلا برليو ييرك هذه تفده دقو .ينيلحلما ناكسلا لىع ةيودلأل ةرئاضلا تايرثأتلا دصر لجأ نم نيلاديصلا ظ ُّقيتلل ةلاعف ةينطو جمابرل ةجالحا ستم :ةـصلالخا دقو .رطق في ةلدايصلا لبق نم ةيودلأل ةرئاضلا تايرثأتلا نع غلابلإل ةبسنلاب ةكردلما تابقعلاو فقاولماو تابرلخاو فراعلما فصو لىإ ةساردلا غلابلإا نم ضرغلابو تاحلطصلماب ةفرعلما تناك دقو ،)%25 ةباجتسلاا لدعم( تنترنلإا برع ًادنب 27 نمضتي نايبتسا لىع ًاينلاديص 116 باجأ ينبيجتسلما مظعم ّبرع دقو .رطق في ةيودلأل ةرئاضلا تايرثأتلا لوح ًاغلاب ًادبأ بتكي لم مهنم طقف %29.3 نأ لاإ ،ينعفترم ةيودلأل ةرئاضلا تايرثأتلاب ةيودلأل ةرئاضلا تايرثأتلا عوقو لماتحا لىع فرعتلا لىع ةردقلا مدع لىإ نوبيجتسلما رظن ماك ،يئاودلا ظ ُّقيتلا في ليديصلا رود وحن ةيبايجإ فقاوم نع ليهست لماوع ةباثمب تاغلابلا ميدقت في ةءافكلا لىإو رزعلما بيردتلا لىإ نوبيجتسلما رظن ماك ،قئاوعلا نم مانهأ لىع غلابلإا جذومن لىإ لوصولا وأ بغريو .رطق في مهيرغ فاعضأ ةعبسب ةيودلأل ةرئاضلا تايرثأتلا نع غلابلإل ًلاماتحا رثكأ تايفشتسلما في ةلدايصلا ناكو .لبقتسلما في غلابلإا .غلابلإا ةيلمع في ةيفافشلابو بيردتلا نم ديزمب مهمعد ّمت اذإ نيلاديصلا ظ ُّقيتلا ةطشنأب ماهسلإا في رطق في ةلدايصلا Pharmacovigilance au Qatar : enquête auprès des pharmaciens RÉSUMÉ Des programmes de pharmacovigilance nationaux actifs sont requis pour surveiller les données relatives aux réactions indésirables aux médicaments dans les populations locales. L’objectif de la présente étude était de décrire les connaissances, les expériences, les attitudes et les obstacles perçus en matière de notification des réactions indésirables par les pharmaciens au Qatar. 116 pharmaciens ont répondu à une enquête en ligne à 27 items (taux de réponse de 25 %). Leur niveau de connaissances en ce qui concerne la terminologie pour les réactions indésirables et les objectifs de notification était élevé, mais seuls 29,3 % d’entre eux avaient déjà notifié une suspicion de réaction indésirable au Qatar. La majorité des répondants ont présenté des attitudes positives au sujet du rôle du pharmacien en matière de pharmacovigilance. L’incapacité à reconnaître une réaction indésirable potentielle ou à accéder à un formulaire de notification ont été perçus comme des obstacles. Une formation et une efficacité accrues dans la transmission des notifications ont été identifiées comme des facteurs favorisant une future participation. Les pharmaciens hospitaliers étaient sept fois plus susceptibles d’avoir notifié une suspicion de réaction indésirable que les autres pharmaciens dans le pays. Les pharmaciens au Qatar sont disposés à s’impliquer dans des activités de pharmacovigilance s’ils bénéficient d’une formation et d’une transparence accrues pour le processus de notification. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 931 Introduction Suspected adverse drug reaction (ADR) reporting is the cornerstone of pharmacovigilance activity; however, its infrastructure varies throughout the world. Surveillance programmes within individual health care facilities may supplement a central national registry, which may in turn augment an international database. Most reporting systems are voluntary and while spon- taneous reporting offers advantages of low expense and less complexity, bar- riers such as time, ambiguity in ADR identification and lack of feedback contribute to under-reporting in sev- eral countries [1–6]. Qatar is an affluent Arab emirate with a population of 1.9 million (pre- dominantly expatriates). The Qatar Supreme Council of Health (SCH) has a pharmacy and drug control department subdivision assuming various medication regulation roles, but there is no coordinated national pharmacovigilance programme. A re- cent inventory of pharmacovigilance activity in Qatar inpatient settings found that suspected ADR reporting policies and procedures are in place within all public hospitals, but in only 1 of the 5 private hospitals [7]. The success of any surveillance system relies on the active participa- tion of its reporters and is the respon- sibility of everyone involved in the medication use process. Pharmacists working in Qatar are a multinational group, emerging from heterogeneous curricula and training programmes abroad, who may have been exposed to different processes of suspected ADR reporting and experiences with pharmacovigilance activities in gen- eral  [8]. The objective of  the present  study was to describe pharmacists’ knowledge, experiences, attitudes and perceived barriers to ADR reporting in Qatar. Methods Sample Using workplace contact information, all known pharmacists in Qatar (n = 568) were invited by email to participate  in an anonymous web-based survey. The research was approved by both the University of Qatar and London School of Hygiene and Tropical Medicine in- stitutional review boards. Questionnaire development A comprehensive review of the English language literature was conducted us- ing pertinent electronic health data- bases (PubMed, Embase, International Pharmaceutical Abstracts, Cumulative Index to Nursing and Allied Health Lit- erature)  from 1990 to December 2010  using a combination of predetermined keywords and phrases. Hand-searching of references of retrieved articles was also performed. The questionnaire was developed according to the domains of interest evaluated in this existing litera- ture: subject demographics; ability to detect suspected ADRs (knowledge); experiences reporting suspected ADRs; attitudes towards the pharmacists’ role in ADR reporting; perceived barriers and facilitators to suspected ADR reporting; and recommendations for improvements in this process locally. The questionnaire draft was formatted as an electronic survey and reviewed for face and content validity and piloted by a small randomly selected group of Qatari pharmacists. Analysis Incomplete surveys were analysed if a response to the dependent variable question (history of suspected ADR reporting in Qatar) was given. Fre- quencies of correct answers to ADR knowledge questions were assessed. Re- sponses were further stratified according to categorical demographic parameters as well as comparisons between ADR reporters and non-reporters. Univariate and multiple logistic regression analyses were used to examine differences in ADR reporting (dependent variable) among pharmacists according to a priori defined criteria including independent variables: age; sex; years in practice; and practice setting. All data analyses were conducted using SPSS for Mac®, version 19.0. Results Background characteristics The survey remained open between 30  April and 30 June 2011. Of the 142/568  responses (25.0% response  rate), 116  (81.7%) surveys  included  information  about prior experiences with reporting suspected ADRs. A total of 17 different countries of origin were represented and almost half of pharmacists had practised in Qatar for < 5 years (Table 1). Most respond- ents represented hospital inpatient practices (64.0%). Only 14 (12.1%) had  never worked in a hospital pharmacy. Knowledge of ADRs Pharmacists’ knowledge of ADR termi- nology was assessed and over 90% iden- tified the World Health Organization description of an ADR; however, ap- proximately 1  in 5 selected statements  were inconsistent with accepted ADR descriptions. Most pharmacists were able to correctly distinguish an ADR from a medication error [9,10]. Experience of ADR reporting Less than half of the respondents (49, 42.2%)  had  made  suspected  ADR  reports  in  the  past  and  34  (29.3%)  reported doing so in Qatar. Most of these local reports (29, 85.3%) were by  hospital pharmacists,  4  (11.7%)  from  ambulatory clinics and 1 from a non- direct patient care position. None of the community pharmacists surveyed had ever made a suspected ADR report in Qatar. Reporters mostly submitted EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 932 their documentation to their hospitals (97.0%), but also directly  to  the SCH  (14.7%) or drug manufacturer (5.9%);  18 (52.9%) described  receiving  some  form of acknowledgement for their sub- mission. When asked to describe the ultimate fate of a submitted suspected ADR report in Qatar, over half of all surveyed  pharmacists  (54.3%)  were  unsure. Attitudes and barriers to ADR reporting Respondents uniformly agreed with the aims of pharmacovigilance activity to promote new understanding of medica- tion; patient safety; and transparency of reporting. A high proportion (84.4%)  felt that suspected ADR reporting was a professional obligation and if faced with a patient experiencing a serious ADR,  the majority  (90.5%)  thought  they would initiate a suspected ADR report. Although many respondents agreed that lack of access to a reporting form and remuneration were problematic, a larger proportion disagreed that these issues were barriers. Time constraints were also rated low (21.2%) as a poten- tial impediment. Inability to recognize a suspected ADR was a barrier stated by 39.4% of  respondents. Pharmacists  identified an increased likelihood of reporting a suspected ADR if the re- actions were: serious for the patient (96.2%); novel  (90.2%) or  associated  with  a new medication  (88.8%);  and  if some acknowledgment was offered (75.2%). Many  respondents  (81.6%)  felt more pharmacovigilance training and an ability to submit online (68.6%)  would facilitate reporting. Factors influencing ADR reporting There were no significant differences among respondents when stratified according to sex, age, practice setting Table 1 Demographic characteristics of pharmacists responding to the survey of adverse drug reporting (n = 116) Variable Value Mean (SD) Age (years) 36.2 (8.3) No. % Sex (female) 61 52.6 Country of origin (n = 114) a Qatar 4 3.4 Other GCC country 1 0.9 Egypt 40 34.5 Jordan 13 11.2 Other Middle Eastern country 13 11.2 Sudan 21 18.1 Other African country 3 2.6 India/Pakistan 8 6.9 Philippines 5 4.3 Canada/United States 5 4.3 United Kingdom 1 0.9 Highest pharmacy degree Bachelors 102 87.9 Masters 9 7.8 Doctorate (PhD or PharmD) 5 4.3 Year of highest pharmacy degree 2000–11 62 53.4 1990–99 38 32.8 1980–89 12 10.3 1970–79 4 3.4 Country where highest pharmacy degree obtained (n = 109) GCC country 2 1.7 Egypt 41 35.3 Jordan 20 17.2 Other Middle Eastern country 7 6.0 Sudan 12 10.3 Other African country 2 1.7 India/Pakistan 10 8.6 Philippines 5 4.3 Other European or Asian country 2 1.7 United Kingdom 6 5.2 Canada/United States 2 1.7 Duration of working as a pharmacist (years) (n = 115) < 2 6 5.2 2–5 14 12.1 6–10 41 35.3 11–15 26 22.4 < 15 28 24.1 طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 933 and years  in practice (Table 2). Only  availability of an ADR form was con- sidered a greater barrier for ambula- tory care pharmacists when compared with their hospital-based colleagues (11.4% versus 40.3%, P = 0.002). When  controlling for all other factors in the model, respondents working in hospital settings were over 7 times more likely to have reported a suspected ADR in Qatar. Discussion This is the first study evaluating sus- pected ADR reporting among phar- macists in Qatar. Knowledge of ADR classification was assessed, as it follows that poor knowledge would lead to low declared reporting rates. Correct identification of ADRs through rec- ognition of definitions and patient de- scriptions was high in our sample and greater than that reported elsewhere recently [2,5]. Respondents illustrated  a good understanding of purpose and positive attitudes towards suspected ADR reporting by pharmacists as the majority considered it a professional obligation. One-third of respondents had sub- mitted a suspected ADR report in Qatar. This rate is higher than in community pharmacist populations documented recently in the region (approximately 10%  in Saudi Arabia, 21%  in Turkey),  but within reported ranges when sur- veys among hospital pharmacists in the past decade  are  considered  [2,6].  Hospital pharmacists were most likely to have made a suspected ADR report and this is consistent with studies con- ducted elsewhere. Factors for such inpa- tient site-related differences in reporting have been previously proposed and include greater familiarity with phar- macovigilance; constant contact with patients experiencing serious ADRs; and close relationships with physicians who may delegate reporting of ADRs. When controlling for other variables in our model, increased age was also Table 1 Demographic characteristics of pharmacists responding to the survey of adverse drug reporting (n = 116) (concluded) Variable Value Duration of practice in Qatar (years) (n = 109) No. % < 2 21 18.1 2–5 27 23.3 6–10 42 36.2 11–15 14 12.1 < 15 12 10.3 Pharmacy practice site Community 19 16.4 Ambulatory care (private or public) (n = 5) 16 13.8 Hospital (private or public) (n = 3) 72 64.0 Other 9 7.8 aExamples of countries represented in the categories include: GCC (Oman, Kuwait); other Middle Eastern (Lebanon, Palestine, Syrian Arab Republic); other African (Nigeria, South Africa). GCC = Gulf Cooperation Council; SD = standard deviation. Table 2 Logistic regression analysis of influence of personal and professional characteristics on adverse drug reporting (ADR) reporting by pharmacists in Qatar Characteristic Ever reported ADR in Qatar Crude analysis Adjusted analysis a No Yes OR (95% CI) P-value OR (95% CI) P-value Sex Male 34 20 1.00 Female 47 14 0.51 (0.23–1.14) 0.100 0.33 (0.11–0.95) 0.04 Age (years) b 1.01 (0.96–1.06) 0.653 0.86 (0.76–0.99) 0.03 Practice site Outpatient 31 4 1.00 Inpatient 43 29 5.23 (1.67–16.4) 0.002 7.42 (1.90–27.8) 0.003 Duration of practice in Qatar (years) < 2 19 2 1.00 2–5 22 5 2.15 (0.38–12.4) 0.390 1.43 (0.22–9.40) 0.790 6–10 11 3 6.46 (1.20–21.4) 0.020 11.2 (1.60–77.6) 0.020 11–14 25 17 2.59 (0.37–17.9) 0.340 6.78 (0.61–75.7) 0.12 > 15 5 7 13.3 (3.50–84.9) 0.006 23.7 (6.70–83.8) 0.003 aAdjusted for the effects of the other variables in the table; bIn the adjusted analysis, OR of 0.86 indicates that for each additional year of age, a respondent was 0.86 times less likely to reported a suspected ADR in Qatar, controlling for other factors in the model. OR = odds ratio; CI = confidence interval. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 934 associated with decreased reporting. Older pharmacists in Qatar may have graduated from product-centred edu- cation models historically offered in the Middle East region as opposed to more contemporary patient-oriented programmes and, despite greater prac- tical experience, have less clinical con- fidence in detecting potential ADRs [8]. However, pharmacists with longer  practice history in the country in theory have had greater opportunities to en- counter, detect and report suspected ADRs in Qatar. Unavailability of a reporting form has been a stated constraint to volun- tary participation in pharmacovigilance activities in other studies [11–13], but  this was not a collective barrier in our population; this may be due to the large number of hospital practitioners responding who may have a standard form in place at their site. Pharmacists preferred a single and accessible sus- pected ADR reporting form with web- based submission capability. Qatar pharmacists did express sentiments similar to both community and hos- pital pharmacists elsewhere who were unsure if a patient reaction was truly an ADR [14]. Communication and education from regulatory and health professional bodies should emphasize that clinical certainty is not a prerequi- site for report submission, as causality assessment can be performed by the pharmacovigilance authority accord- ing to documentation of the suspected ADR provided by the reporter. Uncertainty exists about how sub- mitted suspected ADR reports are handled in Qatar. There is no directive in which reports are automatically ad- vanced to the SCH from patient care sites and there is no indication that reports received by the SCH are con- sistently or systematically addressed. Local (hospitals, primary-care cen- tres) and national (SCH) bodies alike could enhance pharmacovigilance awareness and reporting with imple- mentation of a feedback mechanism; only half of our respondents described receiving some form of acknowledge- ment for their submission [15]. There were a number of limita- tions to our survey warranting dis- cussion. Survey completion was by an internet-based questionnaire. Community pharmacies in Qatar do not generally have computers and so pharmacists with limited or no internet access at home may have been disadvantaged. Non-response error compromises the accuracy of our conclusions and may further con- tribute to selection bias and restrict the generalizability of our study find- ings. Those who did not participate in the study may have had less pharma- covigilance awareness; therefore our findings regarding knowledge and attitude may be overestimations and the barriers to reporting underestima- tions. Finally, because it is not possible to access the identity of pharmacists who have made suspected ADR submissions in Qatar, a case–control study methodology to assess the fac- tors associated with ADR reporting was not possible. As our study relies on self-reporting, we cannot confirm pharmacists’ declared pharmacovigi- lance activities. Conclusions The results indicated that pharmacists’ workplaces exerted a strong influence on the reporting of suspected ADRs in Qatar. Most responding pharmacists had never submitted a report in the country, although they expressed posi- tive attitudes towards pharmacovigi- lance activity and good knowledge of its purpose. Acknowledgements The statements made herein are solely the responsibility of the author. The author wishes to thank undergradu- ate University of Qatar College of Pharmacy students, Hala Sonallah and Amna Fadul, for their efforts in the initial development and translation of the pharmacist survey. Funding: This report forms one part of a larger project evaluating pharma- covigilance in the Middle East made possible by an undergraduate research experience project award from the Qatar National Research Fund (a member of the Qatar Foundation). Competing interests: None declared. References 1. Belton KJ; The European Pharmacovigilance Research Group. Attitude survey of adverse drug-reaction reporting by health care professionals across the European Union. European Jour- nal of Clinical Pharmacology, 1997, 52:423–427. 2. Toklu HZ, Uysal MK. The knowledge and attitude of the Turk- ish community pharmacists toward pharmacovigilance in the Kadikoy district of Istanbul. Pharmacy World and Science, 2008, 30:556–562. 3. Bawazir SA. Attitude of community pharmacists in Saudi Ara- bia towards adverse drug reaction reporting. Saudi Pharma- ceutical Journal, 2006, 14:75–83. 4. Al-Sultan MS, Bawazir SA. Adverse drug reaction reporting by hospital pharmacists in Saudi Arabia. Saudi Pharmaceutical Journal, 2009, 17:95–105. 5. Su C, Ji H, Su Y. Hospital pharmacists’ knowledge and opinions regarding adverse drug reaction reporting in Northern China. Pharmacoepidemiology and Drug Safety, 2010, 19:217–222. 6. Nita Y, Batty KT, Plumridge RJ. Adverse drug reaction report- ing: attitudes of Australian hospital pharmacists and doctors. Journal of Pharmacy Practice and Research, 2005, 35:9–14. 7. Wilbur K. Pharmacovigilance in Qatar hospitals. Pharmaceuti- cal Medicine, 2012, 26:23–25. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 935 8. Kheir N et al. Pharmacy education and practice in 13 Middle Eastern countries. American Journal of Pharmaceutical Educa- tion, 2009, 72:1–13. 9. World Health Organization. International drug monitoring— the role of the hospital. A WHO report. Drug Intelligence and Clinical Pharmacy, 1970, 4:101–111. 10. Aronson JK. Medication errors: definitions and classification. British Journal of Clinical Pharmacology, 2009, 67:599–604. 11. Irujo M et al. Factors that influence under-reporting of sus- pected adverse drug reactions among community pharmacists in a Spanish region. Drug Safety, 2007, 30:1073–1082. 12. Elkalmi RM et al. A qualitative study exploring barriers and facilitators of reporting adverse drug reactions (ADRs) among community pharmacists in Malaysia. Journal of Pharmaceutical Health Services Research, 2011, 2:71–78. 13. Al-Sultan MS, Bawazir SA. Adverse drug reaction reporting by hospital pharmacists in Saudi Arabia. Saudi Pharmaceutical Journal, 2009, 17:95–105. 14. Nebeker JR, Barach P, Samore MH. Clarifying adverse drug events: a clinician’s guide to terminology, documentation, and reporting. Annals of Internal Medicine, 2004, 140:795–801. 15. Vallano A et al. Obstacles and solutions for spontaneous re- porting of adverse drug reactions in the hospital. British Journal of Clinical Pharmacology, 2005, 60:653–658. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 936 Isolation and identification of Legionella pneumophila from drinking water in Basra governorate, Iraq A.A. Al-Sulami,1 A.M.R. Al-Taee 2 and A.A. Yehyazarian 2 ABSTRACT This study in Iraq investigated the occurrence of Legionella. pneumophila in different drinking- water sources in Basra governorate as well as the susceptibility of isolates to several antibiotics. A total of 222 water samples were collected in 2008–2009: 49 samples from water purification plants (at entry points, from precipitation tanks, from filtration tanks and at exit points), 127 samples of tap water; and 46 samples from tankers and plants supplying water by reverse osmosis. The findings confirmed the presence of L. pneumophila in sources of crude water, in general drinking water supplies and drinking water tankers. Of 258 isolates 77.1% were serotype 1 and 22.9% serotypes 2–15. All examined isolates displayed drug resistance, particularly to ampicillin, but were 100% susceptible to doxycycline. The prevalence of L. pneumophila, especially serogroup 1, is a strong indicator of unsuitability of drinking water and requires appropriate action. 1Department of Biology, College of Education, University of Basra, Basra, Iraq (Correspondence to A.A. Al-Sulami: Aminabdulah@yahoo.com). 2Department of Marine Environmental Chemistry, Marine Science Centre, Basra, Iraq. Received: 06/04/12; accepted: 30/07/12 قارعلا ،ةصربلا ةظفامح في بشرلا هايم في اهيلع فرعتلاو ةَحِو َْتْسُمـلا ةيقَلْيَفلا دارفتسا نايراز اييح نيورزرأ اتينأ ،يئاطلا اضر دممح دعسأ ،يملسلا للها دبع رابلجا دبع ينمأ ،ةصربلا ةظفامح في بشرلا هايلم ةفلتمخ رداصم في ةَحِو َْترْسُمـلا ةيقليفلا دوجو لدعم لىع فرعتلل قارعلا في ةساردلا هذه نوثحابلا ىرجأ :ةـصلالخا 49 اهيف ناكو ،2009 – 2008 ةترفلا في تعجم ةنيع 222 هايلما تانيع ددع غلب دقو .ةيويلحا تاداضلما نم ددعل تادرفتسلما فلتمخ ةباجتسا ىدمو 46و ،يربانصلا هايم نم ةنيع 127و ،)جورلخا طاقن فيو حيشترلا جيراهص فيو بيسترلا جيراهص فيو ،لوخدلا طاقن في( هايلما ةيفصت تاطمح نم ةنيع ،مالخا هايلما رداصم في ةحوترسلما ةيقليفلا دوجو جئاتنلا تدكأ دقو .سيكعلا حضانتلا للاخ نم تعجم عيراشلماو جيراهصلل تادادملإا هايم نم ةنيع طمانلأا نم %22.9 ناكو 1 ليصلما طمنلا نم اهنم %77.1 ناك ،ةدرفتسم 258 ينب نمو .بشرلا هايم جيراهص فيو ةماعلا بشرلا هايم تادادمإ فيو ةساردلا ّلدتو .ةئلماب ةئم ينلكيس سيكودلل بيجتست انهأ لاإ ،ينليسيبملأا مايسلاو ،ةيودلأل ةمواقم تادَرفتسلما عيجم ترهظأ دقو .15 – 2 ةيلصلما .ٍلجاع ءارجإ ذاتخا ةروضر لىعو بشرلا هايم ةمءلام مدع لىع يوق شرؤم 1 ةيلصلما ةعومجلما مايسلاو ،ةحوترسلما تايقليفلا راشتنا تلادعم نأ لىع Isolement et identification de Legionella pneumophila dans l’eau potable dans le gouvernorat de Bassora (Iraq) RÉSUMÉ Une étude en Iraq visait à évaluer l’occurrence de Legionella pneumophila dans différentes sources d’eau potable dans le gouvernorat de Bassora ainsi que la sensibilité des isolats à plusieurs antibiotiques. Au total, 222 échantillons d’eau ont été prélevés en 2008 et 2009 : 49 échantillons de stations d’épuration des eaux usées (aux points d’entrée, dans les cuves de précipitation, dans les cuves de filtration et aux points de sortie), 127 échantillons d’eau du robinet et 46 échantillons d’eau de camions-citernes et d’établissements fournissant de l’eau par osmose inverse. Les résultats ont confirmé la présence de L. pneumophila dans les sources d’eau brute, dans les sources d’approvisionnement générales et les camions-citernes d’eau de boisson. Sur 258 isolats, 77,1 % étaient de sérotype 1 et 22,9 % de sérotypes 2–15. Tous les isolats examinés étaient pharmacorésistants, en particulier à l’ampicilline, mais 100 % étaient sensibles à la doxycycline. La prévalence de L. pneumophila, notamment du sérogroupe 1, est un puissant indicateur du caractère impropre à la consommation de l’eau de boisson et appelle des mesures adéquates. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 937 Introduction The Legionella pneumophila species of bacteria comprises over 15 serogroups  [1], of which serogroup 1 is responsible for the majority of human infections [2].  Two clinical manifestations have been defined within this spectrum: Legion- naires’ disease, which is a pneumonic illness caused by an acute bacterial infection of the lower respiratory tract; and Pontiac fever, which is an influenza- like  illness  [3]. This  Gram-negative  bacterium survives in water systems as a parasite of protozoa [4], which are readily found in cooling towers, hot- water distribution systems, bathrooms, swimming pools  and  fountains  [5,6].  Infection results when L. pneumophila are transmitted from an environmental source (water or soil) to a host via the inhalation of contaminated aerosols. However, there have been no reports of human-to-human transmission [1]. Therefore, studies concerning the pres- ence of these organisms in drinking- water distribution systems are very important to ensure the good quality of public water. The present study in Iraq aimed to investigate the occurrence of L. pneu- mophila in different drinking-water sources in Basra governorate (water sanitation plants, drinking water from different districts and reverse-osmosis water-supply plants), as well as the sus- ceptibility of isolates to several antibiot- ics. Method Water samples A  total  of  222  water  samples  were  collected in Basra governorate during the period  from August 2008  to April  2009. These included: 49 samples from  all 13 water purification plants  in  the  governorate  (13  samples  from entry  points, 13  from precipitation tanks, 10  from filtration  tanks  and 13  samples  from  exit  points);  127  samples  of  tap water  collected  from 18 districts;  and 46 water  samples  collected  from  reverse-osmosis water suppliers (from tankers supplying water by reverse os- mosis in 19 different places and from 5  water-supply plants). The samples were collected accord- ing to Standard methods for examina- tion of water and wastewater [7] into sterile  sampling bottles, with 10 mL  of a sodium thiosulphate solution at 1%  in order  to neutralize any  residual  chlorine. The water samples were di- rectly placed in ice, for transportation and examination within the same day. The concentration of residual chlorine for each sample was measured using a chlorine meter (Lovibond 2000) at the  time of collection. Isolation A duplicate of 5 mL of each sample from  water purification plants and tap water and  100 mL  of  water  samples  from  reverse-osmosis plants and tankers was filtered by the membrane filtration tech- nique using 47 mm cellulose acetate membrane filters with a nominal pore size of 0.45 µm (Sartorius). The mem- brane filter papers were placed on m-FC agar and incubated in a water bath at 44.5 °C for 24 h and on Legionella agar  base  (LAB) medium  [8]  containing  Legionella growth supplement and Legionella-selective supplement which contained dyes, colistin sulphate, vanco- mycin, trimethoprim and amphotericin B (Himedia). They were incubated at 35 °C  in an  incubator with humidified  atmosphere for 24–72 h. Identification Suspected colonies were subcultured in parallel onto LAB medium and were subjected to Gram stain, oxidase, cata- lase, nitrate reduction, motility, gelatin liquefaction, urease and hippurate test. In addition the slide-agglutination test [1] (HiLegionella latex kit, HiMedia) was used for confirmatory identification of L. pneumophila to serogroup 1 and serogroups 2–15. Antimicrobial susceptibility testing Isolates were tested for antimicrobial susceptibility by the Stoke disk diffusion method [9] using Mueller–Hinton agar and antibiotic disks (Bioanalyse). The following disks were used: doxycycline (30 µg),  erythromycin (15 µg),  strep- tomycin (10 µg), gentamicin (10 µg),  chloramphenicol (30 µg) and ampicil- lin (10 µg). The plates were incubated at  37  °C overnight. The diameter of zone  of inhibition of each antimicrobial agent was measured and recorded as resistant, sensitive or intermediate according to the manufacturer’s table. Results Purification plant samples The logarithmic numbers of L. pneu- mophila and faecal coliforms from the 13 water  purification plants  in Basra  governorate are shown in Figure 1. All stations (except 1) showed the pres- ence of both L. pneumophila and faecal coliforms in raw water. There was no obvious reduction of these 2 groups  in  precipitation and filtration tanks. Few stations, (5/13) showed the presence of  L. pneumophila, whereas 9/13 were posi- tive for faecal coliforms in water coming from treatment plants. In precipitation tanks  3/13  stations  showed  higher  number of L. Pneumophila, while in the filtration  tanks 2/13  stations  showed  higher numbers of L. pneumophila. Of the 106  isolates  recovered  from  purification plant samples on LAB medium,  55  of  them belonged  to L. pneumophila serogroup 1 while the rest belonged to L. pneumophila serogroups 2–15. Tap water samples Table 1 shows the average of the loga- rithmic numbers of L. pneumophila and faecal coliforms and the concentration of residual chlorine for the 127 samples  of drinking tap water collected from 18  districts. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 938 A  total  of  133  isolates of L. pneu- mophila serogroup 1 were isolated from these districts, while only 6  isolates of  serogroups 2–15 were  isolated  from  Al-Jubaila and Al-Junaina districts. All stations were positive for L. pneumophila at frequencies much higher than those recorded for the water coming from treatment plants. Reverse-osmosis water samples A total of 41 samples were collected from reverse-osmosis water-supply tankers in 19 different districts in Basra governorate. The average of logarithmic numbers of L. pneumophila and faecal coliforms indicated the presence of L. pneumophila in 6/19 stations while fae- cal coliforms was recorded in 12/19 sta- tions. Only 8 isolates of L. pneumophila serogroup 1 were isolated from reverse- osmosis water tankers. In  addition 5 main  reverse-osmo- sis plants in Basra governorate were tested for L. pneumophila, indicating the presence of L. pneumophila in only 1/5  stations  as  compared  to 3/5  sta- tions harbouring faecal coliforms. Only 3 isolates of L. pneumophila serogroup 1 were isolated from the reverse-osmosis plants of the General Company of Pet- rochemical Industries. Serogroups The total number of L. pneumophila isolated  on  LAB medium were  258;  serogroup 1 (199 isolates) comprised 77.1% of  total  isolates and serogroups  2–15 (59 isolates), comprised 22.9% of  total isolates. Antibiotic susceptibility tests Antibiotic susceptibility testing was done  for  10 L. pneumophila isolates, 8  isolates  belonging  to  serogroup  1,  and 2  isolates belonging to serogroups  2–15.  Among  serogroup  1  isolates  there was 83.0% resistance to ampicillin,  37.5%  to  erythromycin and 50.0%  to  chloramphenicol and gentamicin, but 100%  sensitivity  to  doxycycline. On  other hand, isolates of serogroups 2 –15  showed 75.0% resistance  to ampicillin,  100% intermediate sensitive to erythro- mycin and streptomycin, 50% sensitive  to chloramphenicol and gentamicin and 100% sensitive to doxycycline. Discussion Water is a fundamental need for all forms of life, yet human beings con- tinue to pollute the reserves which still remain, thus increasing the risk of dis- eases that can jeopardize the population [10].  In  this  study using LAB medium  as a selective medium for isolating L. pneumophila, most of the water sam- ples in Basra governorate were found to be positive for growth of L. pneu- mophila. These bacteria were isolated from raw water entering the plants and their numbers were uncountable in some plants, confirming that water is a natural reservoir for Legionella spp. The bacterium is ubiquitous in fresh water Table 1 Average residual chlorine concentration and average frequency of Legionella pneumophila and fecal coliforms isolated from drinking water (tap water) in Basra governorate, Iraq District No. of samples Average of residual chlorine concentration (mg/L) Average log no. of fecal coliforms Average of log no. of L. pneumophila No. of L. pneumophila isolates Old Basra 9 1.03 2.89 1.66 10 Al-Jame’eyat 3 0.05 3.03 1.84 5 Al-Ashar 17 0.04 3.44 1.72 18 Al-Ma’aqal 13 0.17 3.43 1.71 15 Al-Hakeemya 8 0.63 2.91 1.50 5 Shatt-Al-Arab 10 0.44 2.66 2.14 8 Al-Esmae’e 5 0 2.32 1.30 4 Al-Hussain 8 1.01 2.78 1.81 8 Al-Tuwaisa 6 0 3.18 2.61 8 Al-Hadi 4 0 3.60 1.44 6 Al-Abela 3 0 3.44 1.54 7 Al-Jubaila 5 1.4 4.00 1.54 7 Al-Jazae’er 3 0 2.87 1.30 5 Al-Jumhurya 3 0 2.33 89.1 3 Al-Junaina 5 0.02 3.72 1.57 5 Al-Mowafakai 5 0 2.66 87.1 5 Al-Fayhaa 9 0.31 2.32 2.31 8 Abu-Al-Khaseeb 11 1.32 2.34 1.60 12 Total 127 – – – 139 طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 939 Fi gu re 1 A ve ra ge o f l og ar it hm ic n um be rs p er m L of L eg io ne lla p ne um op hi la a nd fe ca l c ol ifo rm s is ol at ed fr om w at er tr ea tm en t p la nt s in B as ra g ov er no ra te , I ra q 0 0 .511.522. 53 3. 54 Al-Baradhiya Al-Rubat Al-Fayhaa Al-Labani Al-Abbas Al-Ma'aqal Hamdan Shatt Al-Arab Uwasyan Muhaila Muhajran Al-Baradhiya Al-Jubaila I Al-Jubaila II Al-Rubat Al-Fayhaa Al-Labani Al-Abbas Al-Ma'aqal Hamdan Shatt Al-Arab Uwasyan Muhaila Muhajran Average Al-Baradhiya Al-Jubaila I Al-Jubaila II Al-Rubat Al-Fayhaa Al-Labani Al-Abbas Al-Ma'aqal Hamdan Shatt Al-Arab Uwasyan Muhaila Muhajran Al-Baradhiya Al-Jubaila I Al-Jubaila II Al-Rubat Al-Fayhaa Al-Labani Al-Abbas Al-Ma'aqal Hamdan Shatt Al-Arab Uwasyan Muhaila Muhajran W at er c om in g ou t o f p la nt Fi ltr at io n ta nk s Pr ec ip ita tio n ta nk s R aw w at er log/mL Fa ec al L. p ne um op hi la Al-Jubaila I Al-Jubaila II EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 940 sources [11], which may be due to the inadequacy of sewage water processing before it is dumped into rivers. This bacterium is also able to infect protozoa, a relationship that provides protection for the bacterium against adverse envi- ronmental conditions [12],  in addition  to the presence of organic materials that provide nutrients for Legionella spp. growth. This study was similar to that of Wullings and van der Kooij who used culture methods and polymerase chain reaction techniques [13]. L. pneumophila were also isolated from precipitation tanks and it was noted that in some plants the numbers were higher than the numbers in raw water. This may be a result of ineffi- ciency in the primary treating stage of the raw water entering the plants, sug- gesting that the precipitation tanks work as a reservoir for the growth of these bacteria, perhaps due to the presence of suitable conditions such as precipitants and growth of algae. L. pneumophila were also present in the filtration units in some of the puri- fication plant samples in Basra and this could be ascribed to the fact that some of the plants are old and/or the filters used in these units are old and there is no maintenance or periodic cleaning or changing of filters. It was observed that in other water treatment plants these bacterium were not detected which provides evidence for the efficiency of filtration units in some cases, which is in agreement with the findings of Bomo et al. [14]. The high growth in the filtration stage of water treatment plants is known to occur in areas of slow-moving water, which may allow growth-supporting materials to accumulate. Passage of water through the rapid sand-filters of the plant almost completely reduces the potential for growth of bacteria, due to removal of growth-enhancing fac- tors and reducing the residence time of bacteria; these findings are similar to the observations of Hoekstra et al. on water passing through rapid and slow sand filters [15]. For the samples of water emerg- ing from plants, it was noted that L. pneumophila was absent in most plants and the number of isolates varied between plants, which may be due to the differences in remaining chlorine concentrations in the emission water, as chlorine activity depends on factors such as temperature and pH [2]; these  results are compatible with Hsu et al. [16]. L. pneumophila is more resistant than other organisms to common standard disinfecting methods. It may, therefore, be found even in disinfected waters with residual chlorine content [17]. A decrease in, or even absence of, chlorine at the extreme ends of the water distribution system increases the risk of growth of the bacterium. L. pneumophila was isolated from drinking (tap) water in different per- centages from district to district and in different areas in the same district of the governorate. The difference in the num- bers of isolates across different districts may be due to differences in the biologi- cal membranes (biofilms) formed in the  distribution  pipe  networks  [18].  Biofilms are essential for growth and proliferation of this bacterium [19]. The combination of organic elements, inorganic elements and the right water temperature create a good environ- ment for L. pneumophila proliferation [20,21]. Several studies have indicated  that the type of materials of water sup- ply systems (rubber, stainless steel or polyvinyl chloride) affects the forma- tion biofilms [22]. It is well known that  Iraq suffers from chronic water defi- ciency and therefore water treatment plants may not operate in a continuous manner. This creates conditions that contribute to the deterioration of water quality, mainly due to the precipitation and regrowth of pollutants in network pipes, as most of the networks undergo continuous breakage and corrosion that facilitates the entry of pollutants from rain water or infiltration of sewage water into networks. These results are similar to data reported in the literature, in which L. pneumophila was the pre- dominant species in freshwater and municipal drinking water supplies [23]  and L. pneumophila serogroup 1 was isolated at high frequencies in buildings [24]. Regarding samples of water treated by reverse osmosis it was found that 20  samples were positive  for L. pneu- mophila, which is compatible with what Goutziana  et  al.  have observed  [25].  Sunlight, temperature, pH and biofilms are factors that affect bacterial activity [13]. This  is  in  addition  to  the  risk of  pollution of water during transportation and storage, due to inadequate clean- ing and drying practices which provide suitable conditions for the growth and reproduction of pollutants in the stored water. No association was observed be- tween L. pneumophila and the presence of faecal coliforms in our study as L. pneumophila were detected in water samples in the absence of faecal coli- forms. This opportunistic pathogen has commonly been isolated in the absence of faecal contamination [26]. Development of resistance to anti- biotics may be due to increasing use of antibiotics for medical and agricultural purposes and there has been a rise in resistance  to  these drugs  [27].  In  the  present study isolates were more resist- ant to ampicillin and less resistant to erythromycin, chloramphenicol and gentamicin. Resistance to ampicillin has been reported previously among Legionella spp., due to beta-lactamase production  [28].  Erythromycin  has  usually been considered the anti- biotic of choice for the treatment of Legionnaires’ disease, but newer anti- biotics that are more potent and less toxic  are  now  replacing  it  [29].  For  aminoglycosides such as gentamicin, the mechanism of resistance that is predominantly observed clinically is chemical alteration of the drug cata- lysed by aminoglycoside-modifying enzymes  [30,31].  In  this  study  as  all  examined isolates were sensitive to طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 941 doxycycline, confirming the efficacy of doxycycline on L. pneumophila isolates as demonstrated in 7 European coun- tries [32]. This is the first report of L. pneu- mophila in water samples including References 1. Forbes BA, Sahm DF, Weissfeld AS. Bailey and Scott’s diagnostic microbiology, 12th ed. St Louis, Missouri, Mosby, 2007. 2. De Jong MD, Hien TT. Avian influenza A (H5N1). Journal of Clinical Virology, 2006, 35:2–13. 3. Hoge CW, Breiman RF. Advances in the epidemiology and control of Legionella infections. Epidemiologic Reviews, 1991, 13:329–340. 4. Fields BS. The molecular ecology of legionellae. Trends in Mi- crobiology, 1996, 4:286–290. 5. Abrail D, Riffard S. Detection and identification of Legionella species from ground waters. International Journal of Hygiene and Environmental Health, 2004, 67(Part A):1845–1849. 6. Sabria M et al. A community outbreak of Legionnaires’ disease: evidence of a cooling tower as the source. Clinical Microbiol- ogy and Infection, 2006, 12:642–647. 7. Standard methods for the examination of water and wastewater, 20th ed. Washington DC, American Public Health Associa- tion/American Water Works Association/ Water Environment Federation, 1995. 8. Water quality—detection and enumeration of Legionella. ISO 11731:1998. Geneva, International Organization for Standardi- zation, 1998. 9. Stokes EJ. Ridgway GI, eds. Clinical bacteriology, 5th ed. Lon- don, Arnold, 1980:215. 10. Companhia de Saneamento Básico do Estado de São Paulo S.A (Sabesp) [website] [http://www.sabesp.com.br/, accessed 14 July 2013) [in Portugese]. 11. Riffard S et al. Occurrence of Legionella in groundwater: an ecological study. Water Science and Technology, 2001, 43:99–102. 12. Decludt B et al. Clusters of travel associated Legionnaires’ disease in France, September 2001–August 2003. Euro Surveil- lance, 2004, 9:11–13. 13. Wullings BA, van der Kooij D. Occurrence and genetic diver- sity of uncultured Legionella spp. in drinking water treated at temperatures below 15 degrees C. Applied and Environmental Microbiology, 2006, 72:157–166. 14. Bomo AM et al. Bacterial removal and protozoan grazing in biological sand filters. Journal of Environmental Quality, 2004, 33:1041–1047. 15. Hoekstra AC, van der Kool D, Unen WAMH. Bacteriologi- cal, chemical, and physical characteristics of samples from two hot water systems containing Legionella pneumophila compared with drinking water from municipal water works. In: Thornsberry C, et al. eds. Legionella. Proceedings of the 2nd International Symposium. Washington DC, American Society for Microbiology, 1984:343–346. 16. Hsu SC, Martin R, Wentworth BB. Isolation of Legionella spe- cies from drinking water. Applied and Environmental Microbiol- ogy, 1984, 48:830–832. 17. Legionella drinking water health advisory. Washington DC, United States Environmental Protection Agency, Office of Water, 2001. 18. Momba MNB, Makala N. Comparing the effect of various pipe materials on biofilm formation in chlorinated and com- bined chlorine-chlorinated water systems. Water SA, 2004, 30(2):175–182. 19. Lin YS et al. Disinfection of water distribution systems for Le- gionella. Seminars in Respiratory Infections, 1998a, 13:147–159. 20. Prevost M, Laurent P, Servais P. Biodegradable organic matter in drinking water treatment and distribution. Denver, Colorado, American Water Works Association, 2005. 21. Al-Wazzan Y et al. Desalting of subsurface water using spiral- wound reverse osmosis (RO) system: technical and economic assessment. Desalination, 2002, 143:21–28. 22. Kuiper MW et al. Intracellular proliferation of Legionella pneu- mophila in Hartmannella vermiformis in aquatic biofilms grown on plasticized polyvinyl chloride. Applied and Environmental Microbiology, 2004, 70:6826–6833. 23. Gião MS et al. Incorporation of natural uncultivable Legionella pneumophila into potable water biofilms provides a protective niche against chlorination stress. Biofouling, 2009, 25:345–351. 24. Pelaz C, Martín C. Legionella infection in Spain: analysis of human and environmental strains isolated between 1980 and 1999. [Infección por Legionella en España: análisis de las cepas humanas y ambientales aisladas entre 1980 y 1999.] Enferme- dades Emergentes, 2000, 2:214–219 25. Goutziana G et al. Legionella species colonization of water dis- tribution systems, pools and air conditioning systems in cruise ships and ferries. BMC Public Health, 2008, 8:390. 26. Lehtola MJ et al. Survival of Mycobacterium avium, Legionella pneumophila, Escherichia coli, and caliciviruses in drinking wa- ter-associated biofilms grown under high-shear turbulent flow. Applied and Environmental Microbiology, 2007, 73:2854–2859. 27. Čižman M. The use and resistance to antibiotics in the com- munity. International Journal of Antimicrobial Agents, 2003, 21:297–307. 28. Fung-Tomc JC et al. Activity of carbapenem BMS-181139 against Pseudomonas aeruginosa is not dependent on porin protein D2. Antimicrobial Agents and Chemotherapy, 1995, 39:386–393. 29. Baltch AL et al. Antibacterial activities of gemifloxacin, levo- floxacin, gatifloxacin, moxifloxacin and erythromycin against intracellular Legionella pneumophila and Legionella micdadei in human monocytes. Journal of Antimicrobial Chemotherapy, 2005, 56:104–109. 30. Wright GD. Mechanisms of resistance to antibiotics. Current Opinion in Chemical Biology, 2003, 7:563–569. 31. Wybenga-Groot LE et al. Crystal structure of an aminoglyco- side 6′-N-acetyltransferase: defining the GCN5-related N- acetyltransferase superfamily fold. Structure, 1999, 7:497–507. 32. Critchley IA et al. In vitro activity of levofloxacin against con- temporary clinical isolates of Legionella pneumophila, Myco- plasma pneumoniae and Chlamydia pneumoniae from North America and Europe. Clinical Microbiology and Infection, 2002, 8:214–221. water sanitation plants, reverse-osmosis water supplies and samples of tap water from different districts of Basra city, Iraq. The findings confirmed the pres- ence of L. pneumophila in crude water sources and in general drinking water supplies and tankers of drinking water. The prevalence of L. pneumophila, espe- cially serogroup 1, is a strong indicator of unsuitability of drinking water and requires appropriate action. Competing interests: None declared. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 942 Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients A.A. Al-Mahbashi,1 M.M. Mukhtar 2 and E.S. Mahgoub 3 ABSTRACT This study was done to characterize at the species level Mycobacterium spp. isolates from Yemeni pulmonary tuberculosis patients. Early-morning sputum samples were collected from 170 patients referred to the National Tuberculosis Institute in Sana’a city with suspected pulmonary tuberculosis. Samples were processed with Ziehl–Neelsen stain and cultured in Ogawa and Lowenstein–Jensen media. The rpoB gene target sequence was amplified using mutagenesis forward and reverse primers followed by HindIII enzyme digestion. Of the 120 isolates analysed, 118 (98.3%) were identified as M. tuberculosis complex and 2 (1.7%) were identified as mycobacteria other than M. tuberculosis. The results showed that those 2 isolates were multi-drug resistant and the DNA sequencing analysis showed that the alignment of nucleic acid of DNA in isolates of mycobacteria other than M. tuberculosis was different from that of M. tuberculosis complex. 1Department of Microbiology, Faculty of Science, University of Sana’a, Sana’a, Yemen. 2Institute of Endemic Disease; 3Department of Microbiology and Parasitology, Faculty of Medicine, University of Khartoum, Khartoum, Sudan (Correspondence to E.S. Mahgoub: mahgoubsh@gmail.com). Received: 04/06/12; accepted: 25/09/12 نميلا في لسلا ضىرم ىدل تارِّطفتلما عاونأ نم تادَرفتسملل ةيئيزلجا طمانلأا ديدتح بوجمح خيشلا ،راتمخ ةيواعم ،شيبحلما دحمأ سنأ مغلبلا تانيع نوثحابلا عجم دقو ،نميلا في يوئرلا لسلا ضىرم نم ةدَرفتسلما تارِّرطفتلما عاونأ لىع ف ُّرعتلل ةساردلا هذه نوثحابلا ىرجأ :ةـصلالخا ليست نّولمب تانيعلا نيولت مت دقو ،يوئرلا لسلاب مهتباصإب هابتشلال ءاعنص في لسلل ينطولا دهعلما لىإ مهليوتح مت ًاضيرم 170 نم ركابلا حابصلا في تائدابلل ةرفطلا ببست داوم مادختساب rpoB ينلجا في ةفدهتسلما تايلاتتلما ميخضت متو ،نسنج – ينتشنيفلو اواغوأ طَبنتسم في تعرزو نوسلين ف ُّرعتلا مت دق )%98.3( اهنم 118 نأ ينبت نوثحابلا اهللح ةدَرفتسم 120 ينب نمو .مضهلل HindIII ميزنلإا مادختسا كلذ لات مث ،فلخللو ماملأل نوثحابلا اهيلإ لصوت يتلا جئاتنلا حضوتو .ينتيلس يرغ ناترطفتم مانهأ لىع ماهيلع ف ُّرعتلا مت )%1.7( اهنم 2 نأو ،ةيلسلا ةرطفتلما د َّقعم انهأ لىع اهيلع نم تادَرفتسلما في اندلا في يوونلا ضملحا فصارت نأ رهظأ اندلا تايلاتتم ليلتح نأ ماك ،ةيودلأل ةمواقلما تارطفتلما نم اهم ينتدَرفتسلما ينتاه نأ .ةيلسلا تارطفتلما دقعم في هيلع وه ماع فلتيخ ناك ةيلسلا يرغ تارطفتلما Typage moléculaire des isolats de Mycobacterium spp. prélevés chez des patients yéménites atteints de tuberculose RÉSUMÉ La présente étude a été menée afin de caractériser l’espèce des isolats de Mycobacterium spp. prélevés chez des patients yéménites atteints de tuberculose. Des échantillons d’expectoration ont été prélevés tôt le matin chez 170 patients qui avaient été orientés vers l’Institut national de la tuberculose de la ville de Sanaa pour suspicion de tuberculose pulmonaire. Les échantillons ont été traités par coloration de Ziehl-Neelsen et mis en culture sur milieux Löwenstein–Jensen et Ogawa. La séquence cible du gène rpoB a été amplifiée selon la méthode des amorces mutagènes directe et inverse suivie par une digestion par l’enzyme HindIII. Sur les 120 isolats analysés, 118 (98,3 %) ont été identifiés comme appartenant au complexe M. tuberculosis et 2 (1,7 %) comme étant des mycobactéries d’un autre type que M. tuberculosis. Nos résultats ont révélé que ces deux isolats étaient pharmacorésistants tandis que l’analyse des séquences d’ADN a montré que l’alignement d’acide nucléique dans les isolats des mycobactéries d’un autre type que M. tuberculosis était différent de celui du complexe M. tuberculosis. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 943 Introduction Tuberculosis (TB) is a disease of major public health concern world- wide. It is a bacterial infectious disease that is considered the second most important cause of death due to an identifiable infectious agent [1]. Ap- proximately one-third of the world’s population is infected with latent TB and 5%–10% of  this population will  develop active stages of the disease during their life time [2]. TB is a highly transmissible disease and infection can occur via inhalation of droplet particles aerosolized from persons infected with Mycobacterium tuberculosis or by consumption of milk infected with bovine M. bovis. The dis- ease can infect humans and animals, with outcomes ranging from localized lesions to disseminated disease. The genus Mycobacterium comprises more than 70  species,  some of which  are  potentially pathogenic to humans and animals and some of which are sapro- phytic. Mycobacteria that cause TB in mammals form the Mycobacterium tuberculosis complex (MTC) and in- clude M. tuberculosis, M. africanum, M. bovis or M. bovis BCG, M. microtti and M. canetti. Other forms of mycobacte- ria that are considered opportunistic are termed mycobacteria other than Mycobacterium tuberculosis (MOTT) [3]. Yemen is one of the poorest of the world’s low-income countries and TB is one of the most infectious diseases that are endemic in the Yem- eni population. The absolute number of TB cases in Yemen is not known, but 37 000 cases were  recorded as  under treatment throughout the country  in  the  year  2002  [4]. The  main objective of this study was to use molecular techniques to identify and characterize Mycobacterium spp. isolated from pulmonary TB patients in Yemen. Methods Sample collection The study was conducted on patients referred to the National Tuberculosis Institute in Sana’a city with suspected pulmonary TB based on their presen- tation with cough more than 2 weeks.  The Institute is a specialist referral centre for TB diagnosis and therapy and is situated in Sana’a the capital city of Yemen. The Institute receives TB patients from all regions of Yemen and provides free treatment. An early-morning sputum sam- ple was collected  from 170 patients  into wide-mouthed plastic contain- ers. Baseline data of the patients was collected by completion of a questionnaire administered during the collection of samples. Samples were collected between January 2004  and October 2005 and the study was  completed in 2008. The study was approved by the University of Sana’a ethics committee and consent was obtained from the participants before their enrolment in the study. Laboratory methods Antibiotic sensitivity testing, using standard methods, was carried out on cultures from all 170 samples. For cost  reasons, PCR was done on only 120 of  the samples. Staining and culture methods Sputum samples were treated with 4%  NaOH and stained by Ziehl–Neelsen stain  to  detect  acid-fast  bacilli  [5].  The sputum samples were cultured on a special egg-based solid medium (Ogawa medium) according to the procedures of the Japan International Cooperation Agency  [6]. Typically  growth of Mycobacteria spp. appears within 3–4 weeks. The  colonies  are  buff in colour with a dry and friable surface and irregular edges. DNA extraction Two colonies were taken from the culture medium  and  placed  in  100  µL of sterile distilled water; 100 µL of  phenol-chloroform reagent was added and the mixture was vortexed for about 10 s and heated at 80  °C  for 20 min.  The  mixture  was  stored  at  –20 °C  in microcentrifuge tubes (free from DNA or RNA) until needed [7]. Polymerase chain reaction technique Primers specific for the rpoB gene, encoding the B-subunit of RNA polymerase (rpoB  DNA,  342–360  base pairs) was the target region for amplification and identification of My- cobacterium  spp.  [8]. The polymerase  chain reaction (PCR) mixture was prepared as follows: distilled water 5.0  µL,  sample  DNA  4.0  µL,  PCR  buffer  2.5  µL,  PCR MgCl 2   2.0  µL,  PCR dNTP 2.5 µL, primers 3 µL, Tag  polymerase 1.0 µL. The PCR mixture  was gently mixed and amplified using a thermocycler (Perkin Elmer) adjusted to  the cycling programme  for 30 cy- cles. The sequence of rpoB primers for the mutagenesis forward primer was 5′-CGA CCA CTT CGG CAA CCG-3′  and for the mutagenesis reverse primer was 5′-TCG ATC GGG CAC ATC  CGG-3′. Restriction fragment length polymor- phism (RFLP) Following amplification of the rpoB gene the product was subjected to digestion by HindIII restriction en- zymes (Roche) as follows: 15 µL from  PCR product was pipetted into PCR tubes, 2 µL of enzyme was added  to  the  tube, 2 µL of enzyme buffer was  also added  to  the  tube,  then 1 µL of  distilled water was added to the mix- ture and mixed well [9]. DNA sequencing analysis PCR-amplified DNA of the drug- resistant isolates was commercially EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 944 sequenced by Macrogen Company us- ing the BigDye terminator cycling and universal primers. Results The age of  the whole  sample of 170  patients ranged between 12–70 years  old, and the largest proportion was in the age group 20–30 years (Table 1).  There were significantly more males (117, 69%) than  females  (53, 31%)  (P < 0.05). After culture and sensitivity test- ing of  isolates, 15 antibiotic  resistant  isolates were  found: 5 (33.3%) were  resistant  to  1  drug,  4  (26.6%)  to  2  drugs,  4  (26.6%)  to  3  drugs  and  2  (13.3%)  to  4  drugs. The  resistance  data were as follows: isoniazid 14/15  (93%), rifampicin 8/15 (53%), strep- tomycin 5/15 (33%) and ethambutol  6/15 (40%). Our results showed that mycobac- terial DNA was amplified successfully using the relevant primers and the size of DNA was 360 bp compared with  the molecular weight marker  (100  bp) (Figure 1). The PCR-RFLP results showed that 118/120 (98.3%) of  the  isolates  were MTC, whereas 2/120 (1.7%)  were MOTT (Figure 2A and B). The DNA sequencing analysis re- sults showed that the DNA sequence of MTC strains were different from MOTT strains (Figure 3). Discussion A recent health report on Arab countries by the World Health Or- ganization declared that TB was an important public health problem in the 19 Arab countries of the Eastern Mediterranean Region, affecting 240 000 people with 53 000 deaths  every year; 85% of the deaths occurred  in adults  [10].  In Yemen, TB  is con- sidered one of the major infectious diseases recorded in the national disease list [11]. A rapidly increas- ing population, poor quality health services, very low annual income of individuals and the whole country’s poor economic status are the most important factors responsible for the high incidence of TB in the country [12]. In  the present study 170 patients  were recruited who were suspected of having pulmonary TB based on their presentation with cough more than 2  weeks. The age of the patients ranged between  12–70  years  old,  and  the  highest prevalence was among the age group 20–30 years. These results are  in agreement with previous reports from the national disease surveillance infectious diseases centre and the Ministry of Health [11,12]. As previ- ously reported, in this study males were significantly more affected than females  [13].  In Yemen  the higher  rate of TB in males may be attributed to the different habits of males, espe- cially smoking the waterpipe (nargile or mada’a), which is usually shared between different persons. Another prevalence study on pulmonary TB Table 1 Age and sex distribution of the study patients who were sputum-smear positive for tuberculosis Variable No. % Age group (years) 10–< 20 40 24 20–< 30 67 39 30–< 40 27 16 40–< 50 18 11 50–< 60 10 6 > 60 8 5 Sex Male 117 69 Female 53 31 Total 170 100 Figure 1 Polymerase chain reaction assay results using the MF and MR primers for detection and amplification of the Mycobacterium rpoB gene from the isolates with leader marker (100 bp) to detect the size of amplified DNA M = molecular weight control marker (100 bp); P = positive control; N = negative control; lanes 1–13 from patient samples M N P 1 2 3 4 5 6 7 8 9 10 11 12 13 500 bp 400 bp 300 bp 200 bp 100 bp طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 945 M N P 1 2 3 4 5 6 7 8 9 10 11 12 13 attributed the low prevalence of TB among women to underdetection of TB in females because women often choose medical care providers operat- ing outside the national TB control centres [14]. Routine sputum smears and Myco- bacterium spp. cultures confirmed the presence of acid-fast bacilli in the 170  sputum samples examined. However, acid-fast staining does not identify the Mycobacterium to the species level. In addition the time required to detect the organism by routine culture is approximately 4–8 weeks. PCR assay  was therefore used to characterize 120 of the isolates. The rpoB gene was successfully amplified in all isolates and enabled identification of Myco- bacterium spp. following restriction of the PCR product by HindIII restric- tion enzyme  that produced 2 DNA  fragments in the amplicons of M. tuberculosis. The PCR-RFLP results identified 98.3% of  isolates  as MTC and 1.7%  samples as MOTT. Interestingly the MOTT isolates were resistant to iso- niazid, rifampicin and streptomycin. MOTT have been reported to cause infection in humans and to compli- cate treatment regimens since they may not respond to routinely used anti-TB drugs [15–17]. Based on the  results of this study we recommend the use of molecular techniques for identification of the Mycobacterium spp. before initiation of treatment. Acknowledgements Funding: This research was supported by the Ministry of Higher Education of Yemen as part of a PhD degree for the first author. Competing interests: None declared. 1- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCGACAA 2- ACCA-TCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 3- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 4- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 5- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 6- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 7- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 8- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 9- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 10- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 11- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 12- ACCA-GCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAA 13- ACCGCGTCGTGTATGACTCTGTATACACAGAGGAGTCACGGCGCGCGTGGTGGTCTCCAT Figure 2A Polymerase chain reaction–restriction fragment length polymorphism assay using restriction enzymes of confirmed tuberculosis patients; lanes 1,2,3,4,5,6 were Mycobacterium tuberculosis complex isolates that showed 2 fragments. M = control marker 100 bp; N = negative control Figure 2B Polymerase chain reaction–restriction fragment length polymorphism assay using restriction enzymes of confirmed tuberculosis patients; lanes 1,2,3,4,5,6,7,9 were Mycobacterium tuberculosis complex isolates that showed 2 fragments, whereas lane 8 is Mycobacteria other than M. tuberculosis that showed 1 fragment. M = control marker 100 bp; N = negative control; P = positive control M 1 2 3 4 5 6 N M N P 1 2 3 4 5 6 7 8 9 Figure 3 DNA sequence analysis alignment showing the difference between nucleic acid of Mycobacterium tuberculosis complex (samples 1–12) and Mycobacteria other than M. tuberculosis (sample 13) EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 946 References 1. Tiruviluamala P, Reichman LB. Tuberculosis. Annual Review of Public Health, 2002, 23:403–426. 2. Jones-Lopez EC, Ellner JJ. Tuberculosis and atypical mycobac- terial infections. In: Guerrant RL, Walker DH, Weller PF, eds. Tropical infectious diseases: principles pathogens and practice. New York, Elsevier, 2011 (Chapter 36). 3. Annual heath report. National tuberculosis control programme. Sana’a, Yemen, Ministry of Health, 2004. 4. Edsel M, Gregory SC, Robert AS. Mycobacterium other than tuberculosis (MOTT) infection: an emergency disease in inflixi- mab treated patients. Journal of Infection, 2007, 10:1–4. 5. Cheesbrough M. District laboratory practice in tropical coun- tries. Volume 2. Cambridge, Cambridge University Press, 2000:207–213. 6. Kawai M, Fujiki A. Minimum essentials of laboratory procedure for tuberculosis control. Tokyo, Japan Anti-Tuberculosis As- sociation, Research Institute of Tuberculosis in Japan, 1996. 7. Yates MD, Drobniewski FA, Wilson.SM. Evaluation of a rapid PCR-based epidemiological typing method for routine studies of Mycobacterium tuberculosis. Journal of Clinical Microbiology, 2002, 40(2):712–714. 8. Kim BJ et al. Differentiation of mycobacterial species by PCR-restriction analysis of DNA (342 base pairs) of the RNA polymerase gene (rpoB). Journal of Clinical Microbiology, 2001, 39:2102–2109. 9. Kim BJ et al. Identification of mycobacterial species by com- parative sequence analysis of the RNA polymerase gene (rpoB). Journal of Clinical Microbiology, 1999, 37:1714–1720. 10. Tuberculosis. In: Overview of child health in Arab countries, 2nd ed. Alexandria, Egypt, World Health Organization Regional Office for the Eastern Mediterranean, 2002. 11. Tuberculosis infection: disease surveillance of infectious disease. Sana’a, Yemen, Ministry of Health and World Health Organiza- tion Country Office, 2000:49–52. 12. National tuberculosis programme. Tuberculosis in Republic of Yemen. Sana’a, Yemen, Ministry of Health, 1996. 13. Abassi A, Mansourian AR. Efficacy of DOTS strategies in treatment of respiratory tuberculosis in Gorgan, Islamic Re- public of Iran. Eastern Mediterranean Health Journal, 2007, 13(3):664–669. 14. Thorson A et al. Do women with tuberculosis have a lower likelihood of getting diagnosed? Prevalence and case detec- tion of sputum smear positive pulmonary TB, a population- based study from Vietnam. Journal of Clinical Epidemiology, 2004, 57(4):398–402. 15. Kearns AM et al. Epidemiology and molecular typing of an outbreak of tuberculosis in a hostel for homeless men. Journal of Clinical Pathology, 2000, 53(2):122–124. 16. Sharaf-Eldin GS et al. Molecular analysis of clinical isolates of Mycobacterium tuberculosis collected from patients with persistent disease in the Khartoum region of Sudan. Journal of Infection, 2002, 44:244–251. 17. Sanguinetti M et al. Routine use of PCR-reverse cross-blot hybridization assay for rapid identification of Mycobacterium species growing in liquid media. Journal of Clinical Microbiol- ogy, 1998, 36:1530–1533. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 947 High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt L. Metwally,1 N. Gomaa,1 M. Attallah 2 and N. Kamel 3 ABSTRACT The emergence and rapid spread of antibiotic-resistant Klebsiella pneumoniae isolates harbouring the blaKPC gene that encodes for carbapenemase production have complicated the management of patient infections. This study in a tertiary care hospital in Egypt used real-time PCR assay to test ertapenem-nonsusceptible isolates of K. pneumoniae for the presence of the blaKPC gene and compared the results with modified Hodge test. Antibiotic sensitivity was performed by standard methods, and interpreted following both the old CLSI breakpoints (M100-S19) for carbapenems and the revised breakpoints (M100-S22). From the 45 non-duplicate isolates of K. pneumoniae recovered from different clinical specimens, a high prevalence of ertapenem-nonsusceptible isolates (44.4%) was reported using the new lower CLSI breakpoints. The blaKPC gene was confirmed in 14/20 (70.0%) of these isolates. The high prevalence of ertapenem nonsusceptibility at a tertiary care hospital in Egypt was predominantly attributed to K. pneumoniae carbapenemase-mediated resistance mechanisms in K. pneumoniae isolates. 1Department of Microbiology; 3Department of Clinical Pathology, Faculty of Medicine, Suez Canal University, Ismailia, Egypt (Correspondence to L. Metwally: lobna.metwally@gmail.com). 2Department of Microbiology, Faculty of Medicine, Ain Shams University, Cairo, Egypt. Received: 28/08/12; accepted: 17/10/12 صرم في ةيوئرلا لايسبلكلا تادرفتسُم في زماينيبابراك ميزنإ طساوتب ةيوئرلا لايسبلكلل ةمواقملل عفترم راشتنا لدعم لماك انه ،للها اطع مركم ،ةعجم دهان ،ليوتم ىنبل جاتنلإ زمري يذلا blakpc ينلجا لىع يوتتح يتلاو ةيويلحا تاداضملل ةمواقلما ةيوئرلا لايسبلكلا تادرفتسلم عيسرلا راشتنلااو غوزبلا نإ :ةـصلالخا في ةيثلاثلا ةياعرلل ىفشتسم في ةساردلا هذه تاثحابلا ترجأ دقو .ىودعلاب ينباصلما ضىرملل يجلاعلا يربدتلا ديقعت لىإ ىدأ دق زماينيبابراك ميزنإ فشكل مينباترلإل بيجتست لا يتلا ةيوئرلا لايسبلكلا تادرفتسم رابتخلا يقيقلحا نمزلا في زايرميلوبلل ليسلسلا لعافتلا ةسياقم مادختساب صرم اهيرسفتب َنْمُقو ،ةيرايعلما قرطلاب ةيويلحا تاداضملل ةباجتسلاا تاثحابلا تسرد دقو .ل َّدعلما جده رابتخا عم جئاتنلا ةنراقلمو blakpc ينلجا دوجو ةح َّقنلما لصفلا طاقن بناج لىإ ،مينيبابراك تابكرلم ةبسنلاب )M100-S19( ةيبرتخلماو ةيريسرلا يرياعلما دهعم ىدل ةدمتعلما ميدقلا لصفلا طاقن عابتاب لدعم نأ تاثحابلل حضتاو ،ةفلتمخ ةيريسر تانيع نم تذخأ ةيوئرلا لايسبلكلل ةجودزم يرغ ةدرفتسم 45 ةساردلا تلمشو .)M100– S22( يرياعلما دهعم ىدل ةدمتعلما ةديدلجاو ةضفخنلما لصفلا طاقن مادختساب هليجست مت دق )%44.4( مينيباترلإل ةبيجتسلما يرغ تادرفتسملل ًاعفترم راشتنا منيباترلإل ةباجتسلاا مدع راشتنا لدعم عافترا ىزعيو ،)%70( ةدرفتسم 20 ينب نم 14 في blakpc ينلجا دوجو تاثحابلل دكأت ماك ،ةيبرتخلماو ةيريسرلا .ةيوئرلا تلايسبلكلا تادرفتسم في زماينيبابراك تمايزنإ اهطساوتت يتلا ةمواقلما تايلآ لىإ بلغلأا لىع صرم في ةيثلاثلا ةياعرلا ىفشتسم في Prévalence élevée de la résistance de Klebsiella pneumoniae médiée par les carbapénèmases dans des isolats de K. pneumoniae en Égypte RÉSUMÉ L’émergence et la propagation rapide des souches de Klebsiella pneumoniae résistantes aux antibiotiques et porteuses du gène blaKPC codant la production de carbapénèmases ont compliqué la prise en charge des infections des patients. La présente étude menée dans un hôpital de soins tertiaires en Égypte a utilisé la méthode de PCR en temps réel pour évaluer la présence du gène blaKPC dans les isolats de K. pneumoniae non sensibles à l’ertapénème, puis a comparé les résultats à l’aide du test de Hodge modifié. La sensibilité aux antibiotiques a été évaluée à l’aide des méthodes standards, puis a été interprétée selon les anciens seuils du Clinical and Laboratory Standards Institute (M100-S19) pour les carbapénèmes et selon les seuils révisés (M100-S22). Après l’analyse des 45 isolats non-dupliqués de K. pneumoniae prélevés à partir de différents échantillons cliniques, une prévalence élevée d’isolats non sensibles à l’ertapénème (44,4 %) a été rapportée selon les nouveaux seuils plus bas du Clinical and Laboratory Standards Institute. La présence du gène blaKPC a été confirmée dans 14 isolats sur 20 (70,0 %). La forte prévalence de la non sensibilité à l’ertapénème dans un hôpital de soins tertiaires en Égypte était principalement imputable aux mécanismes de résistance médiés par les carbapénèmases dans les isolats de K. pneumoniae. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 948 Introduction Klebsiella pneumoniae carbapenemases (KPCs) are Ambler class A plasmid- encoded enzymes that are capable of hydrolyzing all beta-lactam antibiotics, including monobactams, extended- spectrum cephalosporins and carbap- enems  [1,2]. Originally  described  in  2001 [3], pathogens harbouring  these  antibiotic-resistance enzymes have been reported from the United States of America (USA) [4–7], France, China, Sweden, Norway, Colombia, Brazil, Scotland, Germany and Spain [8–11].  Epidemic situations have also been reported  in  Israel and Greece [12,13].  An important challenge to developing a standardized definition of bacterial iso- lates resistant to carbapenems is a recent (mid-2010) change in the Clinical and  Laboratory Standards Institute (CLSI) interpretative criteria (breakpoints) for determining susceptibility to car- bapenems among Enterobacteriaceae [14,15]. These new recommendations  lowered the breakpoints and removed the requirement for testing for carbap- enemases, e.g. by modified Hodge test (MHT), to determine susceptibility. However, based on clinical and micro- biological data, ertapenem breakpoints were modified again  in  January 2012  (M100-S22) by doubling  the dilution  (to ≤ 0.5 µg/mL) [16]. In addition to beta-lactam/car- bapenem resistance, nonsusceptible organisms can carry genes that confer high levels of resistance to many other antimicrobials, often leaving very lim- ited  therapeutic options  [17,18]. The  blaKPC gene encodes for KPC enzyme production. Although carbapenemases have been identified in many species of Enterobacteriaceae, K. pneumoniae remains the most common organism carrying resistance-encoding genes [2]. Carbapenem resistance in K. pneu- moniae may also be due to production of other carbapenemases [19] or to changes in outer membrane porin proteins  [20],  often  combined  with  production of an extended-spectrum beta-lactamase, AmpC or both [19,21]. Molecular detection of the blaKPC gene by polymerase chain reaction (PCR) assay provides laboratories with a means to quickly identify the presence of this important resistance determinant  [22,23].  Considering  the demonstrated potential for rapid horizontal and vertical transmission of the blaKPC gene, prompt recognition is important to controlling the spread of KPCs. In the present study we de- scribe a real-time PCR assay to detect all variants of the blaKPC gene and the use of this assay to test clinical isolates of K. pneumoniae. We also tested ertapenem- nonsusceptible isolates using MHT. Methods Study isolates A prospective study was conducted over a period of 6 months (June 2011  to December 2011) at  the Suez Canal  University hospital, Ismailia, Egypt. A total  of  45,  single-patient K. pneumo- niae isolates were included in the study. These isolates were recovered from urine (n = 13), blood (n = 8), respiratory  tract (n  = 12)  and other  clinical  sites  (n = 12) from patients admitted to the  intensive care unit and different wards of the hospital. Full identification was carried out using  the API 20E system  (bioMérieux). Ethical approval to perform the study was obtained from the ethics committee in the Faculty of Medicine, Suez Canal University and the man- agement board of the hospital. All the included patients consented to the col- lection of specimens before the study was initiated. Susceptibility testing Antibiotic susceptibility testing was determined using the modified Kirby– Bauer method following the CLSI guidelines. The following antimicro- bial agents were included in the panel: ampicillin, amoxicillin/clavulanic acid, ceftriaxone, cefepime, cefazolin, cefoxi- tin, ciprofloxacin, gentamicin, tobramy- cin, imipenem, ertapenem, meropenem, trimethoprim/sulfamethoxazole, piper- acillin, piperacillin/tazobactam and tobramycin (Oxoid). Isolates were further subjected to minimum inhibitory concentration (MIC) testing for imipenem and mero- penem using the Oxoid MIC evaluator strip (Thermo Fisher Scientific) and for ertapenem using the gradient strip E- test (bioMérieux); boxes were allowed to equilibrate at room temperature for at least 1 h before opening. For all isolates the inocula for strip tests were matched  to a 0.5 McFarland standard.  Results were read in accordance with the manufacturers’ directions and in- terpreted following both the old CLSI M100-S19 breakpoints and the revised  breakpoints  in  the M100-S22  docu- ment issued in January 2012 [14–16]. Suspension of a known KPC-pro- ducing isolate [K. pneumoniae American Type Culture Collection (ATCC) BAA-1705], recovered on the MacCo- nkey agar, was used as quality control strain. A second carbapenem-suscepti- ble K. pneumoniae (ATCC 700603) was  used as negative control. Stocks of 20 distinct  single-patient  K. pneumoniae isolates representing different antibiogram patterns and showing MIC ≥ 1 µg/mL (n = 20)  for  ertapenem, using the revised carbapen- em breakpoints  (M100–S22,  January  2010), were tested for carbapenemases  by MHT and stored in tryptic soy broth with 20% glycerol at –20 °C until further  testing by blaKPC real-time PCR. Detection of blaKPC by real- time PCR Fresh, well-isolated test colonies grown on sheep-blood agar plates following overnight incubation were used for DNA extraction using the QIAamp DNA mini kit (Qiagen) according to the manufacturer’s protocol. Briefly, a  2.0 McFarland  standard  bacterial  طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 949 suspension was prepared in saline, and bacterial DNA was extracted from 200  µL  (1.2 ×  108 colony forming units) of the suspension. Extracted bacterial DNA was eluted from the columns in 100  µL  elution  buffer  and  stored  at  –20 °C. The TaqMan real-time KPC PCR assay uses previously published primers and probes which detect all currently described KPC variants  [24]. The  se- quences were as follows: for the KPC forward  primer,  5′-GCG GAA CCA  TTC  GCT  AAA  CTC  GAA-3′;  for  the KPC reverse primer, 5′-AGA AAG  CCC TTG AAT GAG CTG CAC-3′;  and  for  the KPC probe, 5′-/6-FAM/ ATA CCG GCT CAG GCG CAA CTG  TAA  GTT  A/6-TAMRA/-3′  (where 6-FAM represents 6-carboxy- fluorescein and 6-TAMRA represents  6-carboxytetramethylrhodamine). Real-time PCR was performed with  2  µL  template  DNA  in  a  total  reaction volume of 10 µL containing  1× LightCycler FastStart DNA master  hybridization probe reagent (Roche Diagnostics), 3.5 mM MgCl 2 , and 2 µM  of primers for blaKPC and the TaqMan probe. A negative control consisting of the reaction mixture and water (in place of template DNA) was added in each run. In addition to negative controls, a reference K. pneumoniae strain (ATCC BAA-1705) was selected as the positive  control. The  LightCycler  2.0  instrument  (Roche Diagnostics) was used for the amplification and detection of the blaKPC gene using the following PCR cycling conditions; after an initial denaturation step of 3 min at 95  °C,  a 2-step PCR  procedure was used consisting of 30 s at  95 °C and 1 min at 60 °C for 45 cycles. Data were obtained during the an- nealing period. Fluorescence was meas- ured once every cycle immediately after the 60  °C  incubation (extension step).  Fluorescence curves were analysed with the LightCycler  software,  version  4.0.  The results were expressed by deter- mination of the threshold cycle (Ct) value which marked the cycle at which the fluorescence of the sample became significantly different from the base- line signal. A sample was regarded as positive when the LightCycler software determined a Ct in the quantification analysis screen. When analysing the results, it is important to only consider amplifica- tion between 10–35 cycles as positive.  Amplification prior to 10 cycles means  the template should be diluted before repeating. Amplification after 35 cycles  can indicate trace contamination. The no template (water) control should not yield a product (Ct > 40). PCR positive  isolates with reduced ertapenem MIC were considered to be KPC positive. Detection of KPC by the MHT Isolates that were nonsusceptible to er- tapenem (i.e. resistant and intermediate isolates) were also tested by the MHT previously described [25]. Briefly, a 0.5  McFarland suspension of Escherichia coli (ATCC 25922), was used to prepare a  lawn culture on a Mueller–Hinton agar plate (Becton Dickinson), and a 10 µg  ertapenem susceptibility disk (Oxoid) was placed in the centre of the test area. Test isolates were subcultured onto sheep-blood agar plates (Becton Dick- inson) to establish pure cultures. The isolate was then streaked in a straight line from the edge of the disk to the edge of the plate and was incubated overnight at 35 °C in ambient air. After  24 hours of  incubation,  the plate was  examined for a cloverleaf-shaped in- dentation at the intersection of the test organism and the E. coli ATCC 25922  within the zone of inhibition. The pres- ence of a cloverleaf-shaped indentation was considered MHT positive. Results By using current breakpoints (M100- S22)  for  carbapenem  interpretation,  20  out  of  45 K. pneumoniae isolates (44.4%) were  reported as nonsuscep- tible (intermediate and resistant) to ertapenem (Table 1). However, when the old 2009 breakpoints were used,  ertapenem interpretation classified only 15 (33.3%) of  isolates  as nonsuscep- tible  and  30  (66.7%)  as  susceptible.  Of  the 5  isolates  that was  counted as  susceptible by  the 2009 guidelines yet  nonsusceptible by the new guidelines, 3  isolates were positive  for  the blaKPC gene; these isolates were susceptible to meropenem and imipenem. Among the  isolates  tested,  40.0%  and  37.8%  were nonsusceptible to imipenem and meropenem respectively at the new CLSI resistance breakpoint of ≥ 2 µg/ mL for both drugs (Table 1). Table 1 Minimum inhibitory concentration results for carbapenem antibiotics on Klebsiella pneumoniae isolates (n = 45) using different Clinical and Laboratory Standards Institute (CLSI) breakpoints Antibiotic agent Older breakpointsa Current breakpointsb Susceptible Nonsusceptiblec Susceptible Nonsusceptiblec No. % No. % No. % No. % Imipenem 34 75.6 11 24.4 27 60.0 18 40.0 Meropenem 33 73.3 12 26.7 28 62.2 17 37.8 Ertapenem 30 66.7 15 33.3 25 55.6 20 44.4 aCLSI M100-S19 criteria [14,15]; bCLSI M100-S22 criteria [16]; cIntermediate and resistant. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 950 Real-time KPC PCR assay results were used to confirm that carbapenem resistance in K. pneumoniae isolates was due to production of a KPC. Of the 20  K. pneumoniae isolates with reduced susceptibility to ertapenem (defined as ≥ 1 µg/mL),  according  to  the  revised  clinical breakpoints, 14 isolates were found positive for KPCs by MHT and by PCR detection of the blaKPC gene (Table 2). Of  the  remaining 6  isolates  that were negative by PCR, 3  isolates  were positive by MHT. Discussion The emergence and rapid spread of antibiotic-resistant K. pneumoniae iso- lates harbouring the blaKPC gene that encodes for carbapenemase production have complicated the management of patients’ infections [1,2]. To our knowl- edge, this is the first published report of KPC-producing K. pneumoniae isolated from patients at a tertiary care hospital in Egypt. In our study we used ertap- enem to screen for carbapenemases, as ertapenem is the least active carbap- enem against KPCs [26] and as the use  of this drug in automated or manual susceptibility testing has been found to be a highly sensitive method for the detection of KPCs [26,27]. Despite the  limited number of isolates included, we were able to show a high prevalence of ertapenem non-susceptibility, account- ing  for 44.4% of K. pneumoniae isolates tested. This high prevalence reflected the new lower CLSI breakpoints for carbapenems. When the previous CLSI breakpoints for ertapenem were used (resistant > 4 µg/mL;  susceptible ≤ 2  µg/mL), only 33.3% would be counted  as nonsusceptible. A high prevalence of ertapenem resistance was similarly reported by many investigators in dif- ferent  countries  [5,19]. For  instance,  in a study from China none of the 77 clinical  isolates collected  from 2002  to  2009 were  susceptible  to  ertapenem  and only 6.5% and 1.3% of isolates were  susceptible to imipenem and mero- penem respectively [28]. Of the 5 isolates that were counted  as ertapenem-susceptible by the old CLSI M100-S19 breakpoints but non- susceptible by the revised breakpoints, 3 isolates were positive for blaKPC genes and MHT, signifying the improved rate of detection of KPC-meditated resist- ance when using the new CLSI break- points. Likewise, the new breakpoints increased the proportion of isolates counted as nonsusceptible to imipenem and meropenem (to 40.0% and 37.8%  respectively), although these were less than for ertapenem. We also described in this study, a real-time PCR designed to detect and characterize genes encoding all KPC variants. Using this assay, we docu- mented for the first time in Egypt the presence of isolates producing KPCs. Isolates with ertapenem MIC ≥ 1 µg/ mL were further investigated to deter- mine the prevalence of KPC enzymes. We were able to confirm the presence of blaKPC genes  in 14 (70.0%) of ertap- enem-nonsusceptible isolates, which comprised 31.1% of all  isolates  tested,  indicating that the increased prevalence of ertapenem non-susceptibility was predominantly attributed to KPC- mediated resistance mechanisms in K. pneumoniae. Prevalence rates of KPC- positive K. pneumoniae isolates of > 30%  have been recorded in some institutions in the eastern USA, in association with nosocomial outbreaks [27]. Our results suggest performing confirmatory testing for the presence of KPC for all ertapenem-resistant bacteria. All KPC-producing bacteria were also MHT positive, indicating the usefulness of doing this phenotypic test- ing. However, due to the more rapid turnaround time of PCR assays, this assay might be more suitable as an initial screening test for detecting KPC- mediated carbapenem resistance. On the other hand, PCR is more technically challenging, prone to inhibition and may miss new variants of KPC arising from genetic mutation Of the ertapenem-nonsusceptible isolates 6 were negative by  real-time  blaKPC  PCR  and,  of  those,  3  isolates  were positive by MHT. Two possi- bilities  exist  that may explain  these 3  MHT-positive/KPC-PCR-negative isolates. First, as reported by Schechner et al. KPC PCR could be falsely nega- tive due to inhibitory substances in the reaction or to technical inexperience of the laboratory [29]. However, the most  probable reason could be the presence of other carbapenemases, such as the metallo-beta-lactamases and the mem- ber of the Serratia marcescens (SME) family of carbapenem-hydrolyzing beta-lactamases, SME-1, which can produce a positive result for MHT but negative for blaKPC. So although the new CLSI recommendations lowered the breakpoints of carbapenems and removed the requirement for testing for carbapenemase (e.g. MHT) to de- termine susceptibility [15], performing  MHT as an adjunct to KPC PCR may increase the likelihood of detecting other carbapenemases. Furthermore, the current recommendation is to still Table 2 Results of modified Hodge test (MHT) and polymerase chain reaction (PCR) assay for blaKPC gene on nonsusceptible Klebsiella pneumoniae isolates (n = 20) Modified Hodge test results Polymerase chain reaction results Total PCR+ve PCR–ve MHT+ve 14 3 17 MHT–ve 0 3 3 Total 14 6 20 +ve = positive; –ve = negative. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 951 to perform MHT for infection control and epidemiological purposes. Our study had some limitations. First, the number of isolates included in the study was limited by the low in- cidence of K. pneumoniae-associated infections in our institution during the study; nonetheless, the available results provided robust pilot data. Secondly, molecular detection of blaKPC genes was further limited to isolates nonsus- ceptible to ertapenem. However, this did not substantially compromise our study findings, especially when using the new lower CLSI breakpoints for interpretation. Thirdly, we did not screen our isolates for other resistance determinants, such as AmpC or outer membrane proteins, owing to limited funding available. In summary, our data showing an increased prevalence of ertapenem- nonsusceptible K. pneumoniae isolates partly reflects lowering of clinical break- points but also indicates the spread of carbapenemases, principally KPC types, in Suez Canal University hos- pital, Egypt. Confirmatory testing for the presence of KPCs is required for all ertapenem-resistant bacteria. Real-time PCR assay described here provides a useful tool to rapidly and accurately detect blaKPC-positive bacteria, which is an important step in controlling their spread. Acknowledgements Funding: No specific funding was re- ceived for this study. Competing interests: None declared. References 1. Nordmann P, Cuzon G, Naas T. The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infec- tious Diseases, 2009, 9:228–236. 2. Arnold RS et al. Emergence of Klebsiella pneumoniae carbap- enemase-producing bacteria. Southern Medical Journal, 2011, 104:40–45. 3. Yigit Het al. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneu- moniae. Antimicrobial Agents and Chemotherapy, 2001, 45:1151– 1161. 4. Hirsch EB et al. Emergence of KPC-producing Klebsiella pneu- moniae in Texas. Diagnostic Microbiology and Infectious Dis- ease, 2011, 69:234–235. 5. Centers for Disease Control and Prevention (CDC). Carbap- enem-resistant Klebsiella pneumoniae associated with a long- term-care facility—West Virginia, 2009–2011. Morbidity and Mortality Weekly Report, 2011, 60:1418–1420. 6. Bratu S et al. Rapid spread of carbapenem-resistant Klebsiella pneumoniae in New York city: a new threat to our antibiotic armamentarium. Archives of Internal Medicine, 2005, 165:1430– 1435. 7. Brandon Kitchel et al. Molecular epidemiology of KPC-pro- ducing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicro- bial Agents and Chemotherapy, 2009, 53:3365–3370. 8. Steinmann Jet al. Outbreak due to a Klebsiella pneumoniae strain harbouring KPC-2 and VIM-1 in a German university hos- pital, July 2010 to January 2011. Eurosurveillance, 2011, 16:19944. 9. Chung KP et al. Arrival of Klebsiella pneumoniae carbapen- emase (KPC)-2 in Taiwan. Journal of Antimicrobial Chemo- therapy, 2011, 66:1182–1184. 10. Beirao EM et al. Clinical and microbiological characterization of KPC-producing Klebsiella pneumoniae infections in Brazil. Brazilian Journal of Infectious Diseases, 2011, 15:69–73. 11. Gomez-Gil MRet al. Detection of KPC-2-producing Citrobacter freundii isolates in Spain. Journal of Antimicrobial Chemothera- py, 2010, 65:2695–2697. 12. Leavitt A et al. Molecular epidemiology, sequence types, and plasmid analyses of KPC-producing Klebsiella pneumoniae strains in Israel. Antimicrobial Agents and Chemotherapy, 2010, 54:3002–3006. 13. Souli Met al. An outbreak of infection due to beta-lactamase Klebsiella pneumoniae carbapenemase 2-producing K. pneu- moniae in a Greek university hospital: molecular characteriza- tion, epidemiology, and outcomes. Clinical Infectious Diseases, 2010, 50:364–373. 14. Performance standards for antimicrobial susceptibility testing: 19th informational supplement. CLSI document M100-S19. Wayne, Pennsylvania, Clinical and Laboratory Standards In- stitute, 2009. 15. Performance standards for antimicrobial susceptibility testing, 20th informational supplement: M100-S20 & M100-S-20-U. Wayne, Pennsylvania, Clinical and Laboratory Standards In- stitute, 2010. 16. Performance standards for antimicrobial susceptibility testing; 22nd informational supplement. M100-S22. Wayne, Pennsylva- nia, Clinical and Laboratory Standards Institute, 2012. 17. Endimiani A et al. Presence of plasmid-mediated quinolone resistance in Klebsiella pneumoniae isolates possessing blaKPC in the United States. Antimicrobial Agents and Chemotherapy, 2008, 52:2680–2682. 18. Neuner EA et al. Treatment and outcomes in carbapenem- resistant Klebsiella pneumoniae bloodstream infections. Diag- nostic Microbiology and Infectious Disease, 2011, 69:357–362. 19. Pfeifer Y, Cullik A, Witte W. Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. Interna- tional Journal of Medical Microbiology, 2010, 300:371–379. 20. Doumith M et al. Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. Journal of Antimicrobial Chemotherapy, 2009, 63:659–667. 21. Cuzon G et al. In vivo selection of imipenem-resistant Klebsiella pneumoniae producing extended-spectrum beta-lactamase CTX-M-15 and plasmid-encoded DHA-1 cephalosporinase. International Journal of Antimicrobial Agents, 2010, 35:265–268. 22. Raghunathan A, Samuel L, Tibbetts RJ. Evaluation of a real-time PCR assay for the detection of the Klebsiella pneumoniae car- bapenemase genes in microbiological samples in comparison with the modified Hodge test. American Journal of Clinical Pathology, 2011, 135:566–571 23. Hindiyeh M et al. Rapid detection of blaKPC carbapenemase genes by internally controlled real-time PCR assay using Bac- tec blood culture bottles. Journal of Clinical Microbiology, 2011, 49(7):2480–2484. 24. Doern CD, Dunne WM Jr, Burnham CA. Detection of Klebsiella pneumoniae carbapenemase (KPC) production in non-Kleb- EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 952 siella pneumoniae Enterobacteriaceae isolates by use of the Phoenix, Vitek 2, and disk diffusion methods. Journal of Clinical Microbiology, 2011, 49:1143–1147. 25. Carvalhaes CG et al. Cloverleaf test (modified Hodge test) for detecting carbapenemase production in Klebsiella pneumo- niae: be aware of false positive results. Journal of Antimicrobial Chemotherapy, 2010, 65:249–251. 26. Landman D et al. Accuracy of carbapenem nonsusceptibility for identification of KPC-possessing Enterobacteriaceae by use of the revised CLSI breakpoints. Journal of Clinical Microbiol- ogy, 2011, 49:3931–3933. 27. Endimiani A et al. Evaluation of updated interpretative criteria for categorizing Klebsiella pneumoniae with reduced carbap- enem susceptibility. Journal of Clinical Microbiology, 2010, 48:4417–4425. 28. Hu F et al. Emergence of carbapenem-resistant clinical En- terobacteriaceae isolates from a teaching hospital in Shanghai, China. Journal of Medical Microbiology, 2012, 61:132–136. 29. Schechner V et al. Evaluation of PCR-based testing for surveil- lance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. Journal of Clinical Microbiology, 2009, 47:3261–3265. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 953 Prognostic factors of Atractylis gummifera L. poisoning, Morocco S. Achour,1,2 N. Rhalem,2,3 S. Elfakir,4 A. Khattabi,2,3 C. Nejjari,4 A. Mokhtari,2 A. Soulaymani 2 and R. Soulaymani 3,5 ABSTRACT In Morocco, acute Atractylis gummifera L. poisoning represents the leading cause of death by plant poisoning especially for children. All cases received in the Moroccan poison control centre from January 1981 to December 2009 (n = 467) were included in a retrospective study of the characteristics and risk factors of A. gummifera L. poisoning The most vulnerable age group was children (63.4% of cases). Most cases were due to accidental exposure (75.5%), but some were from therapeutic use (18.1%) or attempted abortion (7.4%). Patients presented with moderate poison severity signs (grade 2) in 22.3% of cases or severe signs (grade 3) in 21.0%. The mortality rate was 39.2%. The majority of deaths (81.1%) occurred in children aged < 15 years following accidental exposure. Multivariate logistic regression analysis revealed that risk factors for mortality were coma (OR = 20.5); hepatitis (OR = 52.7) and rural residence (OR = 7.26), while gastric decontamination was a protector factor (OR = 0.26). 1Laboratory of Toxicology, University Hospital and Faculty of Medicine and Pharmacy of Fez, Fez, Morocco (Correspondence to S. Achour: achoursanae@gmail.com). 2Laboratory of Genetics and Biometry, Ibn Tofail University, Faculty of Science and Technology, Kenitra, Morocco. 3Moroccan Poison Control and Pharmacovigilance Centre, Rabat, Morocco. 4Laboratory of Epidemiology and Public Health Faculty of Medicine of Fez, Fez, Morocco. 5Faculty of Medicine and Pharmacy of Rabat, Rabat, Morocco. Received: 02/04/12; accepted: 24/09/12 برغلما في )كلعلا كوش( صيخشلإاب ممستلا في ةّيراذنلإا لماوعلا نيمايلس خيشلا ةديشر ،نيمايلس ديجلما دبع ،يراتمخ ينغلا دبع ،يراجن بيكش ،بياطخ ءماسأ ،يرقفلا ةيرمس ،لماغ هميعن ،روشاع ءانس نوثحابلا ىرجأ دقو .لافطلأا ينب مايسلاو ،تاتابنلاب ممستلل سييئرلا ببسلا برغلما في )كلعلا كوش( صيخشلإا تابنب ممستلا لثمي :ةـصلالخا /لولأا نوناكو 1981 رياني/نياثلا نوناك نم ةترفلا في ممستلا ةحفاكلم بيرغلما زكرلما اوعجار نيذلا ممستلاب ينباصلما عيجم تلمش يتلا ةساردلا هذه ًاضرعت رماعلأا تائف رثكأ نأ نوثحابلا دجوو .صيخشلإاب ممستلل رطلخا لماوعلو صئاصخلل ةيداعتسا ةسارد يهو ،467 مهددعو ،2009 برمسيد تمجن تلاالحا ضعب نأ لاإ ،)%75.5( )دوصقلما يرغ( ضراعلا ض ُّرعتلا اهببس تلاالحا مظعم نأو ،)تلاالحا نم %63.4( لافطلأا مه رطاخملل في )2 ةجردلا( ةدشلا ةلدتعم ممست تاملاعو ضارعأب ضىرلما عجار دقو .)%7.4( ضاهجلإا تلاوامح وأ )%18.1( ةلجاعلما دصقب تامادختسا نع لافطلأا ينب )%81.1( تايفولا تلااح مظعم تناكو ،%39.2 تايفولا لدعم غلبو .تلاالحا نم %21 في )3 ةجردلا( ةديدشو ،تلاالحا نم %22.3 راطتخا لماوع نأ تايرغتلما ددعتلما يتسجوللا فوحتلا ليلتح نم حضتا دقو .)دوصقلما يرغ( ضراعلا ضرعتلا ولت ًاماع 15 نع مهرماعأ لقت نيذلا ينح في ،)7.26 = ةيحجرلأا ةبسن( فايرلأا في نكسلاو ،)52.7 = ةيحجرلأا ةبسن( يدبكلا باهتللااو ،)20.5 ةيحجرلأا ةبسن( ةبوبيغلا يه ةافولا .)0.26 ةيحجرلأا ةبسن( ةيقاولا لماوعلا نم ةدعلما فيظنت ناك Facteurs pronostiques d’intoxication par Atractylis gummifera L. au Maroc RÉSUMÉ Au Maroc, l’intoxication aiguë par Atractylis gummifera L. représente la principale cause de décès dus à une intoxication par les plantes, en particulier chez les enfants. Tous les cas reçus au centre antipoison marocain entre janvier 1981 et décembre 2009 (n = 467) ont été inclus dans une étude rétrospective des caractéristiques et des facteurs de risque d’une intoxication par A. gummifera L. Le groupe d’âge le plus vulnérable était les enfants (63,4 % des cas). La plupart des cas étaient dus à une exposition accidentelle (75,5 %), mais certaines expositions avaient des visées thérapeutiques (18,1 %) ou abortives (7,4 %). Les patients présentaient des signes d’intoxication d’une intensité modérée (grade 2) dans 22,3 % des cas, ou d’une intensité sévère (grade 3) dans 21,0 % des cas. Le taux de mortalité était de 39,2 %. La majorité des décès (81,1 %) se sont produits chez des enfants de moins de 15 ans, à la suite d’une exposition accidentelle. L'analyse de régression logistique multivariée a révélé que les facteurs de risque de mortalité étaient un coma (O.R. = 20,5), une hépatite (O.R. = 52,7) et la résidence en milieu rural (O.R. = 7,26), tandis qu’une décontamination gastrique constituait un facteur protecteur (O.R. = 0,26). EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 954 Introduction Atractylis gummifera L. also called “glue thistle” or “addad” is a poisonous plant widespread in North Africa (Tunisia, Morocco, Algeria), Asia Minor and southern Europe (Spain, Portugal, Italy, Greece), but also in France (Corsica) [1]. This thistle, acciden- tally injested or used in traditional medicines, causes serious poisoning incidents with fatal outcome in many cases, and constitutes a public health problem especially for children in the Mediterranean region [2]. Victims of  intoxication are mainly rural children, who confuse the root with other edible plants, such as the artichoke Scolymus hispanicus L., or use the white substance, which it exudes as chewing gum. Intoxication can also occur dur- ing use of the glue thistle as a medicinal plant because of its antipyretic, diuret- ic, abortifacient, emetic and purgative properties [3]. The toxic effect of this plant arises from 2 diterpenoid  toxicants  causing  toxicity—atractyloside and carboxy- atractyloside—which are a powerful mitochondrial inhibitors of oxidative phosphorylation and interact with a mitochondrial protein involved in mi- tochondrial membrane permeabiliza- tion. This action is exerted especially in cells rich in mitochondria such as hepatocytes and in proximal tubular ep- ithelial cells. The consequences are cell necrosis with extensive liver damage and kidney failure. Poisoned patients manifest characteristic symptoms such as nausea, vomiting, epigastric and abdominal pain, diarrhoea, hepatitis, anxiety, headache and convulsions, often followed by coma. No specific pharmacological treatment for A. gum- mifera intoxication is yet available and all the current therapeutic approaches are only symptomatic. In Morocco, poisoning by this plant is very common and frequently fatal [4,5] and  represents  the  leading cause  of death by plant poisoning in Morocco [6]. The thistle is available in herbal stalls  and markets and is frequently found in nature in the wild, except in desert areas or dry lands and the Anti-Atlas mountains [7]. From 1980 to 2008, the  poison control centre of Morocco has collected 4287 cases of poisoning by  plants, of which death occurred in 7.3%.  The glue thistle was implicated in 77.6%  of these deaths [6]. Published data about A. gummifera L. poisoning are rare and limited to a few clinical cases. A comprehensive study with a determination of risk factors has never been made. The current study aimed to evaluate a series of cases of acute A. gummifera L. poisoning in the Moroccan population to determine the characteristics and the prognostic factors of this type of poisoning in our context. Methods Study population and data collection The present retrospective study was performed in Morocco. All cases related to acute A. gummifera L. poisoning re- ceived in the Moroccan poison control centre from January 1981 to December  2009 were included. The survey collected information on sociodemographic characteris- tics (age, sex, origin), circumstances (accident, therapeutic use, suicide), clinical symptoms, therapeutic as- pects (symptomatic treatment and gastric decontamination) and out- come (mortality rate). The patient's clinical state was classified accord- ing to the Poisoning Severity Score [8]. Treatment at  the centre  is based  on symptomatic treatment such as the correction of hypoglycaemia by infusion of glucose solution, the ad- ministration of oxygen or intubation- ventilation in case of respiratory or neurological distress and correction of metabolic acidosis and hydroelec- trolyte disorders. Statistical analysis Epi 2000,  version 3.3.2 program was  used to perform the analysis. The chi-squared test was used to assess the significance of differences in the distribution of selected sociodemo- graphic characteristics, circumstances, clinical symptoms, therapeutic aspects and frequency of deaths among the participants. A logistic regression was performed with death versus living as the depend- ent variable. We compared the groups of survivors and deceased to determine some prognostic factors. The explana- tory factors were coma, hepatitis, gastric decontamination, and residence area. Odds ratios (OR) with 95% confidence  interval (CI) and degree of significance (P-value) was determined for each vari- able. A P-value of < 0.05 was considered  significant. Results In our study 467 cases of A. gummifera L. poisoning were included, representing 10.6% of  all  cases of  plant  poisoning  collected over the same period. Declara- tions came from health professionals in 94.4% of cases and  from the public  in  5.6%. Profile of poisoning cases Although the number of cases fluctu- ated annually, they decreased slightly after  2006  (Figure  1). The  number  varied between 2 cases  in 1982  to 53  cases in 1996 (11.1%). This type of poi- soning was found in all regions of our country with a clear predominance in the region of Fez-Boulemane (27.4% of  cases), followed by the regions of Taza- Al Hoceima-Taounate  (16.3%)  and  Marrakech-Tensift-Al Haouz (10.2%). The mean  age  of  cases  was  15.3  (SD 12.5) years,  ranging  from 1  to 70  years. The most vulnerable age group was children (63.4% of cases), followed  by adults (22.4%). Children aged 4–10  years and from rural areas were more of طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 955 the cases (51.7%). The sex ratio (male/ female) was 0.76  in  favour of  females  (203 males versus 264 females). The route of intoxication was in- dicated  in 380  cases.  Ingestion was  the most common route of exposure (98.0%), followed by topical adminis- tration in only 2.0% of cases. Acciden- tal exposure was the most common circumstance  (75.5%);  therapeutic  use was noted in 18.1% and the plant  was used for attempted abortion in 7.4%. Adult females were more impli- cated in therapeutic use (48.4%) and  male children in accidental exposure (51.6%). Patients were symptomatic in 67.3%  of cases; the evaluation of clinical sever- ity at admission according to Poisoning Severity Score showed that 22.3% were  in grade 2 with pronounced signs and  21.0% of patients were  in grade 3 with  life-threatening symptoms. Hepato- digestive disorders were the most com- monly  observed  symptoms  (57.0%)  followed by neurological disorders (26.9%) (Table 1). Hepatitis was found  in 106 cases,  associated with  jaundice  and elevation of serum transaminases and bilirubin. Prothrombin time was specified in 61.1% of cases and it was less  than 50%  in 96 cases, while  fulminant  hepatitis was described at admission in 36 cases. Furthermore, hyperglycae- mia followed by hypoglycaemia was reported  in 30.3% of  cases  and  renal  failure in 16.2% of cases. The management delay after in- toxication was  less ≤ 4 hours  in 72.2%  of the cases. Gastric decontamination was performed  in 40.3% of  cases  and  symptomatic treatment was made in 71.1% of cases. The outcome was speci- fied  in 332 cases, of which 130 deaths  were recorded. The mortality rate was 39.2%. The majority of deaths (81.1%)  occurred  in  children  aged < 15  years  following accidental exposure. The dis- tribution of cases and deaths according to year is shown in Figure 1. The num- ber of deaths varied in each year with a pronounced decrease after 2002. Risk factors associated with death In order to identify clinical risk factors associated with death, we compared the 2 groups (survivors and deaths)  using univariate analysis. The parame- ters statistically associated with death and elucidated by P-value < 0.05 are  reported  in Table 2. Death was  sig- nificantly more common in children aged < 15 years (P < 0.001), among  females (P = 0.05), rural residents (P < 0.001)  and  in  cases of  accidental  poisoning (P  <  0.001). Death was  significantly associated with pres- ence of tachycardia, dizziness, mio- sis, haemorrhage/bleeding, history of hepatitis or coma. Patients with abdominal pain and having gastric decontamination were significantly less likely to die. Table  3  gives  the  adjusted OR  from multivariate logistic regression models to tease out the adjusted asso- ciation between different characteris- tics and survival status. The analysis revealed that a history of coma was Figure 1 Distribution of cases of poisoning (n = 467) and deaths (n = 130) due to Atractylis gummifera L. by year (1981–2009) 0 10 20 30 40 50 60 19 81 19 82 19 83 19 85 19 86 19 87 19 88 19 89 19 90 19 91 19 92 19 93 19 94 19 95 19 96 19 97 19 98 19 99 20 00 20 01 20 02 20 03 20 04 20 05 20 06 20 07 20 08 20 09 Poisoning Death Year N o . EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 956 significantly associated with higher risk of death compared with the subjects without a history of coma (OR = 20.5, 95% CI: 5.0–84.0), inde- pendent of the potential confounders. Subjects with a history of hepatitis had a greater likelihood of death than those without (OR = 52.7, 95% CI:  15.0–185). Living in a rural area (OR  = 7.26, 95% CI: 2.68–19.6) was also  a risk factor for death. Gastric decon- tamination was the only protector factor of death (OR = 0.26, 95% CI:  0.07–0.96). Discussion Despite the plant’s well-known toxicity, ingestion of A. gummifera L continues to be a common cause of poisoning in Morocco. In our study 467 cases were compiled, mainly in the  Fez-Boulemane and the Taza-Al Ho- ceima-Taounate regions. This number is likely to be an underestimate be- cause a large number of patients who died were not declared to the poison centre. Poisoning by this plant is com- mon in the Mediterranean region and frequently fatal. It has been described since the mid-19th century [9]. About 200  cases have been  reported  since  then [4,10], mainly by accidental sub- stitutions or due to children chewing the sweet gum obtained from the latex of its subterranean parts. Although most poisoning cases occur in North Africa  [10]  they  have  also  been  re- ported among European countries: Greece  [11]; Spain  [12];  Italy  [13].  If used internally it is extremely toxic, even at very low doses. A report by Hamouda et al. stated that  from 1983  to 1998  the Tuni- sian poisoning  centre  collected 56  medical records of patients admitted to the toxicological intensive care unit for poisoning with 11 species of plants [14]. The principal plants involved were A. gummifera (18 cases;  32%),  Datura stramonium L. (14 cases; 25%) and Ricinus communis L. (5 cases; 9%). Of  these 56 cases 16  were lethal and all of them involving A. gummifera. Because A. gummifera L. is easily confused with a wild artichoke Scoly- mus hispanicus L., most poisonings are unintentional  (75.5%  in our  study)  and involved mainly children because this thistle has sweet-tasting juice and children enjoy chewing the chewing- gum-like substance from the roots [15]. Therapeutic circumstances were  reported  in  18.1%  and  attempted  Table 1 Symptoms presented by patients affected by Atractylis gummifera L. poisoning Signs and symptoms No. with signsa % Hepato-digestives disorders Hepatitis 106 12.6 Vomiting 150 17.9 Nausea 88 10.5 Abdominal pain 73 8.8 Intestinal bleeding 38 4.5 Diarrhoea 24 2.9 Total 479 57.0 Neurological disorders Coma 76 9.1 Dizziness 32 3.8 Headache 30 3.6 Mydriasis 26 3.1 Sensorymotor deficit 18 2.1 Drowsiness 16 1.9 Convulsions 14 1.7 Restlessness 14 1.7 Total 226 26.9 Cardio-respiratory disorders Dyspnoea 40 4.8 Collapse: hypotension 34 4.1 Hypertension 10 1.2 Arrhythmia 6 0.7 Bronchospasm 3 0.3 Apnoea 2 0.2 Cyanosis 2 0.2 Total 97 11.5 General signs Anuria 11 1.3 Dry mouth 9 1.1 Sialorrhoea 8 1.0 Asthaenia 7 0.8 Skin rash 3 0.4 Total 38 4.5 All signs 840 100.0 aEach patient may have presented 1 or more clinical signs, and therefore the number of symptoms exceeded the number of patients. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 957 abortion in 7.4% of cases. In fact, in folk  medicine, A. gummifera has been used to treat several conditions including intestinal parasites, ulcers, snake-bite poisoning, hydrops and drowsiness. In traditional Arabic medicine it was used to cauterize abscesses. The plant was also known for its antipyretic, diu- retic, purgative and emetic properties [16].  It  is  also used against parasites  in folk veterinary medicine [17]. In the popular medicine of North Africa it is still used to treat syphilitic ulcers, induce abortion and bleach the teeth [18]. Table 2 Univariate analysis of factors associated with mortality among patients affected by Atractylis gummifera L. poisoning Variables Survived Died P-value No. % No. % Demographic data Age group (years) Child (0–14) 104 53.6 109 87.9 0.001 Teenager (15–19) 27 13.9 6 4.8 Adult (20–74) 63 32.5 9 7.3 Sex Female 123 63.1 65 52.4 0.05 Male 72 36.9 59 47.6 Residence 0.001 Urban 82 72.6 26 35.1 Rural 31 27.4 48 64.9 Circumstances Voluntary 52 27.7 6 5.1 0.001 Accidental 136 72.3 111 94.9 Clinical signs Abdominal pain No 152 76.7 123 94.6 0.001 Yes 46 23.2 7 5.4 Tachycardia No 188 94.9 115 88.5 0.030 Yes 10 5.1 15 11.5 Dizziness No 190 96.0 114 87.7 0.005 Yes 8 4.0 16 12.3 Miosis No 195 98.5 122 94.6 0.045 Yes 3 1.5 7 5.4 Coma No 190 96.0 90 69.2 0.001 Yes 8 4.0 40 30.8 Haemorrhage/ bleeding No 197 99.5 122 93.8 0.002 Yes 1 0.5 8 6.2 Hepatitis No 182 91.9 41 31.5 0.001 Yes 16 8.1 89 68.5 Gastric decontamination No 154 77.8 115 88.5 0.014 Yes 44 22.2 15 11.5 Data missing in some categories. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 958 Several case reports of poisoning have been published in the literature and provide useful information on the symptoms and laboratory findings that help to identify victims of A. gummifera poisoning. The symptoms begin 6–36  hours after the ingestion of the extract of the A. gummifera  rhizome [16]. The  signs and symptoms found in our series corroborate those found in the literature already cited. The laboratory findings (marked increased in serum glutamic oxaloacetic transaminase, se- rum glutamic-pyruvic transaminase and bilirubin) may indicate severe hepato- cellular damage and acute renal failure [19]. In our series, hepatitis was present in 106 patients and was associated with  a high mortality. A. gummifera L. poisoning is respon- sible for a heavy burden of morbidity and mortality and to our knowledge the factors that determined death were never investigated. Our study is the first one to focus on the study of prognos- tics factors. The multivariate analysis revealed that mortality in A. gummifera L. poisoning correlated with coma and hepatitis and the presence of these signs increased the risk of death. This can be explained by the pathologic action of atractyloside and carboxyatractyloside, which involves inhibition of adenosine diphosphate triphosphate conversion through inhibition of P450 cytochrome,  thus leading to damage of tissues. The organs with the greatest oxygen require- ments appear to be especially sensitive to damage; these include the brain and liver. No specific pharmacological treat- ment (antidote) is currently available to treat A. gummifera intoxication and all therapeutic approaches including fluid and electrolyte replacement, cardiovascular and respiratory sup- port, seizure control and conventional therapeutic methods for severe hepatic and renal failure are only symptomatic [20]. Some authors  recommend that  standard therapeutic practice should include induction of vomiting, bowel evacuation, gastric decontamination and administration of activated char- coal [21]. The majority of  these treat- ments were performed in our patients, except activated charcoal, because it is not available in our country. In our study, gastric decontamination was a protector factor against death, and indeed, by reducing the toxic load, this type of treatment improves the prognosis of poisoned patients. Symp- tomatic treatment is still insufficient in patients who have taken quanti- ties theoretically lethal of the poison. In spite of the progress achieved in the fields of toxicology and associated therapy, A. gummifera L. poisoning is still responsible for a high rate of mortality  (39.2%  in our  study). New  therapeutic approaches could come from immunotherapy research: some studies have already tried to produce polyclonal Fab antibody fragments against the toxic components of A. gummifera [22]. Competing interests: None declared. Table 3 Multivariate logistic regression analysis of factors associated with mortality among patients affected by Atractylis gummifera L. poisoning Variables ORa 95% CI P-value Coma 20.5 5.0–84.4 0.001 Hepatitis 52.7 15.0–185 0.001 Gastric decontamination 0.26 0.07–0.96 0.04 Rural origin (rural versus urban 7.26 2.68–19.6 0.001 ORa = adjusted odds ratio; CI = confidence interval. References 1. Skalli S et al. L’intoxication par le chardon à glu (Atractylis gum- mifera L.); à propos d’un cas clinique [Poisoning by Atractylis gummifera L: about one clinical case]. Bulletin de la Société de Pathologie Exotique, 2002, 95:284–286. 2. Madani N et al. Intoxication par le chardon à glu chez une femme enceinte [Poisoning by glue thistle in a pregnant woman]. Presse Medicale (Paris, France), 2006, 35:1828–1830. 3. Ahid S et al. Atractylis gummifera : de l’intoxication aux méthodes analytiques [Atractylis gummifera: from poisoning to the analytic methods]. Annales de Biologie Clinique, 2012, 70:263–268. 4. Hami H et al. Intoxication par Atractylis gummifera L. Don- nées du centre antipoison et de pharmacovigilance du Maroc [Poisoning by Atractylis gummifera l. Morocco poison control center data]. Bulletin de la Société de Pathologie Exotique, 2010, 104:53–57. 5. Vallejo JR et al. Atractylis gummifera and Centaurea ornata in the province of Badajoz (Extremadura, Spain). Ethnopharma- cological importance and toxicological risk. Journal of Ethnop- harmacology, 2009, 126:366–370. 6. Rhalem N et al. Etude rétrospective des intoxications par les plantes au Maroc : Expérience du Centre Anti Poison et de Pharmacovigilance du Maroc (1980–2008) [A retrospective study of poisoning by plants in Morocco: experience of the poison and pharmacovigilance centre of Morocco (1980– 2008]. Toxicologie Maroc., 2010, 5:5–8. 7. Charnot A. La toxicologie au Maroc [Toxicology in Morocco]. Mémoire de la Société des Sciences Naturelles du Maroc, 1945, XLVII:572–598. 8. Person HE et al. Poisoning severity score. Grading of acute poisoning. Clinical Toxicology, 1998, 36:205–213. طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 959 9. Lefranc E. Étude botanique, chimique et toxicologique sur l’Atractylis gummifera [Botanical, chemical and toxicological studies on Atractylis gummifera]. Bulletin de la Société Botanique de France, 1866, 13:146–157. 10. Hamouda C et al. Plant poisonings from herbal medica- tion admitted to a Tunisian toxicological intensive care unit, 1983–1998. Veterinary and Human Toxicology, 2000, 42:137–141. 11. Georgiou M et al. Hepatotoxicity due to Atractylis gummifera L. Clinical Toxicology, 1988, 26:487–493. 12. Salas J et al. Intoxicaciones por Atractylis gummifera L. en Bada- joz (Espana) [Poisoning by Atractylis gummifera L. in Badajoz (Spain)]. Studia Botanica, 1985, 4:201–204. 13. Santi R, Cascio G. Ricerche farmacologiche sul principio attivo dell’Atractylis gummifera [Pharmacological research on the active ingredient of Atractylis gummifera]. Archivio Italiano di Scienze Farmacologiche, 1955, 5:354. 14. Hamouda C et al. A review of acute poisoning from Atrac- tylis gummifera L. Veterinary and Human Toxicology, 2004, 46:144–146. 15. Stickel F et al. Hepatotoxicity of botanicals. Public Health Nutri- tion, 2000, 3:113–124. 16. Capdevielle P, Darraq R. Poisoning by bird-lime thistle. Mede- cine Tropicale, 1980, 40:137–142. 17. Viegi L et al. A review of plants used in folk veterinary medicine in Italy as basis for a databank. Journal of Ethnopharmacology, 2003, 89:221–244. 18. Larrey D, Pageaux GP. Hepatotoxicity of herbal remedies and mushrooms. Seminars in Liver Disease, 1995, 15:183–188. 19. Masria, W. et al. Intoxication par Atractylis gummifera L : à pro- pos de deux cas cliniques [Poisoning by Atractylis gummifera L: about two clinical cases]. Revue Francophone des Laboratories, 2009, 413, 87–91. 20. Stewart MJ, Steenkamp V. The biochemistry and toxicity of atractyloside: a review. Therapeutic Drug Monitoring, 2000, 22:641–649. 21. Ben Salah N et al. Quelques spécialités de chez nous: in- toxications par les plantes, le chloralose et le methanol [Some specialties from us: poisoning by plants, chloralose and metha- nol]. Memoire Online [online journal] (http://www.samu.org/ JAMU2003/jamu2001/chez%nous11.htm, accessed 31 July 2013). 22. Danielea C et al. Atractylis gummifera L. poisoning: an ethnop- harmacological review. Journal of Ethnopharmacology, 2005, 97:175–181. EMHJ  •  Vol. 19  No. 11  •  2013 Eastern Mediterranean Health Journal La Revue de Santé de la Méditerranée orientale 960 Case report Case of acquired lobar emphysema mimicking pneumothorax in a neonate F. Firinci,1 N. Duman,1 O. Ates,2 E. A. Ozer,3 A. Kumral,1 A. Erdemir 3 and H. Ozkan 1 1Department of Paediatrics; 2Department of Paediatric Surgery, Dokuz Eylul University School of Medicine, Izmir, Turkey (Correspondence to F. Firinci: fatih.firinci@deu.edu.tr, fatihfirinci@yahoo.com). 3Department of Paediatrics, Izmir Tepecik Training and Research Hospital, Izmir, Turkey. Received: 16/01/12; accepted: 06/12/12 Introduction Despite the improvements in pre- vention of acute respiratory disease in preterm infants, the incidence of bronchopulmonary dysplasia (BPD) remains largely unchanged. Acquired lobar emphysema (ALE) is an increas- ingly recognized complication of advanced BPD. Barotrauma, oxygen toxicity and lung immaturity are pre- sumed to play an important role in the development of ALE in children with BPD and most cases present overinfla- tion [1,2]. We report on an infant with  BPD who developed ALE mimicking pneumothorax. Case report Following  a  30-week  of  gestation  complicated with premature rupture of  membranes  for  3  days,  a  1275  g  male infant was delivered by caesarean section. The initial chest radiography showed a grade IV respiratory distress syndrome (RDS), requiring a total of 3 surfactant administrations. The initial  situation was complicated by a systemic inflammatory response syndrome. Ven- tilatory support was performed to treat respiratory acidosis and severe RDS. On postnatal day 28, when  the  child  had been on mechanical ventilation, a right pneumothorax developed. A chest tube was  inserted and removed after 3  days. On postnatal day 31, radiographic  evidence of BPD was noted (Figure 1). Although vitamin A supplementation and dexamethasone treatment were administered, the infant did not tolerate extubation. On postnatal day 56, severe  acute hypoxaemia developed. Chest radiography confirmed the diagnosis of right pneumothorax and a chest tube was inserted. However, the infant dete- riorated clinically and repeated radiog- raphy revealed lobar emphysema on the right lower lung. The infant underwent right lower lobectomy and a marked clinical improvement after surgery was evident. The patient was extubated on Figure 1 Chest radiographs of a case of acquired lobar emphysema mimicking pneumothorax in a neonate. (A) Postnatal day 21: bilateral diffuse cystic changes in lung parenchyma, consolidation on the left retrocardiac side. (B) Postnatal day56: emphysema on the right lower lobe of the lung, deviation of the heart and mediastinal structures to the left, diffuse cystic parenchymal changes on the right upper lobe and left lobe of the lung. (C) Postnatal day 59: emphysema on the right lower lobe of the lung, deviation of the heart and mediastinal structures to the left. (D) Postnatal day 63: bilateral diffuse cystic parenchymal changes and no emphysema after right lower lobectomy طسوتلما قشرل ةيحصلا ةلجلماشرع عساتلا دلجلما شرع يدالحا ددعلا 961 postnatal day 67. The  infant was  then  transferred to another hospital due to his family’s request on postnatal day 125. On  discharge,  he was  clinically  stable and receiving only supplemental oxygen. Discussion The pulmonary air leak syndromes, including pneumomediastinum, pneumothorax, pulmonary inter- stitial emphysema and pneumo- pericardium, comprise a spectrum of disease with the same underlying pathophysiology. They are common in preterm neonates with RDS during treatment with mechanical ventila- tion. The  incidence  is  about 10% of  the ventilated preterm infants treated with  surfactants  [3].  <body>This  is  a case report of a preterm newborn developing RDS complicated with BPD and ALE during mechanical ven- tilation. Initially he was managed with chest tube drainage due to diagnosis of pneumothorax. However repeated radiologic examination revealed the diagnosis of ALE. ALE is an usual complication of mechanical ventilatory support in neo- nates with RDS. Although numerous therapeutic approaches to this com- plication have been described, there is no widely accepted management strategy in current practice. Therapeu- tic options include positioning of the neonate on the affected hemithorax, selective ventilation of the unaffected lung with conventional ventilation, selective occlusion of the affected mainstem bronchus, surgical resection of the affected lung portion, applica- tion of high-frequency ventilation to the trachea and administration of dexamethasone [4–9]. In our case, re- section of the large emphysematous bulla was successfully performed with- out any perioperative complications. Considering the surgical approach the postoperative outcome was encourag- ing, although the long-term outcome of the child remains unclear. In the lit- erature concerning infants who failed medical management, lobectomy is clearly beneficial [1]. In conclusion, ALE should be kept in mind as a complication in infants with severe BPD on mechanical venti- lation. Early diagnosis of the ALE is im- portant for conservative management. A misdiagnosis of pneumothorax should be avoided. Obviously, preven- tion is better than treatment. Therefore clinical trials in patients with BPD will provide additional therapeutic options for the treatment and prevention of complications of BPD. References 1. Azizkhan RG et al. Acquired lobar emphysema (overinflation): clinical and pathological evaluation of infants requiring lobec- tomy. Journal of Pediatric Surgery, 1992, 27:1145–1152. 2. Miller KE et al. Acquired lobar emphysema in premature infants with bronchopulmonary dysplasia: an iatrogenic dis- ease? Pediatric Radiology, 1981, 138:589–592. 3. Ozkan H et al. Synchronized ventilation of very-low-birth- weight infants; report of 6 years’ experience. Journal of Mater- nal-Fetal and Neonatal Medicine, 2004, 15:261–265. 4. Leonidas JC, Hall RT, Rhodes PG. Conservative management of unilateral pulmonary interstitial emphysema under tension. Journal of Pediatrics, 1975, 87:776–778. 5. Dickman GI, Short BI, Krauss DR. Selective intubation in the management of unilateral pulmonary interstitial emphysema. American Journal of Diseases of Children, 1977, 131:365. 6. Lewis S et al. Pulmonary interstitial emphysema: selective bronchial occlusion with a Swanganz catheter. Archives of Dis- ease in Childhood, 1988, 63:613–615. 7. Andreou A et al. One-sided high-frequency oscillatory ven- tilation in the management of an acquired neonatal lobar emphysema: a case report and review. Journal of Perinatology, 2001, 21:61–64. 8. Weintraub Z, Oliven A. Succesful resolution of unilateral pulmonary interstitial emphysema in a premature infant by selective bronchial balloon catheterization. Journal of Pediatric Surgery, 1988, 96:475–477. 9. Martin JS et al. Emphyseme lobaire geant acquis chez un premature sous ventilation artificielle. Guerison par la corti- cotherapie [Acquired giant lobar emphysema in an artificially ventilated premature infant. Cured by corticosteroid therapy]. Annales de Pediatrie, 1993, 40:49–50. Subscriptions and Distribution Enquiries regarding subscriptions and distribution of the print edition of EMHJ should be addressed to: Printing and Marketing of Publications at: email: pam@emro.who.int; tel: (+202) 2276 5000; fax: (+202) 2670 2492 or 2670 2494 Permissions Requests for permission to reproduce or translate articles, whether for sale or non-commercial distribution should be addressed to EMHJ at: emhj@emro.who.int Correspondence Editor-in-chief EMHJ WHO Regional Office for the Eastern Mediterranean P.O. Box 7608 Nasr City, Cairo 11371 Egypt Tel: (+202) 2276 5000 Fax: (+202) 2670 2492/(+202) 2670 2494 Email: emhj@emro.who.int ‚G™BÐçOTogBm^TÐoœZTÐod]eBogdgcRüÐoe›cTÐÊm[KÌëÐzc—TÐ phYĆHüÐëÐ}xÎpxڎg+ nh˜hU iŽ> Œx}˜UÐ ënš—Tn= Ò{šCÐph=}_UÐÓÐÚnYüÐ ënš—in`RÌ ëØÚúÐ WY ënf˜U qxŽcUÐ }]S N]—dR ë5 ôL çÐ}_UÐ énYŽ[UÐ ëÐ؎—UÐ .Ž˜h@ëÐ؎—UÐюf@ ŒehUÐ pxڎ—UÐph=}_UÐpxڎge!Ð px؎_—UÐph=}_UÐpcdeCÐ Ñ}`CÐ Members of the WHO Regional Committee for the Eastern Mediterranean Afghanistan . Bahrain . Djibouti . Egypt . Islamic Republic of Iran . Iraq . Jordan . Kuwait . Lebanon Libya . Morocco . Oman . Pakistan . Palestine . Qatar . Saudi Arabia . Somalia . South Sudan Sudan . Syrian Arab Republic . Tunisia . United Arab Emirates . Yemen Membres du Comité régional de l’OMS pour la Méditerranée orientale Afghanistan . Arabie saoudite . Bahreïn . Djibouti . Égypte . Émirats arabes unis . République islamique d’Iran Iraq . Libye . Jordanie . Koweït . Liban . Maroc . Oman . Pakistan . Palestine . Qatar . République arabe syrienne Somalie . Soudan . Soudan du Sud . Tunisie . Yémen Contents Editorial An ancient scourge triggers a modern emergency ................................................................................................. 903 Research articles Arabic version of the Global Mental Health Assessment Tool—Primary Care version (GMHAT/PC): a validity and feasibility study .................................................................................................................................. 905 Predictors of smoking among male college students in Saudi Arabia ...................................................................909 Salt intake in Eastern Saudi Arabia ............................................................................................................................ 915 Investigating inspection practices of pharmaceutical manufacturing facilities in selected Arab countries: views of inspectors and pharmaceutical industry employees ................................................................................919 Pharmacovigilance in Qatar: a survey of pharmacists ............................................................................................ 930 Isolation and identification of Legionella pneumophila from drinking water in Basra governorate, Iraq ................ 936 Molecular typing of Mycobacterium spp. isolates from Yemeni tuberculosis patients ......................................... 942 High prevalence of Klebsiella pneumoniae carbapenemase-mediated resistance in K. pneumoniae isolates from Egypt........................................................................................................................... 947 Prognostic factors of Atractylis gummifera L. poisoning, Morocco .........................................................................953 Case report Case of acquired lobar emphysema mimicking pneumothorax in a neonate .....................................................960