Organisation mondiale de la santé (OMS) · Publications

Laboratory techniques in rabies, volume 2

Organisation mondiale de la santé
Voir le document original

Le texte intégral est hébergé par l’organisation qui le publie. lawenc.com indexe les métadonnées et renvoie vers la source officielle.

Texte intégral

W H O Expert Consultation on R abies Since the launch of the Global framework to eliminate human rabies transmitted by dogs by 2030 in 2015, WHO has worked with the Food and Agriculture Organization of the United Nations, the World Organisation for Animal Health, the Global Alliance for Rabies Control and other stakeholders and partners to prepare a global strategic plan. This includes a country-centric approach to support, empower and catalyse national entities to control and eliminate rabies. In this context, WHO convened its network of collaborating centres on rabies, specialized institutions, members of the WHO Expert Advisory Panel on Rabies, rabies experts and partners to review strategic and technical guidance on rabies to support implementation of country and regional programmes. This report provides updated guidance based on evidence and programmatic experience on the multiple facets of rabies prevention, control and elimination. Key updates include: (i) surveillance strategies, including cross-sectoral linking of systems and suitable diagnostics; (ii) the latest recommendations on human and animal immunization; (iii) palliative care in low- resource settings; (iv) risk assessment to guide management of bite victims; and (v) a proposed process for validation and verification of countries reaching zero human deaths from rabies. The meeting supported the recommendations endorsed by the WHO Strategic Advisory Group of Experts on Immunization in October 2017 to improve access to affordable rabies biologicals, especially for underserved populations, and increase programmatic feasibility in line with the objectives of universal health coverage. The collaborative mechanisms required to prevent rabies are a model for collaboration on One Health at every level and among multiple stakeholders and are a recipe for success. Rabies is a vaccine-preventable disease. The provision of support to countries will end the pain and suffering due to rabies that burdens people, especially children. Investing in rabies control and elimination strengthens health systems, improves equity and access to health care and contributes to sustainable development. Investment in rabies elimination is not only for elimination of this fatal but preventable disease but also for building capacity in the world’s most neglected regions. This report, requested by countries, provides hands-on guidance to drive progress towards rabies elimination. 1012 W H O Technical Report Series W H O T e c h n i c a l R e p o r t S e r i e s 1012 WHO Expert Consultation on Rabies Third report WHO_TRS_Cover_final_2018_124C.indd 1 17/04/2018 20:11 The World Health Organization was established in 1948 as a specialized agency of the United Nations serving as the directing and coordinating authority for international health matters and public health. One of WHO’s constitutional functions is to provide objective and reliable information and advice in the field of human health, a responsibility that it fulfils in part through its extensive programme of publications. The Organization seeks through its publications to support national health strategies and address the most pressing public health concerns of populations around the world. To respond to the needs of Member States at all levels of development, WHO publishes practical manuals, handbooks and training material for specific categories of health workers; internationally applicable guidelines and standards; reviews and analyses of health policies, programmes and research; and state-of-the-art consensus reports that offer technical advice and recommendations for decision-makers. These books are closely tied to the Organization’s priority activities, encompassing disease prevention and control, the development of equitable health systems based on primary health care, and health promotion for individuals and communities. Progress towards better health for all also demands the global dissemination and exchange of information that draws on the knowledge and experience of all WHO’s Member countries and the collaboration of world leaders in public health and the biomedical sciences. To ensure the widest possible availability of authoritative information and guidance on health matters, WHO secures the broad international distribution of its publications and encourages their translation and adaptation. By helping to promote and protect health and prevent and control disease throughout the world, WHO’s books contribute to achieving the Organization’s principal objective – the attainment by all people of the highest possible level of health. The WHO Technical Report Series makes available the findings of various international groups of experts that provide WHO with the latest scientific and technical advice on a broad range of medical and public health subjects. Members of such expert groups serve without remuneration in their personal capacities rather than as representatives of governments or other bodies; their views do not necessarily reflect the decisions or the stated policy of WHO. For further information, please contact WHO Press, World Health Organization; 1211 Geneva 27, Switzerland; www.who.int/bookorders; tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: bookorders@who.int. SELECTED WHO PUBLICATIONS OF RELATED INTEREST WHO Position Paper on Rabies Vaccines Weekly Epidemiological Record, 2010, 85: 309-320 WHO Expert Consultation on Rabies. Second report. Geneva, World Health Organization, 2013 WHO Technical Report Series, No. 982 WHO Expert Consultation on Rabies. First report. Geneva, World Health Organization, 2005 WHO Technical Report Series, No. 931 WHO Expert Committee on Rabies. Eighth report. Geneva, World Health Organization, 1992 WHO Technical Report Series, No. 824 Laboratory Techniques in Rabies. Fourth edition. Geneva, World Health Organization, 1996 Further information on these and other WHO publications can be obtained from WHO Press, World Health Organization ■ 1211 Geneva 27, Switzerland ■ www.who.int/bookorders tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: bookorders@who.int WHO_TRS_Cover_final_2018_124C.indd 2 17/04/2018 20:11 W H O T e c h n i c a l R e p o r t S e r i e s 1 0 1 2 This report contains the collective views of an international group of experts and does not necessarily represent the decisions or the stated policy of the World Health Organization WHO Expert Consultation on Rabies Third report WHO_TRS_inside_final_2018_after_Corr_round5.indd 1 24/04/2018 20:50 ©World Health Organization 2018 Some rights reserved. This work is available under the Creative Commons Attribution- NonCommercial-ShareAlike 3.0 IGO licence (CC BY-NC-SA 3.0 IGO; https://creativecommons.org/ licenses/by-nc-sa/3.0/igo). Under the terms of this licence, you may copy, redistribute and adapt the work for non-commercial purposes, provided the work is appropriately cited, as indicated below. In any use of this work, there should be no suggestion that WHO endorses any specific organization, products or services. The use of the WHO logo is not permitted. If you adapt the work, then you must license your work under the same or equivalent Creative Commons licence. If you create a translation of this work, you should add the following disclaimer along with the suggested citation: “This translation was not created by the World Health Organization (WHO). WHO is not responsible for the content or accuracy of this translation. The original English edition shall be the binding and authentic edition”. Any mediation relating to disputes arising under the licence shall be conducted in accordance with the mediation rules of the World Intellectual Property Organization. Suggested citation. WHO Expert Consultation on Rabies, third report. Geneva: World Health Organization; 2018 (WHO Technical Report Series, No. 1012). Licence: CC BY-NC-SA 3.0 IGO. Cataloguing-in-Publication (CIP) data. CIP data are available at http://apps.who.int/iris. Sales, rights and licensing. To purchase WHO publications, see http://apps.who.int/bookorders. To submit requests for commercial use and queries on rights and licensing, see http://www.who.int/ about/licensing. Third-party materials. If you wish to reuse material from this work that is attributed to a third party, such as tables, figures or images, it is your responsibility to determine whether permission is needed for that reuse and to obtain permission from the copyright holder. The risk of claims resulting from infringement of any third-party-owned component in the work rests solely with the user. General disclaimers. The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of WHO concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted and dashed lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or recommended by WHO in preference to others of a similar nature that are not mentioned. Errors and omissions excepted, the names of proprietary products are distinguished by initial capital letters. All reasonable precautions have been taken by WHO to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either expressed or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall WHO be liable for damages arising from its use. This publication contains the collective views of an international group of experts and does not necessarily represent the decisions or the policies of WHO. Design: WHP (Sophie Guetaneh Aguettant). Printed in Italy. WHO expert consultation on rabies, third report (WHO Technical Report Series, No. 1012) ISBN 978-92-4-121021-8 ISSN 0512-3054 WHO_TRS_inside_final_2018_after_Corr_round5.indd 2 24/04/2018 20:50 iii Contents Abbreviations and acronyms vii 1. Introduction 1 2. The burden of rabies 1 2.1 Methods for estimating the burden of rabies 2 2.2 Estimated global human burden of rabies 3 2.3 Global burden of rabies 6 2.4 References 8 3. Classification of lyssaviruses 10 3.1 Distinguishing features of lyssaviruses 10 3.2 Criteria for differentiating lyssaviruses 10 3.3 Present structure of the Lyssavirus genus 11 3.4 References 15 4. Pathogenesis 17 4.1 References 19 5. Diagnosis 21 5.1 Standard case definitions for rabies 21 5.2 Clinical diagnosis 22 5.3 Biosafety, sampling and specimen transport for laboratory diagnosis 23 5.4 Laboratory techniques for post-mortem diagnosis of rabies in humans and animals 25 5.5 Techniques for ante-mortem diagnosis of rabies in humans 32 5.6 Measuring antibody response to rabies vaccination in humans 34 5.7 Measuring antibody response to rabies vaccination in animals 35 5.8 Virus identification with molecular techniques: epidemiological considerations 35 5.9 References 36 6. Management of patients before and after death 39 6.1 Management of patients with rabies 39 6.2 Palliative management of patients with rabies 41 6.3 Recommendations for health care personnel and family members of patients with rabies 42 6.4 Survivors of rabies and “aggressive” treatment protocols 43 6.5 Management of the bodies of patients who have died of rabies 44 6.6 Transmission via organ transplantation 45 6.7 References 45 WHO_TRS_inside_final_2018_after_Corr_round5.indd 3 24/04/2018 20:50 iv 7. Vaccines and rabies immunoglobulins for humans 47 7.1 Vaccine types 47 7.2 WHO prequalification of human rabies vaccines 49 7.3 Requirements for human rabies vaccines 49 7.4 Routes of vaccine administration 50 7.5 Adverse events after active immunization 51 7.6 Duration of immunity 52 7.7 Failure of rabies vaccine and of full post-exposure prophylaxis 52 7.8 Rabies immunoglobulins 52 7.9 References 54 8. Prevention of human rabies 57 8.1 General considerations 57 8.2 Pre-exposure prophylaxis 58 8.3 Post-exposure prophylaxis 60 8.4 Use of rabies immunoglobulins for passive immunization 68 8.5 Contraindications and precautions to be taken in post-exposure prophylaxis 69 8.6 Supply limitations 70 8.7 Travel to rabies-affected countries and areas and indications for pre-exposure prophylaxis 70 8.8 Education to prevent bites 72 8.9 References 72 9. Prevention and control of rabies in dogs 78 9.1 Case definition of animal rabies 78 9.2 Methods for controlling dog rabies 79 9.3 International movement of animals 89 9.4 Humane dog population management 90 9.5 Vaccination versus sterilization 90 9.6 National programmes for dog rabies control: lessons from the field 91 9.7 References 92 10. Prevention and control of rabies in wild animals 96 10.1 Epidemiology and ecology of rabies in carnivore species 96 10.2 Epidemiology and ecology of rabies in bats 98 10.3 Rabies in rodents 101 10.4 Wildlife species of special concern 101 10.5 Elimination of rabies in wild carnivores 102 10.6 Control of rabies in bats 106 10.7 Other public health measures 107 10.8 References 107 WHO_TRS_inside_final_2018_after_Corr_round5.indd 4 24/04/2018 20:50 v11. Surveillance of rabies 111 11.1 Surveillance systems 112 11.2 Global reporting 117 11.3 References 118 12. Reaching zero human deaths from rabies 120 12.1 Core elements of validation, verification and rabies-freedom 122 12.2 Validation of zero human deaths from rabies 123 12.3 Verification of interruption of rabies transmission 124 12.4 References 124 13. Global and regional activities on rabies 125 13.1 WHO global and regional activities 125 13.2 Examples of activities by partners 129 13.3 References 134 14. Research 137 14.1 Improve programmatic delivery of rabies interventions 137 14.2 Improve the quality and availability of data on rabies 139 14.3 Evidence and new tools to improve the prevention and management of rabies 139 14.4 References 140 15. Concluding remarks 141 16. Acknowledgements 141 Annexes 142 Annex 1 List of participants 142 Annex 2 Record form for cases of possible exposure to rabies 146 Annex 3 Human rabies vaccines and producers worldwide, as of August 2017 148 Annex 4 Four steps for replacing nerve tissue vaccine by modern rabies vaccines produced on cell culture or embryonated eggs 150 Annex 5 Rabies immunoglobulin (RIG) products and producers worldwide, as of August 2017 151 WHO_TRS_inside_final_2018_after_Corr_round5.indd 5 24/04/2018 20:50 vi Annex 6 Technique for intradermal administration of rabies vaccine and precautions to be taken 153 Annex 7 Sites for intramuscular and intradermal administration of human rabies vaccine 155 Annex 8 Recommended post-exposure prophylaxis according to type of exposure 156 Annex 9 Suggested rabies vaccination certificates for humans 157 Annex 10 Currently available oral rabies vaccine products 159 Annex 11 Verbal autopsy questionnaire 160 Annex 12 Animal bite investigation form 171 Annex 13 WHO data collection template 174 Annex 14 Template dossier for validation and verification 175 Annex 15 WHO collaborating centres on rabies, neurovirology, viruses, viral zoonoses and zoonosis control 182 WHO_TRS_inside_final_2018_after_Corr_round5.indd 6 24/04/2018 20:50 vii Abbreviations and acronyms ASEAN Association of South-East Asian Nations CCEEV concentrated, purified cell culture and embryonated egg-based rabies vaccine CSF cerebrospinal fluid DALY disability-adjusted life–year DHIS2 District Health Information Software, version 2 DRIT direct rapid immunohistochemical test ELISA enzyme-linked immunosorbent assay FAT direct fluorescent antibody test FAVN fluorescent antibody virus neutralization GARC Global Alliance for Rabies Control mAb monoclonal antibody OIE World Organisation for Animal Health ORV oral rabies vaccination PAHO Pan American Health Organization PARACON Pan-African Rabies Control Network PEP post-exposure prophylaxis PrEP pre-exposure prophylaxis RABV rabies virus REDIPRA Meeting of the Directors of National Programs for the Prevention and Control of Rabies in the Americas RFFIT rapid fluorescent focus inhibition test RIG rabies immunoglobulin RT-PCR reverse transcriptase polymerase chain reaction USA United States of America WHO_TRS_inside_final_2018_after_Corr_round5.indd 7 24/04/2018 20:50 viii WHO_TRS_inside_final_2018_after_Corr_round5.indd 8 24/04/2018 20:50 1Introduction 1. Introduction The WHO Expert Consultation on Rabies met in Bangkok, Thailand, on 26–28 April 2017. Dr Thiravat Hemachudha (Faculty of Medicine, Chulalongkorn University), Dr Jedsada Chokdamrongsuk (Director-General, Thailand Department of Disease Control) and Dean Suthipong Wacharasindhu (Faculty of Medicine, Chulalongkorn University) welcomed participants, emphasizing the importance of rabies as a preventable disease, which causes tens of thousands of deaths worldwide every year. Dr Chokdamrongsuk outlined Thailand’s commitment to eliminating human deaths from rabies by 2020. Dr Bernadette Abela-Ridder (Neglected Zoonotic Diseases, WHO) described the impact of neglected tropical diseases such as rabies on poor and disadvantaged populations and the benefits of investing to improve health systems. Health and well-being for all people at all ages is the third United Nations Sustainable Development goal, which includes ending the burden of neglected tropical diseases such as rabies by 2030 and achieving universal health coverage by ensuring equal, affordable access to high-quality health services for all. Rabies, a preventable zoonotic disease, is a good indicator of a successful health system and a model for “one health” collaboration. The launch of the Global Rabies Framework in 2015 celebrated the proof of concept that rabies can be eliminated in various settings and the shared goal of reaching zero human deaths from rabies by 2030, worldwide. Dr Thiravat Hemachudha and Dr Christine Fehlner-Gardiner were appointed Chairs, and Dr Susan Moore and Ms Joss Kessels were appointed Rapporteurs of the Consultation. The participants are listed in Annex 1. The information in this report should be considered the most current data on rabies prevention and control, and it supersedes that of the report of the second WHO Expert Consultation on Rabies, published in 2012 (1). 2. The burden of rabies Information on disease burden is widely used to set public health priorities, allocate resources for disease prevention and assess the impact and cost–effectiveness of interventions (2). This section focuses on dog-mediated rabies as the major cause of human rabies. WHO_TRS_inside_final_2018_after_Corr_round5.indd 1 24/04/2018 20:50 2W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 2.1 Methods for estimating the burden of rabies Human deaths from rabies are significantly underreported in many parts of the world. To account for this, a probability decision-tree model has been used to estimate mortality in Bhutan (3), Cambodia (4) and the United Republic of Tanzania (5) and in Africa, Asia (6) and globally (7). Empirical studies for making these estimates include community surveys (8), large-scale verbal autopsy surveys (9), active surveillance and contact tracing (9), with Monte Carlo simulation used to propagate uncertainty (7). Standardized metrics such as the disability-adjusted life–year (DALY) incorporate premature mortality and disability due to disease; as rabies is rapidly fatal, disability accounts for a minimal part of the disease burden. In the few places in which nerve tissue vaccines remain in use, they contribute to vaccine failure and cause severe side-effects that can last for 4–7 months in 0.03–0.08% of cases (6). The most recent comprehensive estimate of the burden of rabies includes productivity losses due to mortality or morbidity (expressed as DALYs), direct costs such as those of rabies vaccines and immunoglobulins, and indirect costs such as transport and loss of income incurred by patients. Livestock losses and the costs of surveillance and preventive measures such as dog vaccination were also included (7). Rabies is a neglected disease. In places where there is no organized control or surveillance, data are weak. Poor surveillance, underreporting, frequent misdiagnosis and the absence of coordination among all the sectors involved are likely to lead to underestimation of the size of the burden. In the absence of specific data, clustering of countries on the basis of epidemiological, socioeconomic and geographical criteria has been used to extrapolate estimates (7); and better surveillance and strengthened regional and global reporting systems would increase the accuracy of estimates and the impact of control programmes (10). Country-specific studies of the burden and better surveillance (see section 11) are encouraged to obtain more reliable global estimates. WHO_TRS_inside_final_2018_after_Corr_round5.indd 2 24/04/2018 20:50 The burden of rabies 3 Figure 1 Global burden of dog-transmitted human rabies A: Human deaths from rabies; B: Death rates per capita (per 100 000 population); countries shaded in grey are free from canine rabies Source: reference 7 2.2 Estimated global human burden of rabies Fig. 1 shows the global burden of dog-transmitted human rabies. WHO_TRS_inside_final_2018_after_Corr_round5.indd 3 24/04/2018 20:50 4W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 2.2.1 Countries that are free of dog rabies A country is defined as free of dog rabies if no indigenously acquired dog-mediated rabies cases have been confirmed in humans, dogs or any other animal species for at least 2 years (see section 12 for a full case definition). Dog- mediated rabies has been eliminated from western Europe, Canada, the United States of America (USA), Japan and some Latin American countries. Australia and many Pacific island nations have always been free from dog-mediated rabies. Such countries may still report imported cases (11), however, and incur costs for maintaining freedom from disease, for surveillance of endemic transmission of RABV in wildlife and/or bats and for pre- (PrEP) and post-exposure prophylaxis (PEP) for people living in or travelling to areas endemic for dog-mediated rabies (12). 2.2.2 Countries in which dog rabies is endemic Latin America and the Caribbean The numbers of cases of human and dog rabies have decreased significantly in this region as a result of sustained control (13). Between 2013 and 2016, dog-mediated human rabies was reported only in Bolivia, Brazil, the Dominican Republic, Guatemala, Haiti, Honduras, Peru and Venezuela (14). In 2016, 10 deaths due to dog-mediated rabies were reported in the Americas – 8 in Haiti and 2 in Guatemala (14), and 23 deaths were reported due to rabies in species other than dogs, with 3 in Brazil, 2 in Colombia, 1 in Guatemala, 2 in Mexico and 15 in Peru. Nerve tissue vaccines continue to be produced for human use in Argentina and Bolivia and for animal use in Bolivia, El Salvador and Honduras (Table 1). Table 1 Countries in which nerve tissue vaccines for humans or animals remain in production Target for use Country Humans Algeria, Argentina, Ethiopia Humans and animals Bolivia Animals only El Salvador, Honduras, Zambia Source: reference 14 WHO_TRS_inside_final_2018_after_Corr_round5.indd 4 24/04/2018 20:50 The burden of rabies 5 Asia An estimated 35 172 human deaths (59.6% of global deaths) and loss of approximately 2.2 million DALYs occur per year in Asia due to dog-mediated rabies (7). India accounts for the most deaths in Asia (59.9% of human rabies deaths) and globally (35% of human rabies deaths). Estimates have been made of the use of nerve tissue vaccines in Bangladesh, Myanmar and Pakistan; however, their use has been discontinued in these countries since 2011, 2013 and 2015, respectively. The cost of PEP is highest in Asia, with estimates up to US$ 1.5 billion per year (18). Despite widespread underreporting and uncertain estimates, rabies is a major burden in Asia, particularly for the rural poor. Africa In Africa, an estimated 21 476 human deaths occur each year due to dog-mediated rabies (36.4% of global human deaths), with a loss of 1.34 million DALYs (7). Human nerve tissue vaccines remain in production in Algeria and Ethiopia (Table 1) (17). In one global cost study, Africa was estimated to spend the least on PEP (3.28% of the global non-human mortality cost) and have the highest cost of human mortality (45%), indicating that many lives could be saved if access to PEP was improved or the prevalence of dog-mediated rabies reduced (15). Central Asia and the Middle East The disease burden due to dog-mediated rabies is estimated to be 1875 human deaths and 14 310 DALYs in Central Asia and 229 human deaths and 1875 DALYs per year in the Middle East (7). 2.2.3 Bat rabies Although bat rabies accounts for a relatively small proportion of human cases worldwide, it now accounts for the majority of human rabies cases in the Americas (13,16). In North America, this is due to a reduced propensity of people to seek PEP after interactions with bats than after bites from terrestrial carnivores; however, more rabid bats than rabid raccoons were recorded in the USA for the first time in 2015, signalling either an increasing prevalence of bat rabies or higher levels of reporting (17). In most other parts of the Americas, haematophagous bats are the primary source of human rabies cases. Vampire bat rabies is also a major cause of livestock mortality, affecting both subsistence and commercial farmers throughout the range of this bat (from Argentina and Uruguay to northern Mexico) (18). In Africa, Asia and Oceania, bat-related WHO_TRS_inside_final_2018_after_Corr_round5.indd 5 24/04/2018 20:50 6W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report human rabies cases remain rare but may be underreported because of limited surveillance and characterization of viruses. Bat lyssaviruses other than rabies virus are described in sections 3 and 10. 2.3 Global burden of rabies The number of human deaths globally due to dog-mediated rabies is estimated to be 59 000 annually, with an associated loss of 3.7 million DALYs (7). The majority of deaths are estimated to have occurred in Asia (59.6%) and Africa (36.4%) (Table 2), and most DALYs were due to premature death (> 99%) and a few to adverse events after administration of nerve tissue vaccines (0.8%). The overall economic cost of dog-mediated rabies was estimated in a probability decision-tree model to be US$  8.6 billion (95% confidence interval, 2.9–21.5 billion) (7). An enhanced verbal autopsy survey within the Million Deaths Study suggested that 12 700 deaths (95% confidence interval, 10 000–15 500) were due to furious rabies (see section 4) in India in 2005. The survey did not include cases of paralytic rabies (19). Major costs associated with dog-mediated rabies vary by region. They include losses in productivity due to premature death (55% of total costs), the cost of PEP (20%) and direct costs to the medical sector and bite victims (20%). Spending on dog vaccination is, however, < 1.5% in most areas endemic for dog- mediated rabies, except in Latin America where 17% of costs are allocated to dog vaccination (7). For individuals, life-saving PEP may be hugely expensive, equivalent to 3.87% of gross national income for a person in Asia (31 days’ wages for the average Asian) and to 5.80% for a person in Africa (51 days’ wages for an average African) (1). These figures may considerably underestimate the true cost for high-risk populations, i.e. the rural poor. Livestock losses also disproportionately affect those who rely on livestock for their subsistence and livelihood. At present, most of the burden is borne by people who can least afford it. Improving the availability of PEP could reduce the number of human deaths but is costly. The incidence of dog-mediated rabies can be reduced by sustained mass dog vaccination, and the cost of PEP will decrease with time if risk is assessed appropriately (see section 12) (20). National dog vaccination programmes and better access to PEP will require consistent, sustained commitment but will have widespread health benefits, particularly for the poorest communities in the world. WHO_TRS_inside_final_2018_after_Corr_round5.indd 6 24/04/2018 20:50 The burden of rabies 7 Ta bl e 2 Es tim at ed n um be rs o f d ea th s f ro m ra bi es (w ith 9 5% co nfi de nc e in te rv al s) in va rio us ar ea s o f t he w or ld Ye ar o f es tim at e Re fe re nc e or s ou rc e M et ho ds A fr ic a Ch in a In di a O th er A si an co un tr ie s A ll A si a A ll A si a an d A fr ic a W or ld 20 03 (8 ) M ul ti- ce nt re st ud y (c om m un ity su rv ey s a nd ho sp ita l r ec or ds ) 20 5 65 (1 6 93 1– 24 19 8) 20 03 (6 ) Pr ob ab ili ty de ci sio n- tre e ap pr oa ch 23 7 00 (6  9 00 – 45  9 00 ) 23 36 (5 65 – 50 49 ) 19 7 13 (4  1 92 – 39  7 33 ) 94 89 (2 28 1– 19  5 03 ) 30 –0 00 (8 10 0– 61  4 00 ) 55  2 70 (2 3  91 0– 93  0 57 ) 20 05 (1 9) Ve rb al au to ps ie s 12 7 00 (1 0  00 0– 15  0 00 ) 20 10 (2 1) N at io na l su rv ei lla nc e d at a 22 13 20 10 PR P Pr ob ab ili ty de ci sio n- tre e ap pr oa ch 23 8 00 (2 1 00 0– 28  0 00 74 50 (2  0 00 – 13  0 00 ) 16 4 50 (6  0 00 – 27  0 00 ) 10 5 50 a (6  0 00 – 14  0 00 ) 34 5 00 (1 4 00 0– 54 0 00 ) 58 3 00 (3 5  00 0– 82 0 00 ) 61 0 00 (3 7 00 0– 86  0 00 ) 20 15 (7 ) Pr ob ab ili ty de ci sio n- tre e ap pr oa ch 21 5 02 6 00 2 (1  0 00 - 11  0 00 ) 20 8 47 (7  0 00 – 55 0 00 ) 8 12 6 a 37 0 45 58 5 47 59 0 00 (2 5  00 0– 15 9  00 0) PR P, Pa rt ne rs fo r R ab ie s P re ve nt io n a E xc lu di ng C en tr al A sia WHO_TRS_inside_final_2018_after_Corr_round5.indd 7 24/04/2018 20:50 8W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 2.4 References 1. Mur1. WHO expert consultation on rabies: second report. Geneva: World Health Organization; 2013 (http://apps.who.int/iris/ bitstream/10665/85346/1/9789240690943_eng.pdf). 2. Murray CJ, editor. Summary measures of population health: concepts, ethics, measurement and applications. Geneva: World Health Organization; 2002. 5. Cleaveland S, Fevre EM, Kaare M, Coleman PG. Estimating human rabies mortality in the United Republic of Tanzania from dog bite injuries. Bull World Health Org. 2002;80:304–10. 3. Tenzin T, Dhand NK, Gyeltshen T, Firestone S, Zangmo C, Dema C et al. Dog bites in humans and estimating human rabies mortality in rabies endemic areas of Bhutan. PLoS Negl Trop Dis. 2011;5(11):e1391. 4. Ly S, Buchy P, Heng NY, Ong S, Chhor N, Bourhy H et al. Rabies situation in Cambodia. PLoS Negl Trop Dis. 2009;3(9):e511. 6. Knobel DL, Cleaveland S, Coleman PG, Fèvre EM, Meltzer MI, Miranda ME et al. Re-evaluating the burden of rabies in Africa and Asia. Bull World Health Org. 2005;83(5):360–8. 7. Hampson K, Coudeville L, Lembo T, Sambo M, Kieffer A, Attlan M et al. Estimating the global burden of endemic canine rabies. PLoS Negl Trop Dis. 2015;9(4):e0003709. 8. Sudarshan MK, Madhusudana SN, Mahendra BJ, Rao NS, Narayana DA, Rahman SA et al. Assessing the burden of human rabies in India: results of a national multi-center epidemiological survey. Int J Infect Dis. 2007;11(1):29–35. 9. Hampson K, Dobson A, Kaare M, Dushoff J, Magoto M, Sindoya E et al. Rabies exposures, post-exposure prophylaxis and deaths in a region of endemic canine rabies. PLoS Negl Trop Dis. 2008;2(11):e339. 10. Taylor LH, Hampson K, Fahrion A, Abela-Ridder B, Nel LH. Difficulties in estimating the human burden of canine rabies. Acta Trop. 2017;165:133– 40. WHO_TRS_inside_final_2018_after_Corr_round5.indd 8 24/04/2018 20:50 The burden of rabies 9 11. Carrara P, Parola P, Brouqui P, Gautret P. Imported human rabies cases worldwide, 1990–2012. PLoS Negl Trop Dis. 2013;7(5):e2209. 12. Cliquet FE, Picard-Meyer E, Robardet E. Rabies in Europe: what are the risks? Didcot: Taylor & Francis; 2014;905–8. 13. Vigilato MA, Clavijo A, Knobl T, Silva HM, Cosivi O, Schneider MC et al. Progress towards eliminating canine rabies: policies and perspectives from Latin America and the Caribbean. Phil Trans R Soc London B Biol Sci. 2013;368(1623):20120143. 14. Human rabies: 2016 updates and call for data. Wkly Epidemiol Rec. 2017;92(7):77–86. 15. Anderson A, Shwiff SA. The cost of canine rabies on four continents. Transbound Emerg Dis. 2015;62(4):446–52. 16. Vigilato MA, Cosivi O, Knöbl T, Clavijo A, Silva HM. Rabies update for Latin America and the Caribbean. Emerg Infect Dis. 2013;19(4):678. 17. Birhane MG, Cleaton JM, Monroe BP, Wadhwa A, Orciari LA, Yager P et al. Rabies surveillance in the United States during 2015. J Am Vet Med Assoc. 2017;250(10):1117–30. 18. Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A. Vampire bat rabies: ecology, epidemiology and control. Viruses. 2014;6(5):1911–28. 19. Suraweera W, Morris SK, Kumar R, Warrell DA, Warrell MJ, Jha P et al. Deaths from symptomatically identifiable furious rabies in India: a nationally representative mortality survey. PLoS Negl Trop Dis. 2012;6(10):e1847. 20. Undurraga EA, Meltzer MI, Tran CH, Atkins CY, Etheart MD, Millien MF et al. Cost–effectiveness evaluation of a novel integrated bite case management program for the control of human rabies, Haiti 2014–2015. Am J Trop Med Hyg. 2017;96(6):1307–17. 21. Yu J, Li H, Tang Q, Rayner S, Han N, Guo Z et al. The spatial and temporal dynamics of rabies in China. PLoS Negl Trop Dis. 2012;6(5):e1640. WHO_TRS_inside_final_2018_after_Corr_round5.indd 9 24/04/2018 20:50 10 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 3. Classification of lyssaviruses 3.1 Distinguishing features of lyssaviruses Rabies is an acute encephalitis caused by lyssavirus infection (1). The etiological agents of rabies encephalitis belong to the Mononegavirales order, the Rhabdoviridae family and the Lyssavirus genus (2). Lyssaviruses have a 12-kb non-segmented RNA genome of negative polarity that encodes five viral proteins (3´ to 5´): a nucleoprotein (N), a phosphoprotein (P), a matrix protein (M), a glycoprotein (G) and an RNA-dependent RNA polymerase (or large protein, L). The lyssavirus particle is shaped like a bullet, 100–300 nm long and 75 nm in diameter. It is composed of two structural and functional units: an internal helical nucleocapsid and an external envelope. The nucleocapsid consists of a ribonucleoprotein complex comprising the genomic RNA and tightly bound N protein and the L and P proteins. The nucleocapsid is active for transcription and replication: the N-RNA template is processed by the L protein, which contains most of the RNA polymerase activities, and its cofactor, the P protein. The lipid envelope is derived from the host cytoplasmic membrane during budding. Knobbed G protein spikes (5–10 nm long and about 3 nm in diameter), consisting of three glycosylated ectodomains that bind the virions to host cell receptors, protrude through the virion membrane. The M protein forms oligomers that bind to the outside of the nucleocapsid, giving rigidity to the virion structure and providing a binding platform for the viral G protein and the envelope membrane (3, 4). 3.2 Criteria for differentiating lyssaviruses Until the 1950s, RABV was considered unique. Identification of serologically related viruses in Nigeria – Lagos bat virus from a pteropodid bat and Mokola virus from a shrew – showed, however, that the structure of this virus group was more complex, and the terms “rabies-related viruses” and “rabies serogroup” were introduced (5). Another serologically related virus, Duvenhage virus, representing a fourth serotype, was isolated from a man who died of rabies after a bite from an insectivorous bat in 1970 in South Africa (6). The viruses regularly isolated from bats in the Americas and Europe since the 1950s were related serologically to Duvenhage virus and were initially included in the Duvenhage serotype (7). Later, use of monoclonal antibodies (mAbs) made it possible to refine the classification of the “rabies serogroup” (8). European bat lyssaviruses were not only distinguished from the African Duvenhage virus but also separated into two distinct serotypes, temporarily called “biotypes” (9). This differentiation was later supported by gene sequencing and phylogenetic WHO_TRS_inside_final_2018_after_Corr_round5.indd 10 24/04/2018 20:50 Classification of lyssaviruses 11 analysis. Extensive phylogenetic studies of the diversity of rabies-related viruses led to creation of the operational term “genotype”, which has subsequently been used widely in the scientific literature (10). New genotypes were identified, and quantitative criteria for their differentiation were proposed (11, 12). To accommodate the growing variety of “rabies-related” viruses, the genus Lyssavirus was established under the auspices of the International Committee on the Taxonomy of Viruses. The name of the genus was derived from Greek mythology: Lyssa (Λυσσα) was a goddess or spirit of rage, fury, raging madness and frenzy. The “genotypes” served as a basis for the taxonomy of lyssavirus but were refined to satisfy the official rules of the International Committee, which apply to more complex entities, such as viral species. Most recently, the nomenclature of the genus was updated to define each species as a distinct lyssavirus (2, 13). The demarcation criteria for lyssavirus species include (13, 15): ■ genetic distance, with a threshold of 80–82% nucleotide identity for the complete N gene, which provides better quantitative resolution than other genes, or 80–81% nucleotide identity for concatenated coding regions of the N+P+M+G+L genes. In general, all isolates belonging to the same species have higher identity values than the threshold, except the viruses currently included in the Lagos bat lys- savirus species. Some authors have therefore suggested that this spe- cies be subdivided into several genotypes (14). In the absence of other sufficient demarcation characteristics, however, Lagos bat lyssavirus has not been separated into several species, as the representatives seg- regate into a monophyletic cluster in most phylogenetic reconstruc- tions; ■ topology and consistency of phylogenetic trees obtained with various evolutionary models; ■ antigenic patterns in reactions with nucleocapsid mAbs (preceded by serological cross-reactivity and definition of lyssavirus serotypes with polyclonal antisera); and, ■ when available, additional characteristics, such as ecological proper- ties, host, geographical range and pathological features. 3.3 Present structure of the Lyssavirus genus Currently, the International Committee on the Taxonomy of Viruses recognizes 14 Lyssavirus species (Table 3). The genus has been subdivided into three phylogroups on the basis of genetic distances and serological cross- reactivity (Fig. 2). WHO_TRS_inside_final_2018_after_Corr_round5.indd 11 24/04/2018 20:50 12 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Table 3 Viruses currently included in the genus Lyssavirus Continent Geographical distribution of isolates Lyssavirus species Mammalian species most frequently infected Phylo- group, vaccine protection? Human fatalities reported? All Terrestrial mammals worldwide except in Australia, Antarctica and several islands; bats in the New World only Rabies lyssavirus All mammals, predominantly dogs I/Y Yes, 59 000 human deaths/ year Africa United Republic of Tanzania Ikoma lyssavirusb Civettictis civetta III/N No Central African Republic, Ghana, Kenya, Nigeria, Senegal, South Africa; travellers returning to France from Egypt or Togo Lagos bat lyssavirus Numerous frugivorous bat species and occasional spillover to domestic dogs and cats II/N No Cameroon, Central African Republic, Ethiopia, Nigeria, South Africa, Zimbabwe Mokola lyssavirus Shrews (Crocidura spp.), domestic cats and rodents II/N Yes, 2 Kenya Shimoni bat lyssavirusb Commerson’s leaf-nosed bat II/N No Kenyac, South Africa Duvenhage lyssavirus Undefined I/Y Yes, 3 Zimbabwe Duvenhage lyssavirus Egyptian slit- faced bat I/Y Yes, 3 WHO_TRS_inside_final_2018_after_Corr_round5.indd 12 24/04/2018 20:50 Classification of lyssaviruses 13 Europe France, Germany, Spain European bat 1 lyssavirus Serotine bat I/Y Yes, 2 Finland, France, Germany, Luxembourg, Netherlands, Switzerland, United Kindom European bat 2 lyssavirus Daubenton’s bat I/Y Yes, 2 France, Germany, Poland Bokeloh bat lyssavirus Natterer’s bat I/Y No Spain Lleida bat lyssavirusb Common bent-winged bat III/N No Finland Kotolahti bat lyssaviruse Brandt’s bat I No Eurasia Kyrgystan Aravan lyssavirusb Lesser mouse- eared bat I/Y No Chinad, Russian Federation Irkut lyssavirus Greater tube- nosed bat I/Y Yes, 1 Tajikistan Khujand lyssavirusb Whiskered bat I/Y No Kenya, Russian Federatione West Caucasian bat lyssavirusb Common bent-winged bat III/N No Australasia Australia Australian bat lyssavirus Black flying fox and related spp. I/Y Yes, 3 Yellow-bellied sheath-tailed bat Asia Sri Lanka Gannoruwa bat lyssavirus Indian flying fox I/Y No Taiwan Taiwan bat lyssaviruse Japanese house bat I/Y No a More than 50 bat species have been implicated in RABV infection in the Americas; only. b Only a single isolate described. c Case reported from The Netherlands, but exposure occurred in Kenya. d Not yet classified as lyssaviruses by the International Committee for Taxonomy of Viruses e Serological evidence of infection in Kenya WHO_TRS_inside_final_2018_after_Corr_round5.indd 13 24/04/2018 20:50 14 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Phylogroup I contains the rabies lyssavirus (RABV), European bat- 1 lyssavirus, European bat-2 lyssavirus, Bokeloh bat lyssavirus, Duvenhage lyssavirus, Australian bat lyssavirus, Aravan lyssavirus, Khujand lyssavirus and Irkut lyssavirus. Phylogroup II contains Lagos bat virus, Mokola virus and Shimoni bat virus, and phylogroup III includes West Caucasian bat lyssavirus and Ikoma lyssavirus. A further two viruses that are likely to be classified within the lyssavirus genus have also been described. Gannoruwa bat lyssavirus was isolated from Pteropus medius bats in Sri Lanka and is closely related to RABV and Australian Figure 2 Diversity of bat associated lyssaviruses Roman numerals refer to antigenic phylogroups. Pictograms represent spillover events where reported. * Denotes single isolation only; ^ represents no isolate available; ? No reported association with bat species; and $ Not yet classified by ICTV within the lyssavirus genus. © Crown Copyright, 2018. Used with the permission of Professor A. Fooks and Dr A. Banyard, Animal and Plant Health Agency, United Kingdom WHO_TRS_inside_final_2018_after_Corr_round5.indd 14 24/04/2018 20:50 Classification of lyssaviruses 15 bat lyssavirus (15). Further, the full genome of another novel lyssavirus, Lleida bat lyssavirus, has been characterized from a common bent-winged bat in Spain (16). While Gannoruwa bat lyssavirus will probably be classified into phylogroup I, Lleida bat lyssavirus is highly divergent and clusters with the phylogroup III viruses Ikoma lyssavirus and West Caucasian bat virus. Two cases of another novel lyssavirus, Taiwan bat lyssavirus, have been reported in Japanese house bats (Pipistrellus abramus) on Taiwan; more genetic data for this virus are required before it can be proposed as a separate lyssavirus species (17), and, as with Kotolahti bat lyssavirus isolated in Finland, it should be further characterized before formal classification. The continuing identification of lyssaviruses in bats has led to the hypothesis that all lyssaviruses originated in bats. While bats have been identified as the reservoir hosts for 15 of the 17 recognized and proposed species of lyssaviruses, neither Mokola nor Ikoma lyssavirus has been detected in bat species, and their reservoir host remains to be determined (17). Lyssaviruses show broad antigenic cross-reactivity at the nucleocapsid level, mainly because of sequence conservation of the N protein. Therefore, similar reagents can be used for diagnosis by immunofluorescence. The ectodomain of the G protein (which carries the main antigenic sites) is more variable, and there is cross-neutralization among lyssaviruses of the same phylogroup (amino acid identity in the ectodomain, > 74%) but not between phylogroups (amino acid identity in the ectodomain, < 62%). Experimental evidence indicates that the available vaccine strains, all of which belong to RABV species in phylogroup I, are ineffective against infection with lyssaviruses in phylogroups II and III. 3.4 References 1. Fooks AR, Banyard AC, Horton DL, Johnson N, McElhinney LM, Jackson AC. Current status of rabies and prospects for elimination. Lancet. 2014;384(9951):1389–99. 2. Amarasinghe GK, Bào Y, Basler CF, Bavari S, Beer M, Bejerman N et al. Taxonomy of the order Mononegavirales: update 2017. Arch Virol. 2017;162(8):2493–504. 3. Graham SC, Assenberg R, Delmas O, Verma A, Gholami A, Talbi C et al. Rhabdovirus matrix protein structures reveal a novel mode of self- association. PLoS Pathog. 2008;4(12):e1000251. 4. Ge P, Tsao J, Schein S, Green TJ, Luo M, Zhou ZH. Cryo-EM model of the bullet-shaped vesicular stomatitis virus. Science. 2010;327(5966):689– 93. WHO_TRS_inside_final_2018_after_Corr_round5.indd 15 24/04/2018 20:50 16 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 5. Boulger LR, Porterfield JS. Isolation of a virus from Nigerian fruit bats. Trans R Soc Trop Med Hyg. 1958;52(5):421–4. 6. Shope RE, Murphy FA, Harrison AK, Causey OR, Kemp GE, Simpson DI et al. Two African viruses serologically and morphologically related to rabies virus. J Virol. 1970;6(5):690–2. 7. Shope RE. Rabies-related viruses. Yale J Biol Med. 1982;55(3-4):271–5. 8. Meredith CD, Prossouw AP, Koch HP. An unusual case of human rabies thought to be of chiropteran origin. S Afr Med J. 1971;45(28):767–9. 9. Schneider LG. Antigenic variants of rabies virus. Comp Immunol Microbiol Infect Dis. 1982;5(1–3):101–7. 10. Schneider LG, Barnard BJ, Schneider HP, Ødegaard ØA, Müller J, Selimov M et al. Application of monoclonal antibodies for epidemiological investigations and oral vaccination studies. In: Kuwert EK, Merieux C, Koprowski H, Bogel K, editors. Rabies  in the tropics. Proceedings of a WHO consultation. Berlin: Springer; 1985;47–59. 11. Wiktor TJ, Koprowski H. Monoclonal antibodies against rabies virus produced by somatic cell hybridization: detection of antigenic variants. Proc Natl Acad Sci. 1978;75(8):3938–42. 12. Dietzschold B, Rupprecht CE, Tollis M, Lafon M, Mattei J, Wiktor TJ et al. Antigenic diversity of the glycoprotein and nucleocapsid proteins of rabies and rabies-related viruses: implications for epidemiology and control of rabies. Rev Infect Dis. 1988;10(Suppl.4):S785–98. 13. Bourhy HE, Kissi B, Lafon M, Sacramento D, Tordo N. Antigenic and molecular characterization of bat rabies virus in Europe. J Clin Microbiol. 1992;30(9):2419–26. 14. King A, Davies P, Lawrie A. The rabies viruses of bats. Vet Microbiol. 1990;23(1–4):165–74. 15. Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Virology. 1993;194(1):70–81. 16. Davis PL, Holmes EC, Larrous F, Van der Poel WH, Tjørnehøj K, Alonso WJ et al. Phylogeography, population dynamics, and molecular evolution of European bat lyssaviruses. J Virol. 2005;79(16):10487–97. 17. Fraser GC, Hooper PT, Lunt RA, Gould AR, Gleeson LJ, Hyatt AD et al. Encephalitis caused by a lyssavirus in fruit bats in Australia. Emerg Infect Dis. 1996;2(4):327. WHO_TRS_inside_final_2018_after_Corr_round5.indd 16 24/04/2018 20:50 Pathogenesis 17 18. Kuzmin IV, Orciari LA, Arai YT, Smith JS, Hanlon CA, Kameoka Y et al. Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Res. 2003;97(2):65–79. 19. Freuling CM, Beer M, Conraths FJ, Finke S, Hoffmann B, Keller B et al. Novel lyssavirus in Natterer’s bat, Germany. Emerg Infect Dis. 2011;17(8):1519. 20. Evans JS, Horton DL, Easton AJ, Fooks AR, Banyard AC. Rabies virus vaccines: is there a need for a pan-lyssavirus vaccine? Vaccine. 2012;30(52):7447–54. 21. Afonso CL, Amarasinghe GK, Bányai K, Bào Y, Basler CF, Bavari S et al. Taxonomy of the order Mononegavirales: update 2016. Arch Virol. 2016;161(8):2351–60. 22. Markotter W, Kuzmin I, Rupprecht CE, Nel LH. Phylogeny of Lagos bat virus: challenges for lyssavirus taxonomy. Virus Res. 2008;135(1):10–21. 23. Gunawardena PS, Marston DA, Ellis RJ, Wise EL, Karawita AC, Breed AC et al. Lyssavirus in Indian flying foxes, Sri Lanka. Emerg Infect Dis. 2016;22(8):1456. 24. Ceballos NA, Morón SV, Berciano JM, Nicolás O, López CA, Juste J et al. Novel lyssavirus in bat, Spain. Emerg Infect Dis. 2013;19(5):793. 25. Banyard AC, Fooks AR. The impact of novel lyssavirus discovery. Microbiol Aust. 2017;38(1):17–21.13. 4. Pathogenesis Most of the available information on pathogenesis is for RABV, although that of other lyssaviruses is probably similar (see section 3). RABV enters the body through wounds or by direct contact with mucosal surfaces; it cannot cross intact skin. RABV may replicate in muscle or other local tissues after exposure and gains access to motor endplates and motor axons to reach the central nervous system (1–5). Virions are carried in transport vesicles (6) to the central nervous system exclusively by fast retrograde transport along motor axons, with no uptake by sensory or sympathetic endings (1–3, 5). Viruses can also enter motor axons in peripheral nerves directly during a penetrating injury (1, 3, 4). In some bat variants, viral propagation may also occur via sensory nerves due to skin tropism WHO_TRS_inside_final_2018_after_Corr_round5.indd 17 24/04/2018 20:50 18 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report (3, 7, 8). The incubation period varies from 5 days to several years (usually 2–3 months; rarely more than 1 year), depending on the amount of virus in the inoculum, the density of motor endplates at the wound site and the proximity of virus entry to the central nervous system (3–5). Muscle-specific micro-RNA may contribute to this eclipse phase by suppressing viral transcription and replication in the muscle (9, 10). The estimated speed of virus migration depends on whether it moves by centripetal retrograde axonal transport or centrifugal spread. In centripetal retrograde axonal transport, migration is fast, with speeds of 5–100 mm/day or even faster, because neuronal populations of the same synaptic order located at various distances, e.g. 10 µm to 2 cm, are infected simultaneously (1, 5). Conversely, centrifugal spread is slow, as it is probably mediated by passive diffusion rather than active transport (1–3, 5). The first rapid centripetal phase leads to wide transneuronal transfer within the central nervous system and to infection of dorsal root ganglia via their central connections with the initially infected motor neurons and spinal interneurons (1–3, 5). The virus then moves centrifugally from the central nervous system via slow anterograde axoplasmic flow in motor axons to the ventral roots and nerves and peripheral sensory axons of the infected dorsal root ganglia, leading to infection of muscle spindles, skin, hair follicles and other non-nervous tissues, such as salivary glands, heart muscle, lung and abdominal visceral organs via their sensory innervation (3–5). By the time of clinical onset of rabies, the virus is widely disseminated throughout the central nervous system and probably to extra-neural organs (11). The first specific clinical symptom is neuropathic pain at the site of the bite. This is caused by virus replication in dorsal root ganglia and inflammation induced by cellular immunity (12). Human rabies can manifest as a spectrum of disease, from furious to paralytic manifestations, which cannot be correlated with a specific anatomical localization of RABV in the central nervous system (12–14). The major clinical signs are probably due to site-specific responses (14); functional neuronal impairment also explains coma. Electrophysiological studies with pathological correlates show that peripheral nerve axonopathy or myelinopathy is responsible for weakness in paralytic rabies (7, 12). Preferential entry via the motor route explains why subclinical anterior horn cell dysfunction precedes sensory loss in furious rabies and is initially localized at body segments corresponding to the site of the bite, progressively spreading to other locations (3, 5, 12). The same considerations apply to prodromal symptoms and signs in paralysed patients (3–5). Diffusion tensor imaging in cases of dog-mediated paralytic rabies show that neural tract integrity is compromised at the brain- stem level, limiting viral propagation to the forebrain (5, 15, 16). A viral immune evasive strategy with blood–brain barrier integrity prevents eradication of the virus in the central nervous system (4, 16–21). There is no evidence of immune suppression or accelerated neuronal death in rabies-infected patients (15, 16). WHO_TRS_inside_final_2018_after_Corr_round5.indd 18 24/04/2018 20:50 Pathogenesis 19 Rabies with atypical clinical and/or neuroimaging features is seen increasingly (4, 22–26). Whether this is due to atypical virus variants, a host immune response or large doses of virus inoculum (as in the case of organ transplantation from rabies-infected donors) is unknown. Without intensive care, death occurs within 7–10 days of the appearance of clinical symptoms (5, 7). 4.1 References 1. Ugolini G. Use of rabies virus as a transneuronal tracer of neuronal connections: implications for the understanding of rabies pathogenesis. Dev Biol (Basel). 2008;131:493–506. 2. Ugolini G. Advances in viral transneuronal tracing. J Neurosci Methods. 2010;194(1):2-0. 3. Ugolini G. Rabies virus as a transneuronal tracer of neuronal connections. Adv Virus Res. 2011:79:165–202. 4. Hemachudha T, Laothamatas J, Rupprecht CE. Human rabies: a disease of complex neuropathogenetic mechanisms and diagnostic challenges. Lancet Neurol. 2002:1(2):101–9. 5. Hemachudha T, Ugolini G, Wacharapluesadee S, Sungkarat W, Shuangshoti S, Laothamatas J. Human rabies: neuropathogenesis, diagnosis, and management. Lancet Neurol. 2013;12(5):498–513. 6. Klingen Y, Conzelmann KK, Finke S. Double-labeled rabies virus: live tracking of enveloped virus transport. J Virol. 2008;82(1):237–45. 7. Hemachudha T, Wacharapluesadee S, Mitrabhakdi E, Wilde H, Morimoto K, Lewis AR. Pathophysiology of human paralytic rabies. J Neurovirol. 2005;11(1):93–100. 8. Morimoto K, Patel M, Corisdeo S, Hooper DC, Fu ZF, Rupprecht CE et al. Characterization of a unique variant of bat rabies virus responsible for newly emerging human cases in North America. Proc Natl Acad Sci U S A. 1996;93(11):5653–8. 9. Israsena N, Supavonwong P, Ratanasetyuth N, Khawplod P, Hemachudha T. Inhibition of rabies virus replication by multiple artificial microRNAs. Antiviral Res. 2009;84(1):76–83. 10. Israsena N, Mahavihakanont A, Hemachudha T. Rabies virus infection and microRNAs. In: Adv Virus Res. 2011;79:329–44. WHO_TRS_inside_final_2018_after_Corr_round5.indd 19 24/04/2018 20:50 20 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 11. Hemachudha T, Wacharapluesadee S, Laothamatas J, Wilde H. Rabies. Curr Neurol Neurosci Rep. 2006;6:460. 12. Mitrabhakdi E, Shuangshoti S, Wannakrairot P, Lewis RA, Susuki K, Laothamatas J et al. Difference in neuropathogenetic mechanisms in human furious and paralytic rabies. J Neurol Sci. 2005;238(1):3–10. 13. Dumrongphol H, Srikiatkhachorn A, Hemachudha T, Kotchabhakdi N, Govitrapong P. Alteration of muscarinic acetylcholine receptors in rabies viral-infected dog brains. J Neurol Sci. 1996;137(1):1–6. 14. Thanomsridetchai N, Singhto N, Tepsumethanon V, Shuangshoti S, Wacharapluesadee S, Sinchaikul S et al. Comprehensive proteome analysis of hippocampus, brainstem, and spinal cord from paralytic and furious dogs naturally infected with rabies. J Proteome Res. 2011;10(11):4911–24. 15. Laothamatas J, Wacharapluesadee S, Lumlertdacha B, Ampawong S, Tepsumethanon V, Shuangshoti S et al. Furious and paralytic rabies of canine origin: neuroimaging with virological and cytokine studies. J Neurovirol. 2008;14(2):119–29. 16. Laothamatas J, Sungkarat W, Hemachudha T. Neuroimaging in rabies. Adv Virus Res. 2011;79:309–27. 17. Lafon M. Evasive strategies in rabies virus infection. Adv Virus Res. 2011;79:33–53. 18. Laothamatas J, Hemachudha T, Mitrabhakdi E, Wannakrairot P, Tulayadaechanont S. MR imaging in human rabies. Am J Neuroradiol. 2003;24(6):1102–9. 19. Roy A, Phares TW, Koprowski H, Hooper DC. Failure to open the blood–brain barrier and deliver immune effectors to central nervous system tissues leads to the lethal outcome of silver-haired bat rabies virus infection. J Virol. 2007;81(3):1110–8. 20. Roy A, Hooper DC. Immune evasion by rabies viruses through the maintenance of blood–brain barrier integrity. J Neurovirol. 2008;14(5):401–11. 21. Kasempimolporn S, Hemachudha T, Khawplod P, Manatsathit S. Human immune response to rabies nucleocapsid and glycoprotein antigens. Clin Exp Immunol. 1991;84(2):195–9. 22. Hemachudha T, Phuapradit P. Rabies. Curr Opin Neurol. 1997;10(3): 260–7. WHO_TRS_inside_final_2018_after_Corr_round5.indd 20 24/04/2018 20:50 Diagnosis 21 23. Burton EC, Burns DK, Opatowsky MJ, El-Feky WH, Fischbach B, Melton L et al. Rabies encephalomyelitis: clinical, neuroradiological, and pathological findings in 4 transplant recipients. Arch Neurol. 2005;62(6):873–82. 24. Maier T, Schwarting A, Mauer D, Ross RS, Martens A, Kliem V et al. Management and outcomes after multiple corneal and solid organ transplantations from a donor infected with rabies virus. Clin Infect Dis. 2010;50(8):1112–9. 25. Shantavasinkul P, Tantawichien T, Wacharapluesadee S, Jeamanukoolkit A, Udomchaisakul P, Chattranukulchai P et al. Failure of rabies postexposure prophylaxis in patients presenting with unusual manifestations. Clin Infect Dis. 2010;50(1):77–9. 26. Human rabies – Minnesota, 2007. Morbid Mortal Wkly Rep. 2008;57(17):460–2. 5. Diagnosis Rabies is an acute, progressive encephalitis caused by a lyssavirus. Clinical diagnosis of encephalitis can be difficult, and laboratory methods should be used to confirm a diagnosis when possible. During the past decade, significant progress has been made in laboratory methods, including clinical case confirmation by the demonstration of viral antigens, antibodies and amplicons. At a minimum, each country should have a national reference laboratory with the capacity for rabies diagnosis by currently recommended techniques (1–3). Where such expertise is lacking, support for training and reference diagnostic capability can be obtained from WHO collaborating centres (section 13.1.3), reference centres of the World Organisation for Animal Health (OIE) and FAO reference laboratories (see section 13). 5.1 Standard case definitions for rabies Countries should use standard definitions for rabies, supported by laboratory-based surveillance of suspected cases in humans and animals. A suspected clinical case of rabies in humans is defined as: an acute neurological syndrome (i.e. encephalitis) dominated by forms of hyperactivity (furious rabies) or paralytic syndromes (paralytic rabies) progressing towards coma and death, usually by cardiac or respiratory failure, typically within 7–10 days of the first signs if no intensive care is instituted. These may include any of the following: aerophobia, hydrophobia, paresthesia or localized pain, dysphagia, localized WHO_TRS_inside_final_2018_after_Corr_round5.indd 21 24/04/2018 20:50 22 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report weakness, nausea or vomiting (4). One or more of the following laboratory criteria should be used to confirm a clinical case: ■ presence of viral antigens in samples (e.g. brain tissue, skin); ■ isolation of virus from samples in cell culture or in laboratory ani- mals; ■ presence of viral-specific antibodies in the cerebrospinal fluid (CSF) or serum of an unvaccinated person; and/or ■ presence of viral nucleic acids in samples (e.g. brain tissue, skin, sa- liva, concentrated urine). Cases of rabies are classified as: ■ suspected: a case that is compatible with a clinical case definition; ■ probable: a suspected case plus a reliable history of contact with a suspected, probably or confirmed rabid animal (see Table 16 in section 11); ■ confirmed: a suspected or probable case that is confirmed in the labo- ratory. A template for recording data on possible exposure to rabies is given in Annex 2. 5.2 Clinical diagnosis A presumptive diagnosis of rabies is simplified when an individual presents with a compatible illness and has documented exposure to an animal confirmed as rabid in a laboratory. Classical signs of rabies include spasms in response to tactile, auditory, visual or olfactory stimuli (e.g. aerophobia and hydrophobia) alternating with periods of lucidity, agitation, confusion and signs of autonomic dysfunction (5). Spasms may occur in rabid patients in whom excitation is prominent. Spontaneous inspiratory spasms can occur continuously until death, and their presence may facilitate a clinical diagnosis. Excitation is less evident in paralytic rabies, and phobic spasms may appear in only 50% of such patients. During the early stages of paralytic rabies, notable signs may include myoedema at percussion sites, usually in the region of the chest, deltoid muscle and thigh, piloerection and fasciculations. In the absence of a history of exposure or typical symptoms, a diagnosis of rabies on clinical grounds alone may be difficult and often unreliable. Some patients can present with atypical rabies, including a paralytic or Guillain- Barré-like syndrome or other atypical features (5). Atypical rabies occurs quite WHO_TRS_inside_final_2018_after_Corr_round5.indd 22 24/04/2018 20:50 Diagnosis 23 commonly and may contribute to misdiagnosis and under-reporting of cases. Detailed clinical information on patients with atypical rabies, especially cases associated with exposure to bats or other wildlife, has been reported (6). Magnetic resonance imaging, performed with adequate precautions for potentially infectious patients, can be helpful (5, 7). Abnormal, ill-defined, mildly hypersignal T2 images involving the brain-stem, hippocampus, hypothalamus, deep and subcortical white matter and deep and cortical grey matter are evident, regardless of clinical type. Gadolinium enhancement may appear clearly only in later stages, when patients lapse into a coma. Such patterns can help differentiate rabies from other viral encephalitides, not in terms of location, but in the appearance of the T2 image and in the pattern of contrast enhancement, when compared with consciousness status (7). Computerized tomography of the brain is of little diagnostic value. Without adequate epidemiological scrutiny and laboratory confirmation, rabies may be misdiagnosed and death ascribed to other, more common and familiar causes of encephalitis (e.g. cerebral malaria in malaria-endemic regions) (1). Rabies should be included in the differential diagnosis of all patients who present with unexplained, acute, progressive viral encephalitis, even in areas where the disease is rare, as it can occur locally in wildlife (such as bats, mongooses, foxes and jackals; see section 10), can be acquired during travel to enzootic areas, and because imported cases of human and animal rabies continue to occur (1, 4). As transmission of RABV to recipients of solid organ transplants has been described, all potential organ donors who present with compatible encephalitis should be screened and tested to determine whether they present an infectious risk by examining suitable ante- or post-mortem specimens by recommended laboratory methods (1). 5.3 Biosafety, sampling and specimen transport for laboratory diagnosis 5.3.1 Biosafety Rabies has the highest case fatality rate of any currently recognized infectious disease. Therefore, safety is of paramount importance when working with lyssaviruses. In general, biosafety level 2 safety practices are adequate for routine laboratory activities such as handling animals, necropsy and collection, preparation and processing of samples (2, 3). The basic facility design should be adequate to allow for these practices, and precautions must include personal protective equipment (e.g. clothing, gloves, eye protection) and pre-exposure rabies vaccination. Activities that may require a biosafety level 3 classification include production of large quantities of concentrated virus, procedures that WHO_TRS_inside_final_2018_after_Corr_round5.indd 23 24/04/2018 20:50 24 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report may generate aerosols (e.g. homogenization of tissue suspensions) and work with newly isolated lyssaviruses for which the effectiveness of current prophylaxis is not known. All national safety guidelines for working with infectious agents should be followed. 5.3.2 Sampling for intra-vitam diagnosis in humans Secretions, biological fluids (such as saliva, CSF, tears, serum) and some tissues (such as skin biopsy samples, including hair follicles at the nape of the neck) can be used to diagnose rabies during life (1, 2). Although serum and CSF may not be very sensitive specimens for ante-mortem diagnosis, particularly in the early course of illness, a positive result provides valuable diagnostic information. The samples that afford the highest diagnostic sensitivity are at least three saliva samples, taken at intervals of 3–6 h, and skin biopsies (including hair follicles). Ideally, samples should be stored at –20 °C or less. 5.3.3 Sampling for post-mortem diagnosis in humans and animals Brain tissue is the preferred specimen for post-mortem diagnosis in both humans and other animals (2, 3). In many situations, it may not be possible to remove the brain for post-mortem sampling because of factors such as family consent or practical and biosafety issues related to removal of animal brains in the field. Some of these challenges can be overcome by collecting samples with effective, well-established techniques that require less invasive post-mortem routes (3), such as through the orbit or foramen magnum. A diagnostic sample can be collected without opening the skull, for example by introducing a 5-mm drinking-straw or a 2-mL disposable plastic pipette into the occipital foramen in the direction of an eye or using a trocar to make a hole in the posterior wall of the eye socket and introducing a plastic pipette or straw. Samples can be collected from the rachidian bulb, the base of the cerebellum, the hippocampus, the cortex and the medulla oblongata. When a straw is used, it should be pinched between the fingers to prevent material escaping on withdrawal. Ideally, brain tissue should be kept refrigerated or frozen until testing. If this is not possible, samples can be preserved at ambient temperature in a 50% glycerine–saline solution. Freezing of samples in glycerine is not recommended. The glyercine must be removed by washing prior to testing, and acetone fixation is not recommended before the direct fluorescent antibody test. Examination of chemically fixed specimens for viral antigens can be both sensitive and specific if appropriate tissues and tests are used but is not recommended for routine diagnosis. If specimens are received in formalin, the WHO_TRS_inside_final_2018_after_Corr_round5.indd 24 24/04/2018 20:50 Diagnosis 25 duration of brain fixation should be approximately 7–14 days before embedding in paraffin. Wet tissue specimens should be transferred from formalin to absolute ethanol for subsequent molecular diagnosis and antigen detection. For molecular studies and genetic characterization of viral strains, the impregnation of brain tissue or body fluid suspected of infection with RABV on filter paper containing proper inactivating chemicals allows safe, stable, cost– effective shipment of samples at ambient temperature. Effective viral inactivation should nevertheless be ensured before shipment. 5.3.4 Transport of samples Diagnostic specimens should be frozen or refrigerated, depending on the sample type. A cold chain should be maintained after sampling, as described above. Specimens for diagnosis of rabies should be shipped according to national and international regulations to avoid exposure (8). Packing instructions are given in the WHO recommendations on transport of infectious substances (8). Information on the appropriate International Air Transport Association shipment classification can be found on the Association’s website (http://www. iata.org/publications/dgr/Pages/index.aspx). 5.4 Laboratory techniques for post-mortem diagnosis of rabies in humans and animals A definitive, reliable diagnosis of rabies can be made only by appropriate laboratory methods. The basic techniques are described in the WHO publication Laboratory techniques in rabies (2) and the OIE Manual of diagnostic tests and vaccines for terrestrial animals (3). Standard diagnostic tests for rabies are summarized in Table 4. Information on additional tests since the WHO publication in 1996 and the OIE Manual, including indications for and the performance of each test, is given in Table 5. The diagnostic tests are also described briefly in the following sections. Participation in routine quality management is strongly recommended when any of the laboratory techniques described is used (2, 3). An updated laboratory manual will be published by WHO in 2018. WHO_TRS_inside_final_2018_after_Corr_round5.indd 25 24/04/2018 20:50 26 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Table 4 Standard diagnostic tests for rabies Antigen detection RNA detection Virus isolation Antibody detection Species (time of test) Samplea Testb Sample Test Sample Test Sample Test Human (ante- mortemc) Skin/ hair follicles FAT Skin/ hair follicles Saliva Tears CSF RT- PCRd Saliva Tears CSF RTCIT MI Serum CSF RFFIT FAVN- test IFA ELISA Human (post- mortem) Brain Skin/ hair follicles FAT DRIT IHC Brain Skin/ hair follicles RT-PCR Brain RTCIT MI NA NA Animal (post- mortem) Brain FAT DRIT IHC Brain RT-PCR Brain RTCIT MI NA NA Abbreviations: CSF, cerebrospinal fluid; DRIT, direct rapid immunohistochemical test; ELISA, enzyme-linked immunosorbent assay; FAT, direct fluorescent antibody test; FAVN, fluorescent antibody virus neutralization; IFA, indirect immunofluorescence; IHC, immunohistochemistry on formalin-fixed samples; MI, mouse inoculation test; NA, not applicable; RTCIT, rabies cell culture inoculation test; RT-PCR, reverse transcriptase- polymerase chain reaction a If more than one sample type is listed, the one(s) shown in bold have highest diagnostic sensitivity. b If more than one test is listed, the one(s) in bold are preferred. c Positive results in ante-mortem samples are diagnostic, but negative results do not rule out rabies. d RT-PCR may be in the conventional or real-time format. WHO_TRS_inside_final_2018_after_Corr_round5.indd 26 24/04/2018 20:50 Diagnosis 27 Ta bl e 5 Ra bi es d ia gn os tic te st s i nt ro du ce d sin ce p ub lic at io n of th e W HO La bo ra to ry te ch ni qu es in ra bi es (2 ) i n 19 96 Te st Ta rg et Sa m pl e ty pe O bj ec tiv e La bo ra - to ry A dv an ta ge s D is ad va nt ag es Co m m en ts D ire ct ra pi d im m un o- hi sto ch em - ist ry te st (D RI T) (1 0, 2 5) Vi ra l pr ot ei n (n uc le o- pr ot ei n) Br ai n Pr im ar y po st- m or te m di ag no sis ; en ha nc ed su rv ei l- la nc e C en tr al an d lo ca l ne tw or k H ig h se ns iti vi ty an d sp ec ifi ci ty ; i nv ol ve s lig ht m ic ro sc op y of ce nt ra l n er vo us sy ste m im pr es sio ns co lle ct ed fro m m am m al s w ith su sp ec te d ra bi es ; r ap id ; su ita bl e f or su rv ei lla nc e un de r fi eld co nd iti on s; re qu ire s b io tin -la be lle d m on oc lo na l o r p ol y- clo na l a nt ib od ie s e ith er fro m O IE o r W H O re fe re nc e l ab or at or ie s o r se lf- pr od uc ed Re qu ire s b as ic la bo - ra to ry eq ui pm en t, re ag en ts an d tr ai ni ng . N o co m m er ci al p ro du ct s av ai la bl e U nd er co ns id er at io n as an ot he r e qu al O IE - re co m m en de d pr im ar y po st- m or te m d ia gn os tic te st; b ro ad ch oi ce o f an tib od ie s a llo w s d et ec - tio n of al l k no w n ly s- sa vi ru se s; in ro ut in e u se in N or th A m er ic a f or en ha nc ed su rv ei lla nc e of w ild lif e r ab ie s i n or al va cc in at io n pr og ra m m es In di re ct ra pi d im m un o- hi sto ch em - ist ry te st (I RI T) (1 7, 26 ) Vi ra l pr ot ei n Br ai n A nt ig en ic ty pi ng o f co nfi rm ed ca se s C en tr al re fe re nc e an d lo ca l ne tw or k Pr ov id es co nfi rm at io n of ca ni ne R A BV id en tit y by m Ab ty pi ng u nd er li gh t m ic ro sc op y; su ch p an els ar e w id ely av ai la bl e f ro m th e W H O co lla bo ra tin g ce nt re s A s a bo ve Ty pi ng o f a nt ig en ic va ria nt s h as b ee n w id e- sp re ad th ro ug ho ut L at in A m er ic a i n do g- m ed i- at ed ra bi es el im in at io n pr og ra m m es WHO_TRS_inside_final_2018_after_Corr_round5.indd 27 24/04/2018 20:50 28 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Te st Ta rg et Sa m pl e ty pe O bj ec tiv e La bo ra - to ry A dv an ta ge s D is ad va nt ag es Co m m en ts Im m un o- ch ro m a- to gr ap hi c te st fo r RA BV d e- te ct io n (i. e. la te ra l fl ow de vi ce s) (1 2, 1 4) Vi ra l pr ot ei n (n uc le o- pr ot ei n) Br ai n Sc re en - in g fo r RA BV in do m es tic an d w ild an im al s C en tr al an d lo ca l ne tw or k Lo w te ch no lo gi ca l re qu ire m en t; lo w co n- ta in m en t r eq ui re m en t; ca n be u se at p oi nt o f sa m pl in g; su ita bl e f or su rv ei lla nc e u nd er fi eld co nd iti on s M uc h be tte r s ta nd - ar di za tio n an d qu al - ity co nt ro l o f s om e k its re qu ire d Ca nn ot su bs tit ut e f or cu rr en tly re co m m en de d re fe re nc e t ec hn iq ue s b ut m ay b e h elp fu l i n co un - tr ie s w he re su rv ei lla nc e is la ck in g RT -P CR (c on ve n- tio na l a nd re al -ti m e) (1 6, 2 7, 2 8) Vi ra l R N A A nt e- m or te m (e .g . s al iv a, nu ch al sk in , C SF , te ar s, co rn ea l w as h) an d po st- m or - te m ti ss ue s (e .g . ce nt ra l ne rv ou s sy ste m ) Pr im ar y di ag no sis ; vi ra l v ar i- an t t yp in g C en tr al re fe re nc e la bo ra to ry H ig h se ns iti vi ty an d sp ec ifi ci ty ; a nt e- m or te m di ag no sis o f h um an ra bi es to co nfi rm cl in ic al di ag no sis an d pa tie nt m an ag em en t, in sti tu tio n of b ar rie r n ur sin g an d PE P to cl os e c on ta ct s; ca n al so b e u se d fo r po st- m or te m co nfi r- m at io n in b ra in ti ss ue (h um an o r a ni m al ); am pl ifi ed m at er ia l c an be se qu en ce d fo r f ur th er vi ru s c ha ra ct er iz at io n. H ig h te ch no lo gi ca l re qu ire m en t; se ns iti vi ty de pe nd s o n th e t yp e o f sp ec im en co lle ct ed ; ~ 10 0% w ith n uc ha l s ki n bi op sy an d at le as t t hr ee sa liv a s am pl es ; i f t he se re qu ire m en ts ar e n ot fu lfi lle d, a ne ga tiv e t es t re su lt do es N O T ru le ou t a d ia gn os is of ra bi es ; str in ge nt q ua lit y as su r- an ce an d id ea l p re se rv a- tio n of th e s am pl e a re re qu ire d. O bt ai ni ng b ra in ti ss ue co nt in ue s t o be a ch al - le ng e i n hu m an ra bi es di ag no sis ; t he re fo re , su ch te sts m ay b e t he on ly fe as ib le o ne s, es pe - ci al ly fo r a nt e- m or te m te sti ng WHO_TRS_inside_final_2018_after_Corr_round5.indd 28 24/04/2018 20:50 Diagnosis 29 Te st Ta rg et Sa m pl e ty pe O bj ec tiv e La bo ra - to ry A dv an ta ge s D is ad va nt ag es Co m m en ts C om pe ti- tiv e E LI SA (k its ) ( 29 , 30 ) H os t an tib od y (a ni m al ) Se ru m ; se ra ad so rb ed on fi lte r pa pe r; m us cle ex tr ac t D et ec tio n an d qu an - tifi ca tio n of R A BV an tib od ie s; m ea su re - m en t o f an tib od y re sp on se to v ac - ci na tio n; se ro -s ur - ve ill an ce C en tr al an d lo ca l ne tw or k G oo d re pe at ab ili ty b e- tw ee n la bo ra to rie s; co n- tro lle d su pp lie r; in te rn al co nt ro ls; n ot sp ec ie s- sp ec ifi c; ea sy , r ap id co lle ct io n di re ct ly in th e fie ld w ith ou t t he n ee d fo r n ee dl es , s yr in ge s o r va cu ta in er tu be s Re qu ire s s om e b as ic la bo ra to ry eq ui pm en t; m ay re qu ire ad di tio na l va lid at io n ste ps a Cu rr en tly av ai la bl e k it is va lid at ed fo r m ea s- ur em en t o f a nt ib od y re sp on se to d og v ac ci na - tio n an d w ild lif e o ra l ra bi es v ac ci na tio n, n ot fo r h um an an tib od ie s In di re ct EL IS A (k its ) ( 23 ) H os t an tib od y (h um an , an im al ) Se ru m , pl as m a D et ec tio n an d qu an - tifi ca tio n of R A BV an tib od ie s; m ea su re - m en t o f an tib od y re sp on se to v ac - ci na tio n; se ro -s ur - ve ill an ce C en tr al an d lo ca l ne tw or k oo d re pe at ab ili ty be tw ee n la bo ra to rie s; co nt ro lle d su pp lie r; in te rn al co nt ro ls Re qu ire s s om e b as ic la bo ra to ry eq ui pm en t; m ay n ot b e u se fu l f or al l s pe ci es ; m ay re qu ire ad di tio na l v al id at io n ste ps ;a m ay d et ec t o nl y ce rt ai n iso ty pe s ( e.g . Ig G ) o f R A BV an tib od - ie s M ay b e u se fu l f or co nfi rm in g im m un e re sp on se in ex po se d pe r- so nn el or d ur in g PE P in im m un e- co m pr om ise d pa tie nt s o r w he n m aj or de vi at io ns fr om re co m - m en de d PE P sc he du le s oc cu r; ca n be u se d in se ro su rv ey s WHO_TRS_inside_final_2018_after_Corr_round5.indd 29 24/04/2018 20:50 30 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Te st Ta rg et Sa m pl e ty pe O bj ec tiv e La bo ra - to ry A dv an ta ge s D is ad va nt ag es Co m m en ts Im m un o- ch ro m a- to gr ap hi c te st fo r RA BV an tib od - ie s ( i.e . la te ra l fl ow de vi ce s) (3 1) H os t an tib od y (a ni m al ) Se ru m Sc re en in g fo r R A BV an tib od - ie s, e.g . re sp on se to v ac - ci na tio n; se ro -s ur - ve ill an ce C en tr al an d lo ca l ne tw or k Lo w te ch no lo gi ca l re qu ire m en t; lo w co n- ta in m en t r eq ui re m en t; ca n be u se at p oi nt o f sa m pl in g Sc re en in g te st on ly fo r de te rm in at io n of h u- m or al im m un e r es po ns e to ra bi es v ac ci na tio n U se fu l i n do g- m ed ia te d ra bi es v ac ci na tio n ca m pa ig ns o r l oc al va cc in at io n cli ni cs in ar ea s w he re eq ui pm en t re qu ire d fo r R FF IT , FA V N o r E LI SA is n ot av ai la bl e a C or re la tio n w ith n eu tr al iz in g a nt ib od y l ev els m ay d ep en d on h om ol og y b et w ee n th e k it an tig en s a nd th e R A BV va cc in e s tr ai n, as w el l a s h os t g en et ic s. D et er m in at io n of ap pr op ria te cu t-o ff le ve ls re qu ire s v al id at io n fo r t he p ur po se o f t es tin g. WHO_TRS_inside_final_2018_after_Corr_round5.indd 30 24/04/2018 20:50 Diagnosis 31 5.4.1 Viral antigen detection The fluorescent antibody test (FAT) is a rapid, sensitive, specific method for diagnosing rabies in animals and humans (2, 3, 9) and is the gold standard for diagnosis. The accuracy of the test depends, however, on variables such as the expertise of the examiner, the quality of the anti-rabies conjugate and functional equipment, including the fluorescence microscope, and the quality of the sample. The test is based on microscopic examination of impressions or smears of brain tissue after incubation with anti-rabies polyclonal globulin or broadly cross-reactive mAbs conjugated with fluorescein isothiocyanate. The diagnostic conjugate should be of high quality, and the appropriate working dilution for optimal performance and detection of virus-specific antigens should be determined. Impressions (or smears) of samples from the brain-stem and/ or cerebellum are recommended to ensure high sensitivity of the test. The hippocampi (Ammon’s horns) may also be included but are not necessary for a definitive diagnosis. Other methods for the detection of lyssavirus antigens, such as enzyme-linked immunosorbent assays (ELISAs) and the direct rapid immunohistochemistry test (DRIT), have provided consistently reproducible results in multiple laboratories. Extensive evaluation of DRIT has shown that its sensitivity and specificity are comparable to those of the FAT (10, 25). The DRIT allows rapid on-site testing by light microscopy and should facilitate decentralized epidemiological surveys, especially if the reagents become commercially available. The Consultation recommends the DRIT as an alternative to the FAT for improved, decentralized, laboratory-based surveillance. Typical intracytoplasmic inclusions in formalin-fixed brain tissue can be detected in neurons by validated immunohistochemical methods (11); however, formalin fixation of brain tissue is not a suitable method for routine diagnosis, because it delays the test results and is less sensitive than the FAT or DRIT. Lateral flow tests have been developed for rapid detection of RABV antigens under field conditions, and some show good results (12–14), although adequate validation according to international standards is still required (2, 13). Nevertheless, such tests may be useful in surveillance in situations in which shipment of samples to laboratories is difficult or laboratory diagnostic facilities are lacking; it may also improve the engagement of front-line staff in rabies surveillance. 5.4.2 Virus isolation Virus might have to be isolated to confirm the results of antigen detection tests and for further amplification or characterization of an isolate (2). Lyssaviruses WHO_TRS_inside_final_2018_after_Corr_round5.indd 31 24/04/2018 20:50 32 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report can be isolated in cell cultures, such as neuroblastoma cells, or by intracranial inoculation into suckling mice. Virus isolation in animals should be replaced by alternative methods, whenever possible. Murine neuroblastoma cells (e.g. NA C1300) are more susceptible to field isolates of lyssavirus than other cell lines tested (2). Virus isolation in neuroblastoma cell culture is at least as efficient as animal inoculation, especially for small quantities of virus. Cell culture isolation also reduces the time required for diagnosis, from 10–21 days with the mouse inoculation test to only 2–4 days. If the conditions are not optimal, however, such as decomposed brain, false-negative results may be obtained. When cell culture facilities or molecular methods are not available, animal inoculation can be used. If a rapid answer is required, suckling mice (< 3 days old) are preferred to weanling or adult mice, because they are more susceptible than older animals. The observation period may be shortened by inoculation of sufficient mice to enable sequential killing and examination of brains by the FAT, starting 4 days post-inoculation (15). 5.4.3 Viral RNA detection Molecular methods, such as the reverse transcription polymerase chain reaction (RT-PCR) and other amplification techniques, play an increasingly important role in many countries (16, 17). If brain tissue is available, the FAT or DRIT should be used for primary diagnosis of viral antigens (2). Molecular techniques can be used for confirmatory testing and epidemiological surveys in laboratories with strict quality control procedures and with experience and expertise in using such techniques. They can also be used for ante-mortem diagnosis in humans. Use of robust positive or in-process controls is strongly recommended. 5.5 Techniques for ante-mortem diagnosis of rabies in humans Many laboratory methods can be used to confirm a clinical case of rabies while the patient is still alive (1); however, use of ante-mortem techniques for the diagnosis of rabies in animals is strongly discouraged. The sensitivity of a technique for diagnosing rabies varies widely according to the stage of the disease, immunological status, intermittent viral excretion and the training of the technical staff. While a positive, validated result is indicative of rabies, a negative result does not necessarily rule out the infection. A diagnosis of rabies in a patient suspected of having the disease is valuable for multiple reasons, including: specific characterization of the causative agent and of the potential source of infection, especially when a history of exposure WHO_TRS_inside_final_2018_after_Corr_round5.indd 32 24/04/2018 20:50 Diagnosis 33 to an animal is lacking; identification of other people who may have been exposed to the same animal during the public health investigation; application of appropriate measures for infection control to prevent exposure from contact with the patient; administration of PEP to people exposed to the patient’s infectious secretions; case closure and grief counselling with family members; consideration of experimental therapeutic options; monitoring of viral loads and patient response if treatment is given; less invasive techniques for documenting the human burden of disease, given the infrequency of autopsies; and indication of another infectious agent if the test results are negative. 5.5.1 Viral antigen detection Viral antigens can be detected with the FAT in skin biopsy samples or hair follicles from patients with clinical rabies (18). The results are independent of the antibody status of the patient, and specimens may be positive during the early phase of the disease. Skin samples are usually taken from the nuchal area of the neck, with hair follicles containing peripheral nerves. Examination of several sections may be required to detect viral antigens around the base of hair follicles. The quality of the samples is of paramount importance, as the absence of follicles decreases the sensitivity of the test. This technique may not be practicable in all settings, because a cryostat is required to prepare frozen sections of skin; detection of viral RNA may be preferable if equipment is lacking (16, 27, 28). The FAT of corneal impressions is rarely reliable in most clinical settings, and it is not recommended as a routine test because of the risk of corneal scarification, particularly in patients with causes of encephalitis other than rabies. Immunochromatographic methods have been developed to detect RABV antigens directly in brain tissue from animals (12), but they require standardization and stringent quality control before their application in human ante-mortem diagnosis. 5.5.2 Viral antibody detection Given the pathogenesis of the virus, it is difficult to use serological tests in ante-mortem diagnosis of rabies in humans, as RABV-specific antibodies may be present in serum and CSF only during the late stage of human infection. Virus neutralizing antibodies in the serum of unvaccinated patients or in CSF can be measured with a virus neutralization test, such as the rapid fluorescent focus inhibition test (RFFIT) and the fluorescent antibody virus neutralization (FAVN) test (19). The sensitivity of such assays for ante-mortem diagnosis is, however, low, as virus neutralizing antibodies tend to appear only, on average, 7–8 days after clinical symptoms first appear. Viral antibodies are infrequently found in CSF, depending in part on the clinical stage of the disease. Antibody (IgG subclass) titres against RABV G protein measured by qualified ELISA have WHO_TRS_inside_final_2018_after_Corr_round5.indd 33 24/04/2018 20:50 34 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report been shown to correlate well with those measured by virus neutralization, and ELISA is easier to perform routinely (20, 21). ELISAs will not, however, detect IgM rabies-specific antibodies that are first produced upon exposure. Rapid detection of antibodies (IgG and IgM) to other viral antigens, (e.g. nucleoprotein) may also be useful, as they may appear before neutralizing antibodies (4). 5.5.3 Viral RNA detection Molecular detection methods are highly sensitive for rabies diagnosis (1, 2). As with all laboratory methods, they require standardization and stringent quality control. Lyssavirus RNA can be detected and amplified from many biological fluids and tissue samples (e.g. saliva, CSF, tears, skin, concentrated urine and hair follicles). Serial samples should be tested, as the virus is excreted intermittently. The highest sensitivity is seen with skin biopsies (including hair follicles) and saliva. 5.5.4 Virus isolation In ante-mortem diagnosis, isolation of virus from saliva or other biological samples is ideal for obtaining an unequivocal diagnosis and virus characterization (1–3). The success rate depends in part on the immunological status of the patient (virus is more likely to be isolated from people without antibodies), the intermittence of viral excretion and the number of consecutive passages in cell culture. Specimens may contain no infectious virus even during the late stage of the disease. Liquid specimens or swabs should be frozen after collection, the content of the swab having been expelled into the collection medium. Under no circumstances should preservatives be added to the collection medium. 5.6 Measuring antibody response to rabies vaccination in humans The RFFIT virus neutralization assay and the FAVN test are recommended for measuring post-vaccination immune responses and for determining whether booster vaccination is necessary, because they have been correlated with protection in animal studies (19, 22). Virus neutralization assays are used to determine the level of protective antibodies in immunocompromised patients, in evaluating new vaccines or vaccination schedules and for deciding whether to give boost vaccination when the neutralizing antibody level is critical on the basis of individual risk factors. ELISAs can be useful for routine screening to determine whether an immune response developed after pre- or post-exposure vaccination, as they are easy to perform (21). Measurement of binding antibodies with an ELISA and measurement of neutralizing antibodies with a RFFIT or an FAVN test are WHO_TRS_inside_final_2018_after_Corr_round5.indd 34 24/04/2018 20:50 Diagnosis 35 inherently different, and the results should be interpreted with this understanding (23). Post-vaccination antibody (IgG subclass) titres against RABV glycoprotein measured by qualified ELISA have been shown to correlate well with those measured by virus neutralization (21). Before a commercially available kit is used, its performance characteristics (i.e. appropriate cut-off level, sensitivity and specificity) should be evaluated under local conditions (23). The limitations of kits, such as species specificity, immunoglobulin class detected and linear range, should be considered and evaluated in respect of the purpose of the monitoring programme (22). Participation in quality assurance and proficiency programmes is recommended to ensure the validity of the results from laboratories that perform rabies serology by the RFFIT, the FAVN test or ELISA. 5.7 Measuring antibody response to rabies vaccination in animals The RFFIT, FAVN test and qualified ELISAs can be used to measure post- vaccination immune responses in animals (19, 22). This is important when there is any uncertainty about the quality of the vaccine, vaccine storage (e.g. maintenance of the cold chain) or the effectiveness of vaccine delivery. Post-vaccination samples should be tested at the time, or close to the time, at which peak titres are expected (approximately 4 weeks post-vaccination). Serological results from samples collected after this time may be difficult to interpret, as antibody titres can wane rapidly even though animals are still protected against infection. As a result of the variable and potentially rapid rate of decline in antibody, serosurveys conducted more than 4 weeks after vaccination are not recommended for monitoring post- vaccination coverage or population immunity (19, 24). The RFFIT (32) and FAVN (19) assays are recommended for the purposes of international animal movement and trade (3). Both virus neutralization (e.g. RFFIT, FAVN test) and ELISA are suitable for monitoring the antibody response of vaccinated animals in the framework of rabies control. ELISAs are available in kit format and may be indirect or competitive. Use of an ELISA is acceptable after qualification of the assay for the purpose of testing. As mentioned above, before a commercially available kit is used, its performance characteristics should be evaluated under local conditions. . 5.8 Virus identification with molecular techniques: epidemiological considerations Thousands of lyssavirus isolates from humans, domestic animals and wildlife have been characterized with antigenic and molecular techniques, resulting in basic identification and classification of lyssaviruses and the WHO_TRS_inside_final_2018_after_Corr_round5.indd 35 24/04/2018 20:50 36 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report demonstration that virus isolates from a given geographical area or species have unique genetic sequences. In most cases, these differences can be used to identify the principal animal reservoir (e.g. bat, dog, fox, mongoose) and to infer the source of infection when a definitive history of exposure is lacking (1, 2). 5.9 References 1. Dacheux L, Wacharapluesadee S, Hemachudha T, Meslin FX, Buchy P, Reynes JM et al. More accurate insight into the incidence of human rabies in developing countries through validated laboratory techniques. PLoS Negl Trop Dis. 2010;4(11):e765. 2. Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. Fourth edition. Geneva: World Health Organization; 1996:9–27. 3. Rabies (infection with rabies virus). Chapter 2.1.17. Manual of diagnostic tests and vaccines for terrestrial animals. Vol. 2. Paris: World Organisation for Animal Health; 2017. 4. Petersen BW, Rupprecht CE. Human rabies epidemiology and diagnosis. In: Tkachev S, editor. Non-flavivirus encephalitis. InTech; 2011. doi: 10.5772/21708. 5. Rupprecht CE, Hemachudha T. Rabies. In: Scheld WM, Whitley RJ, Marra CM, editors. Infections of the central nervous system. Philadelphia: Lippincott, Williams & Wilkins; 2004. 6. Feder HM, Petersen BW, Robertson KL, Rupprecht CE. Rabies: still a uniformly fatal disease? Historical occurrence, epidemiological trends, and paradigm shifts. Curr Infect Dis Rep. 2012;14(4):408–22. 7. Laothamatas J, Hemachudha T, Mitrabhakdi E, Wannakrairot P, Tulayadaechanont S. MR imaging in human rabies. Am J Neuroradiol. 2003;24(6):1102–9. 8. Guidance on the regulations for the transport of infectious substances 2017–2018. Geneva: World Health Organization; 2017. 9. Robardet E, Picard-Meyer E, Andrieu S, Servat A, Cliquet F. International interlaboratory trials on rabies diagnosis: an overview of results and variation in reference diagnosis techniques (fluorescent antibody test, rabies tissue culture infection test, mouse inoculation test) and molecular biology techniques. J Virol Methods. 2011;177(1):15–25. WHO_TRS_inside_final_2018_after_Corr_round5.indd 36 24/04/2018 20:50 Diagnosis 37 10. Coetzer A, Sabeta CT, Markotter W, Rupprecht CE, Nel LH. Comparison of biotinylated monoclonal and polyclonal antibodies in an evaluation of a direct rapid immunohistochemical test for the routine diagnosis of rabies in southern Africa. PLoS Negl Trop Dis. 2014;8(9):e3189. 11. Stein LT, Rech RR, Harrison L, Brown CC. Immunohistochemical study of rabies virus within the central nervous system of domestic and wildlife species. Vet Pathol. 2010;47(4):630–3. 12. Servat A, Picard-Meyer E, Robardet E, Muzniece Z, Must K, Cliquet F. Evaluation of a rapid immunochromatographic diagnostic test for the detection of rabies from brain material of European mammals. Biologicals. 2012;40(1):61–6. 13. Eggerbauer E, de Benedictis P, Hoffmann B, Mettenleiter TC, Schlottau K, Ngoepe EC et al. Evaluation of six commercially available rapid immunochromatographic tests for the diagnosis of rabies in brain material. PLoS Negl Trop Dis. 2016;10(6):e0004776. 14. Léchenne M, Naïssengar K, Lepelletier A, Alfaroukh IO, Bourhy H, Zinsstag J et al. Validation of a rapid rabies diagnostic tool for field surveillance in developing countries. PLoS Negl Trop Dis. 2016;10(10):e0005010. 15. Webster WA, Casey GA, Charlton KM. The mouse inoculation test in rabies diagnosis: early diagnosis in mice during the incubation period. Can J Comp Med. 1976;40(3):322. 16. Faye M, Dacheux L, Weidmann M, Diop SA, Loucoubar C, Bourhy H et al. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus. J Virol Methods. 2017;243:120–30. 17. Mani RS, Madhusudana SN. Laboratory diagnosis of human rabies: recent advances. Sci World J. 2013;2013:569712. 18. Crepin P, Audry L, Rotivel Y, Gacoin A, Caroff C, Bourhy H. Intravitam diagnosis of human rabies by PCR using saliva and cerebrospinal fluid. J Clin Microbiol. 1998;36(4):1117–21. 19. Cliquet F, Aubert M, Sagne L. Development of a fluorescent antibody virus neutralisation test (FAVN test) for the quantitation of rabies- neutralising antibody. J Immunol Methods. 1998;212(1):79–87. WHO_TRS_inside_final_2018_after_Corr_round5.indd 37 24/04/2018 20:50 38 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 20. Welch RJ, Anderson BL, Litwin CM. An evaluation of two commercially available ELISAs and one in-house reference laboratory ELISA for the determination of human anti-rabies virus antibodies. J Med Microbiol. 2009;58(6):806–10. 21. Feyssaguet M, Dacheux L, Audry L, Compoint A, Morize JL, Blanchard I et al. Multicenter comparative study of a new ELISA, PLATELIA™ RABIES II, for the detection and titration of anti-rabies glycoprotein antibodies and comparison with the rapid fluorescent focus inhibition test (RFFIT) on human samples from vaccinated and non-vaccinated people. Vaccine. 2007;25(12):2244–51. 22. Moore SM, Hanlon CA. Rabies-specific antibodies: measuring surrogates of protection against a fatal disease. PLoS Negl Trop Dis. 2010;4(3):e595. 23. Moore SM, Pralle S, Engelman L, Hartschuh H, Smith M. Rabies vaccine response measurement is assay dependent. Biologicals. 2016;44(6):481– 6. 24. Moore SM, Gilbert A, Vos A, Freuling CM, Ellis C, Kliemt J et al. Rabies virus antibodies from oral vaccination as a correlate of protection against lethal infection in wildlife. Trop Med Infect Dis. 2017;2(3):31. 25. Rupprecht C, Cliquet F, Fehlner-Gardiner C, Fooks AR, Mueller T, Saveta C et al. Progress in the development of a direct rapid immunohistochemical test for diagnosing rabies. In: News from Colleagues. Paris: World Organisation for Animal Health; 2014;3:87–95 (https://www.oie.int/doc/ ged/D14185.PDF). 26. Dyer JL, Niezgoda M, Orciari LA, Yager PA, Ellison JA, Rupprecht CE. Evaluation of an indirect rapid immunohistochemistry test for the differentiation of rabies virus variants. J Virol Methods. 2013;190(1– 2):29–33. 27. Dacheux L, Larrous F, Lavenir R, Lepelletier A, Faouzi A, Troupin C et al. Dual combined real-time reverse transcription polymerase chain reaction assay for the diagnosis of lyssavirus infection. PLoS Negl Trop Dis. 2016;10(7):e0004812. 28. Mani RS, Madhusudana SN, Mahadevan A, Reddy V, Belludi AY, Shankar SK. Utility of real‐time Taqman PCR for antemortem and postmortem diagnosis of human rabies. J Med Virol. 2014;86(10):1804–12. WHO_TRS_inside_final_2018_after_Corr_round5.indd 38 24/04/2018 20:50 Management of patients before and after death 39 29. Bedeković T, Šimić I, Krešić N, Lojkić I, Mihaljević Ž, Sučec I et al. Evaluation of ELISA for the detection of rabies virus antibodies from the thoracic liquid and muscle extract samples in the monitoring of fox oral vaccination campaigns. BMC Vet Res. 2016;12(1):76. 30. Wasniewski M, Almeida I, Baur A, Bedekovic T, Boncea D, Chaves LB et al. First international collaborative study to evaluate rabies antibody detection method for use in monitoring the effectiveness of oral vaccination programmes in fox and raccoon dog in Europe. J Virol Methods. 2016;238:77–85. 31. Manalo DL, Yamada K, Watanabe I, Miranda ME, Lapiz SM, Tapdasan E et al. A comparative study of the rapina and the virus‐neutralizing test (rffit) for the estimation of antirabies‐neutralizing antibody levels in dog samples. Zoonoses Public Health. 2017;64(5):355–62. 32. Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabies neutralizing antibody. Bull World Health Organ. 1973; (48): 535- 541. 6. Management of patients before and after death 6.1 Management of patients with rabies Rabies is considered an overwhelmingly fatal disease, with tens of thousands of rabies deaths each year and only a few documented survivors. Worldwide, a probably underestimated 59  000 patients die of suspected or confirmed rabies each year (1). The vast majority of these deaths occur in poor, rural communities in Asia and Africa, where there is a high incidence of dog-mediated rabies and where people may find difficulty in accessing timely, affordable, adequate PEP. Most of these patients are managed, at least initially, in peripheral or even village health centres, where human and material resources for basic wound care and rabies prevention are often extremely limited or absent. There is no effective curative treatment for rabies once clinical signs have appeared. Almost all patients with rabies will die. An algorithm to guide management of human cases of confirmed or suspects rabies is proposed in Fig. 3. WHO_TRS_inside_final_2018_after_Corr_round5.indd 39 24/04/2018 20:50 40 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Rabies (confirmed or clinically suspected?) Aggressive management Palliative care with at least WHO essential medicine Critical care in selected hospitals Rabies-specific treatment Antiviral agents? If so, which? Immunotherapy? (controversial) Neuroprotective agents? Combination? Everywhere In-hospital (isolation) Sedatives (diazepam / midazolam) Analgesics (morphine?) Haloperidol? Rehydration? Home care (culturally sensitive) Sedatives (diazepam/ midazolam) Analgesics (morphine?) Rehydration? (nasogastric tube?) Subcutaneous, intrarectal (oral, usually not possible) Route? Approval could be obtained in advance for certain therapy, in keeping with scientifc and ethical standards. Physician decides with family; explains consequences Figure 3 Proposed algorithm to guide management of cases of confirmed or suspected human rabies From references 2–5 WHO_TRS_inside_final_2018_after_Corr_round5.indd 40 24/04/2018 20:50 Management of patients before and after death 41 6.2 Palliative management of patients with rabies Most patients with rabies remain conscious and are aware of the nature and outcome of their illness. They are usually extremely agitated, particularly when excitation predominates (“furious” rabies). Furthermore, they are often isolated, when possible, because of the perceived risk of transmission of RABV through contact. Unfortunately, in some countries, many rabies patients are turned away from hospitals and receive terminal care only from their families. Hospital care for patients with clinical rabies is advisable when possible, in order to reduce their suffering and ensure that they receive adequate, respectful palliative care. Although almost all patients will die, health care providers still have an essential role to play in providing prompt, effective, holistic, compassionate, culturally sensitive management. This can be done even with extremely limited equipment and drugs (4). In view of the inevitability of death in most cases, treatment should be focused on comfort, with heavy sedation (barbiturates, morphine) and avoidance of intubation or life-support measures, especially once the diagnosis is certain (1). The majority of patients with rabies are not candidates for aggressive therapy in a critical care unit (see section 6.4). Palliative care of these patients, whether in a hospital or at home, must be integral to all guidelines on rabies prevention and management. Palliative care should be accessible to patients with rabies (and other terminal illnesses) in every health care setting, and health care providers must be trained to deliver effective palliation. Some resources and a WHO guide for palliative care (including essential drugs) are available on WHO’s webpage on palliative care (6). Patients with confirmed rabies should receive adequate hydration, sedation and care in an appropriate medical facility, preferably in a calm, draft- free, quiet room, with suitable emotional and physical support (4, 7). The privacy, dignity and cultural needs of patients should be respected. Preserving the capacity of the family to communicate with patients in their dying moments must be a priority. The diagnosis should be discussed with the family as soon as possible after it has been made. Benzodiazepines such as diazepam are effective for sedation and muscle relaxation and can be given subcutaneously, intravenously or rectally. Lorazepam and midazolam are alternative benzodiazepines. Morphine may be administered for analgesia subcutaneously or intravenously, but it is often difficult to access in very peripheral centres. The major tranquilizer haloperidol has been recommended for restlessness, agitation, hallucination and aggression (8), but some physicians avoid its use because of its adverse effects and because sedation is less easily controlled than with other drugs. Excessive salivation can be treated with anticholinergic agents such as scopolamine. Drugs should be titrated to avoid excessive sedation requiring intubation. WHO_TRS_inside_final_2018_after_Corr_round5.indd 41 24/04/2018 20:50 42 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Repeated intravenous or subcutaneous morphine or benzodiazepines are effective in relieving the severe agitation, anxiety and muscular spasms that afflict patients with furious rabies (1). Once furious rabies has been diagnosed, invasive procedures should be avoided. Palliative care for patients with rabies is best delivered in a hospital, with intravenous drug delivery to minimize disturbance and distress. Rabies is not a contagious disease that is likely to cause an outbreak during patient care, and human–human transmission has been documented only in exceptional circumstances, such as organ transplantation (see section 8.3.2). When patients with rabies and/or their families request discharge or refuse admission (e.g. for cultural or religious reasons), health care teams should consider ambulatory palliation (medication and personal protective equipment). If transport is required, non-intravenous administration or medication that can be continued by routes other than parenteral (including through a nasogastric tube or intrarectally) might be preferred. A requirement for transport may be an additional reason for the health care team to initially prefer lighter sedation (4). 6.3 Recommendations for health care personnel and family members of patients with rabies Most patients with rabies die, and families that seek care should be informed and counselled to receive the news of the patient’s impending death. Care of people in whom rabies is diagnosed may cause anxiety among medical and nursing staff, relatives and friends providing non-medical care and in the media and the public. Human rabies does not pose a risk to health care staff if routine precautions are taken, especially during intubation and suctioning. PEP should be provided for health care personnel considered to be at risk, after careful assessment, and they should be reminded of the importance of adhering to barrier nursing and wearing personal protective equipment (standard precautions, including wearing gloves, glasses and mask in case a procedure generates splashes), as recommended for all infectious diseases. Hospitals that are likely to receive rabies patients can consider PrEP for health care staff who may be involved in their management (see section 8.2). PEP may sometimes be necessary for the partners of patients, as close contact and sexual intercourse in the early stages of the disease pose a hypothetical risk for transmission (infectious RABV is present in saliva); however, no reports have clearly established human-to-human transmission. People exposed to the same biting animal should be identified and should receive adequate PEP. The pathobiology and epidemiology of RABV indicate that the risk of an infant contracting rabies from breastmilk is similar to that of drinking milk from a rabid animal: it does not pose a relevant public health risk (see section 8.3.2). WHO_TRS_inside_final_2018_after_Corr_round5.indd 42 24/04/2018 20:50 Management of patients before and after death 43 6.4 Survivors of rabies and “aggressive” treatment protocols Survival has been well-documented in at least 15 cases (9). In all but one case, the survivors received one or more doses of rabies vaccine before the onset of clinical rabies. Survivors of rabies have an immune response associated with development of neutralizing anti-RABV antibodies in the serum and CSF. Current “aggressive” protocols, such as the Milwaukee protocol (11), do not reliably result in survival without severe sequelae. In exceptional cases, aggressive management may be considered. It should be undertaken in reference centres with well-trained teams who have experience or have conferred with experts in managing patients with rabies, using ethically pre-accepted protocols, after discussion with the family and a collegial decision, and only after other life- threatening but curable diseases (differential diagnoses for rabies encephalitis) have been ruled out. 6.4.1 Intensive care (symptomatic treatment) The first documented survivor of rabies, reported in 1969, received only intensive care without intubation (10). Since successful treatment in 2004 of an adolescent in the USA, a treatment approach known as the Milwaukee protocol (11) has been used several times, with no well-documented success to date (12). In the past few years, six well-documented cases of survival (albeit with severe neurological deficits) have been reported in India (13, 14), and survival for several weeks after the onset of symptoms is increasingly being documented. This may be attributed to greater awareness of rabies and better access to critical care facilities in countries endemic for rabies. An aggressive clinical management approach is associated, however, with a high risk of failure and is difficult to apply, especially in resource-limited settings. Therefore, only a small minority of patients with rabies who remain alert or have a mildly depressed sensorium may be considered candidates for an aggressive approach. Whether it can be applied is determined essentially by timely access to adequate resources, including critical care facilities and a competent team (3). Several patients who had early development of serum and CSF antibodies but no demonstrable virus or viral RNA (suggesting the virus had been cleared from the system) survived after receiving intensive care but remained in a vegetative state. These factors are, however, highly unreliable for predicting outcome (1, 15). In considering use of a possible “aggressive” treatment modality for a patient with rabies, the following should be kept in mind (1): ■ Rabies is almost invariably fatal, but a very small number of people have recovered, albeit with severe sequelae in the majority of cases, which will probably have a terrible, long-lasting impact on the pa- tients and their families and carers. WHO_TRS_inside_final_2018_after_Corr_round5.indd 43 24/04/2018 20:50 44 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report ■ Most survivors, with or without treatment, had a vigorous early im- mune response. Although cases due to bat virus more frequently developed antibodies in serum and/or CSF, this was not the true in dog-mediated rabies cases. Most of the cases due to bat virus did not survive. ■ At present, it is not possible to predict reliably which patients are likely to recover. ■ Carefully planned and validated studies conducted in an ethical man- ner to identify management protocols, procedures for immunomod- ulation and new medications, including antiviral drugs, are encour- aged. ■ Treatment of human rabies must be reasonably considered to be safe and not further harm the patient. 6.4.2 Rabies-specific treatment Agents that promote the entry of drugs, antibodies and immune effector cells across the blood–brain and blood–spinal cord barriers, which remain intact during the non-comatose phase (1), and agents that clear virus from non-neural organs (especially the heart) may be useful. Research is under way on antiviral agents that are effective against rabies, but they must be proven to be reasonably safe and not cause further harm (17–19). An approved drug for use in humans against RNA virus infections in general has become available and may be of benefit in some cases of rabies (20, 21). In any event, salvage treatment protocols should be delineated and submitted to ethical boards for approval before clinical teams use them in patients. 6.5 Management of the bodies of patients who have died of rabies The body of a patient suspected to have died of rabies should be labelled as infectious but not as “contagious” (no airborne or droplet transmission). The risk of transmission to others is extremely low if standard precautions are observed (22). Blood does not contain RABV, but the virus is present in many other tissues and fluids, such as those of the central nervous system and salivary glands (1). If embalming or autopsy is performed, it should be undertaken carefully, with appropriate precautions and personal protective equipment. Tissues and body fluids should be disposed of in the same manner as for other infectious diseases. The body of the deceased should be allowed to be buried or cremated, depending on their religious practice. WHO_TRS_inside_final_2018_after_Corr_round5.indd 44 24/04/2018 20:50 Management of patients before and after death 45 6.6 Transmission via organ transplantation RABV is present in many tissues in the terminal stages of disease, and caution should be exercised before transplanting organs from people who have died with neurological symptoms and signs of rabies. Several cases of rabies due to organ and tissue transplantation have been documented (23–25). Testing for common or highly fatal infections should be balanced against the urgency of transplanting a viable organ. Corneal transplantation, which is common in developing countries, should not be performed without ruling out whether the deceased could have died from rabies. 6.7 References 1. Hemachudha T, Ugolini G, Wacharapluesadee S, Sungkarat W, Shuangshoti S, Laothamatas J. Human rabies: neuropathogenesis, diagnosis, and management. Lancet Neurol. 2013;12(5):498–513. 2. Wilde H, Hemachudha T, Jackson AC. Viewpoint: management of human rabies. Trans R Soc Trop Med Hyg. 2008;102(10):979–82. 3. Jackson AC, Warrell MJ, Rupprecht CE, Ertl HC, Dietzschold B, O’Reilly M et al. Management of rabies in humans. Clin Infect Dis. 2003;36(1):60– 3. 4. Tarantola A, Crabol Y, Mahendra BJ, In S, Barennes H, Bourhy H et al. Caring for patients with rabies in developing countries – the neglected importance of palliative care. Trop Med Int Health. 2016;21(4):564–7. 5. Lindqvist O, Lunquist G, Dickman A, Bükki J, Lunder U, Hagelin CL et al. Four essential drugs needed for quality care of the dying: a Delphi- study based international expert consensus opinion. J Palliat Med. 2013;16(1):38–43. 6. Planning and implementing palliative care services: a guide for programme managers. Geneva: World Health Organization; 2016. 7. Daher ED, Júnior S, Ferreira MT, Barros FA, Gurgel TM, Patrocínio RM. Renal involvement in human rabies: clinical manifestations and autopsy findings of nine cases from northeast of Brazil. Rev Inst Med Trop Sao Paulo. 2005;47(6):315–20. 8. Marsden SC, Cabanban CR. Rabies: a significant palliative care issue. Prog Palliat Care. 2006;14(2):62–7. WHO_TRS_inside_final_2018_after_Corr_round5.indd 45 24/04/2018 20:50 46 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 9. Jackson AC. Human rabies: a 2016 update. Curr Infect Dis Rep. 2016;18(11):38. 10. Hattwick MA, Weis TT, Stechschulte, Baer GM, Gregg MB. Recovery from rabies: a case report. Ann Int Med. 1972;76(6):931–42. 11. Willoughby RE Jr, Tieves KS, Hoffman GM, Ghanayem NS, Amlie- Lefond CM, Schwabe MJ et al. Survival after treatment of rabies with induction of coma. N Engl J Med. 2005;352(24):2508–14. 12. Zeiler FA, Jackson AC. Critical appraisal of the Milwaukee protocol for rabies: this failed approach should be abandoned. Can J Neurol Sci. 2016;43(1):44–51. 13. Mani RS, Anand AM, Madhusudana SN. Human rabies in India: an audit from a rabies diagnostic laboratory. Trop Med Int Health. 2016;21(4):556–63. 14. Subramaniam R. Human rabies survivors in India: an emerging paradox?. PLoS Negl Trop Dis. 2016;10(7):e0004774. 15. Feder HM, Petersen BW, Robertson KL, Rupprecht CE. Rabies: still a uniformly fatal disease? Historical occurrence, epidemiological trends, and paradigm shifts. Curr Infect Dis Rep. 2012;14(4):408–22. 16. Tarantola A, Goutard F, Newton P, De Lamballerie X, Lortholary O, Cappelle J et al. Estimating the burden of Japanese encephalitis virus and other encephalitides in countries of the Mekong region. PLoS Negl Trop Dis. 2014;8(1):e2533. 17. Assenberg R, Delmas O, Morin B, Graham SC, De Lamballerie X, Laubert C et al. Genomics and structure/function studies of Rhabdoviridae proteins involved in replication and transcription. Antiviral Res. 2010;87(2):149–61. 18. Dacheux L, Delmas O, Bourhy H. Human rabies encephalitis prevention and treatment: progress since Pasteur’s discovery. Infect Disord Drug Targets. 2011;11(3):251–99. 19. Appolinario CM, Jackson AC. Antiviral therapy for human rabies. Antivir Ther. 2015;20(1):1. 20. Virojanapirom P, Lumlertdacha B, Wipattanakitchareon A, Hemachudha T. T-705 as a potential therapeutic agent for rabies. J Infect Dis. 2016;214(3):502–3. WHO_TRS_inside_final_2018_after_Corr_round5.indd 46 24/04/2018 20:50 Vaccines and rabies immunoglobulin for humans 47 21. Yamada K, Noguchi K, Komeno T, Furuta Y, Nishizono A. Efficacy of favipiravir (T-705) in rabies postexposure prophylaxis. J Infect Dis. 2015;213(8):1253–61. 22. Siegel JD, Rhinehart E, Jackson M, Chiarello L. 2007 guideline for isolation precautions: preventing transmission of infectious agents in health care settings. Am J Infect Control. 2007;35(10):S65–164. 23. Srinivasan A, Burton EC, Kuehnert MJ, Rupprecht C, Sutker WL, Ksiazek TG et al. Transmission of rabies virus from an organ donor to four transplant recipients. N Engl J Med. 2005;352(11):1103–11. 24. Maier T, Schwarting A, Mauer D, Ross RS, Martens A, Kliem V et al. Management and outcomes after multiple corneal and solid organ transplantations from a donor infected with rabies virus. Clin Infect Dis. 2010;50(8):1112–9. 25. Ross RS, Wolters B, Hoffmann B, Geue L, Viazov S, Grüner N et al. Instructive even after a decade: complete results of initial virological diagnostics and re-evaluation of molecular data in the German rabies virus “outbreak” caused by transplantations. Int J Med Microbiol. 2015;305(7):636–43. 7. Vaccines and rabies immunoglobulins for humans Since their development more than four decades ago, concentrated, purified cell culture and embryonated egg-based rabies vaccines (jointly referred to as CCEEVs) have proved to be safe and effective in preventing rabies. These vaccines are intended for both PrEP and PEP and have been administered to millions of people worldwide (1). Prompt administration of CCEEVs after exposure, combined with proper wound management and simultaneous administration of rabies immunoglobulins where indicated, is almost invariably effective in preventing rabies, even after high-risk exposure (1) (see section 8). 7.1 Vaccine types Human rabies vaccines include: ■ cell culture vaccines: purified chicken embryo vaccine, purified Vero cell rabies vaccine and human diploid cell vaccine (see section 7.1.1); ■ duck embryo vaccine (see section 7.1.1); and WHO_TRS_inside_final_2018_after_Corr_round5.indd 47 24/04/2018 20:50 48 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report ■ nerve tissue vaccines (see section 7.1.2). WHO recommends discon- tinuation of nerve tissue vaccines, because they induce severe adverse reactions and are less immunogenic than other vaccines Currently, three human rabies vaccines are WHO prequalified: Rabavert® and Rabipur® produced by GSK and Verorab® (cell culture vaccine) produced by Sanofi Pasteur. Two additional rabies vaccines are being assessed for WHO prequalification. 7.1.1 Rabies vaccines based on cell culture and embryonated eggs CCEEVs are produced by propagating RABV in cell substrates such as human diploid cells, Vero cells, primary chick or duck embryo cells or embryonated duck eggs. Annex 3 gives an overview of currently available human rabies vaccines and their producers. After growth in cell culture (or embryonic egg), the viral harvest is concentrated, purified, inactivated and lyophilized. In some CCEEVs, human albumin or processed gelatine is used as a stabilizer. Human rabies vaccines are not supplied in multidose vials for intramuscular or intradermal injection, and those prequalified by WHO do not contain preservatives such as thiomersal. The shelf-life of these vaccines is ≥ 3 years, provided they are stored at 2–8 °C and protected from sunlight. After reconstitution with sterile diluent, the vaccines should be used immediately or within 6 h if kept at + 2–8 ºC (2), as partially used vials of rabies vaccine may become contaminated. Rabies vaccines for humans should meet WHO recommendations for characterization, production and control, as set out by the WHO Expert Committee on Biological Standardization (3). The current WHO recommendations apply only to inactivated rabies vaccines produced in cell culture or embryonated eggs. 7.1.2 Nerve tissue vaccines Nerve tissue vaccines induce more severe adverse reactions and are less immunogenic than CCEEVs. WHO strongly recommends discontinuation of the production and use of nerve tissue vaccines and their replacement by CCEEVs. Nerve tissue vaccines are now produced for human use only in Algeria, Argentina, Bolivia and Ethiopia. The Consultation again strongly recommends that production and administration of vaccines based on animal central nervous systems, including suckling mouse brain, be discontinued and replaced by CCEEVs. A four-step strategy for replacing nervous tissue vaccine by modern rabies vaccines produced on cell culture or embryonated eggs has been prepared (4) and is attached as Annex 4 to this report. WHO_TRS_inside_final_2018_after_Corr_round5.indd 48 24/04/2018 20:50 Vaccines and rabies immunoglobulin for humans 49 7.2 WHO prequalification of human rabies vaccines Vaccines supplied through United Nations agencies should be prequalified by WHO. Prequalification ensures the quality, safety and efficacy of vaccines and their suitability for use in national immunization programmes in low- and middle-income countries. Prequalification is an established procedure, initiated voluntarily by vaccine manufacturers, for initial and continuous evaluation by WHO of nationally licensed vaccines. After initial prequalification, products are reassessed at regular intervals to ensure continuing quality. A vaccine must be licensed in its country of manufacture as a prerequisite to prequalification. The vaccine characteristics must be suitable for use in national immunization programmes with regard to potency, thermostability, presentation, labelling and cold chain volume. The producer must also meet international standards of quality and good manufacturing practice. Prequalification involves a review of the production process and quality control procedures, testing the consistency of lots, a WHO audit of the manufacturing facilities with observers from the responsible national regulatory authority, assurance of continued acceptability and reassessment at regular intervals. Continued compliance is monitored. Three rabies vaccines are prequalified for intramuscular use: purified Vero cell rabies vaccine, purified chick embryo cell vaccine and purified duck embryo vaccine. A list of WHO prequalified vaccines is available online (https:// extranet.who.int/gavi/PQ_Web/). The Consultation encourages rabies vaccine manufacturers to enter the WHO prequalification process and Member States to purchase WHO prequalified vaccines. 7.3 Requirements for human rabies vaccines 7.3.1 Potency requirements, tests and standards The minimal acceptable potency of CCEEVs is 2.5 IU per intramuscular dose, as determined in the mouse protection potency test (5). Work is under way on alternative assays based on serum neutralization (6, 7–9) and assays based on fewer animals (10), peripheral challenge (11) and others (12). The efficacy of these alternative tests should be established in multicentre studies conducted by WHO collaborating centres, national regulatory authorities and control laboratories, in collaboration with manufacturers. There is currently no evidence that the recommendation of a potency of 2.5 IU per intramuscular dose and a volume of 0.1 mL per intradermal dose (corresponding to a potency of ≥ 0.25 IU per dose) (see sections 9.3.3 and 9.3.4) should be revised. Standards for vaccines and immunoglobulins can be found at: http://www.nibsc.org/search.aspx?cx=004532883405257870201:nbpiibbtndm&c of=FORID%3A10&ie=UTF-8&q=rabies&sa=Search&filter=0. WHO_TRS_inside_final_2018_after_Corr_round5.indd 49 24/04/2018 20:50 50 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report The international standard for rabies vaccine is used in standardizing the mouse protection test and in vitro assays for G protein content. In 2008, a candidate vaccine was calibrated against the fifth international standard in a collaborative study and became the sixth international standard for rabies vaccine. When used in mouse protection tests, this standard contains 8 IU per ampoule, i.e. 8 IU/mL, when reconstituted in 1 mL of distilled water. Other units are used in in vitro assays, such as enzyme immunoassays and single radial immunodiffusion tests, to determine the RABV G protein antigen content (13). 7.3.2 Characterization and evaluation of rabies vaccines More than a dozen species or genotypes of Lyssavirus have been described as causative agents of rabies (see section 3). Lyssavirus genomes vary considerably, RABV being by far the most common causative virus for human rabies and the only virus used to date in vaccines. Current vaccines may not protect against lyssaviruses other than those in phylogroup I (see section 3). The virus strains used in vaccines should be carefully selected, and the antigenic identity of the virus strains and the identity and purity of the cell lines used for production should be evaluated periodically. Comprehensive genetic characterization by full genome sequencing of vaccine virus strains is recommended. General principles for nonclinical and clinical evaluation of inactivated rabies vaccines have been published by WHO (3). Preclinical testing is a prerequisite for the initiation of clinical trials in humans and includes immunogenicity studies (proof of concept) and safety testing in animals. Clinical development of rabies vaccines should include evaluation of their use for PrEP and PEP, with various vaccination schedules and routes of administration, the onset, extent and duration of protection and the requirement for and timing of booster vaccination. Clinical trials should adhere to the principles described in WHO guidelines for good clinical practice (14) and to those for the design, conduct and analysis of vaccine clinical trials, described in WHO guidelines for clinical evaluation of vaccines (3). All clinical trials should be approved by the relevant national regulatory authority. 7.4 Routes of vaccine administration Current rabies vaccines are produced as individual doses for intramuscular injection. CCEEVs reconstituted with 0.5 or 1 mL of diluent in one intramuscular dose vial with a potency of ≥ 2.5 IU per dose can be used for both PrEP and PEP. The cost of cell culture-based vaccines for intramuscular administration limits their widespread use in many areas where rabies is present. WHO promotes the use of intradermal administration of these vaccines as a safe, immunogenic and cost- and dose-sparing alternative to intramuscular administration. Only one or two vials of vaccine are required to complete a full course of PEP by the WHO_TRS_inside_final_2018_after_Corr_round5.indd 50 24/04/2018 20:50 Vaccines and rabies immunoglobulin for humans 51 intradermal route, thereby reducing the volume used and the direct cost of vaccine by 60–80% in comparison with standard intramuscular injection (15). There is no evidence that vaccines administered intradermally are more potent than those recommended for intramuscular administration (16). Intradermal vaccination results in an equivalent immune response at a lower dose, thus sparing vaccine in PrEP and PEP. Appropriate training should be given to ensure full intradermal instillation of the vaccine and to avoid accidental subcutaneous injection. Both routes induce rapid recall responses upon booster immunization. Once opened, vials should be stored at +2 ºC to a maximum of + 8 ºC for no longer than 6–8 h. Rather than discarding vaccine after this time, any remaining vaccine in a vial could be used for PrEP, particularly for professionals active in animal disease control or for staff at health facilities who regularly attend to clinical rabies patients (see section 8.2). Scheduling follow-up PrEP visits for patients within similar periods may help to minimize wastage. Nevertheless, intradermal administration remains cost–effective in all cases for both PrEP and PEP (15). Vaccine manufacturers should provide clinical evidence that new products are also immunogenic, effective and safe when given intradermally and include suitability for intradermal vaccination on the product label. The administration should adhere to WHO guidance for all routes specified and to standards approved by national health authorities. In particular, the vaccine should be compared with a vaccine of known immunogenicity, efficacy and safety, be tested serologically with a FAVN test (see section 5) and the results published in an international, peer-reviewed journal. In countries in which intradermal administration is an approved route for PrEP or PEP, manufacturers of vaccines proven to be safe and effective when given by this route should register their product for intradermal use and state in the product insert that their vaccine can be used intradermally. Countries are encouraged to make national regulatory amendments to allow cost-saving intradermal administration of rabies vaccines. 7.5 Adverse events after active immunization In general, CCEEVs are safe and well tolerated. Adverse events may occur, however, depending in part on the purity of the inactivated RABV, which may vary among batches (17). In 35–45% of vaccinated people, minor, transient erythema, pain or swelling occurs at the site of injection, particularly after intradermal administration of a booster. Mild systemic adverse events, such as transient fever, headache, dizziness and gastrointestinal symptoms, have been observed in 5–15% of vaccinated people. Serious adverse events are rare; they include Guillen-Barré syndrome and allergic reactions (18). WHO_TRS_inside_final_2018_after_Corr_round5.indd 51 24/04/2018 20:50 52 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report True vaccine failures are extremely rare when high-quality CCEEVs are used in conjunction with prompt, proper wound care, adherence to the cold chain and compliance with vaccination schedules. Delay in seeking treatment, improper wound care, unnoticed wounds, direct nerve inoculation and lack of patient compliance with vaccination schedules, among other factors (e.g. vaccine and cold chain quality), may, however, contribute to treatment failure and subsequent death (19). Treatment failure and death have also been reported after use of non- WHO prequalified vaccines and vaccines that do not have their stated efficacy (i.e. “fake” vaccines). 7.6 Duration of immunity CCEEVs establish immunological memory that is assumed to persist for the life of the individual, even after titres of neutralizing antibodies decrease or are no longer measurable. Clinical data confirm that vaccinated people respond to booster immunization within 7 days (20–22), even if the initial course of PrEP or PEP was administered decades previously and regardless of the route of priming or booster immunization (intramuscular or intradermal) and the presence or absence of detectable titres of RABV-specific antibodies at the time of the booster. In addition, published data indicate that periodic booster doses of vaccine are not required after primary rabies vaccination (23), except as an additional precaution for people whose occupation puts them at continual or frequent risk of exposure (see section 8.2). Nevertheless, all vaccinated individuals subsequently exposed to rabies, according to the WHO definition of exposure, should receive an abbreviated course of PEP, as specified in section 8. 7.7 Failure of rabies vaccine and of full post-exposure prophylaxis Failure of PEP, that is, when a patient dies despite having received the correct protocol in a timely manner, are extremely rare among the estimated 20 million people who receive PEP each year. The few PEP failures that have been reported all occurred in developing countries and almost all involved one or more deviations from the WHO-recommended prophylaxis protocol (19). The main deviations from the recommended protocol that lead to death are: delay in seeking rabies prophylaxis; lack of or improper administration of rabies immunoglobulin (e.g. failure to inject all bite sites); lack of or improper primary wound care; and/or poor-quality rabies vaccine (24). 7.8 Rabies immunoglobulins People with category III exposure who have not received at least two doses of PrEP or PEP and severely immunocompromised people with category II exposure (e.g. AIDS patients or transplant recipients) should receive WHO_TRS_inside_final_2018_after_Corr_round5.indd 52 24/04/2018 20:50 Vaccines and rabies immunoglobulin for humans 53 both an effective rabies vaccine and rabies immunoglobulin (25, 26). Rabies immunoglobulins should preferably be administered into and around the wound site to neutralize the RABV still present therein (see section 8.4). Three classes of biological product are available for passive immunization: human rabies immunoglobulin, equine rabies immunoglobulin and highly purified F(ab´)2 fragments produced from equine immunoglobulin (27). Patients with open wounds from suspected or proven rabid animals should receive passive immunization as specified in section 8. Annex 5 gives an overview of currently available rabies immunoglobulin products and their producers. Rabies immunoglobulin should be given with the first dose of vaccine into and around the wound site. Scrupulous wound cleaning and deep irrigation, with application of a potent antiseptic agent, and timely administration of the first CCEEV dose are key factors in increasing survival where RIG is unavailable and should be performed immediately when the patient presents. Human immunoglobulin should be given at a maximum dose of 20 IU/kg of body weight and equine immunoglobulin at 40 IU/kg of body weight. Equine immunoglobulin is considerably less expensive than the human product, and most of the new equine preparations are potent, highly purified and safe, with few adverse events. Serum sickness can occur 1 week after administration of highly purified equine rabies immunoglobulin in < 1–3% of recipients. The risk for anaphylactic reaction is low (1/150 000), and the reaction is generally treatable. Skin tests are not recommended before administration of equine RIG, as such tests poorly predict severe adverse events and their results should not be the basis for not giving equine immunoglobulin if it is needed. Equine immunoglobulin should be administered under conditions that would allow management of an anaphylactic reaction. RIGs are in short supply throughout the world. New technology may lead to use of mAbs in PEP. WHO has recommended use of mAb “cocktails” containing at least two antibodies against RABV, as alternatives for RIGs in PEP (28). Several human mAbs have been tested against rabies. The first (a single mAb) was recently licensed by the Serum Institute of India (29). Studies so far show the equivalence of its performance to human RIG. The availability of this mAb could fill critical public health gaps. As it is made by recombinant technology, it will be less prone to problems such as availability, safety and purity. It should be recommended for use in public health programmes, depending on the epidemiological and geographical setting, with monitoring of its safety and efficacy (clinical outcomes) during post-marketing use. The second international standard preparation of human immunoglobulin is held and distributed on request by the WHO International Laboratory for Biological Standards at the National Institute for Biological Standards and Control, Potters Bar, Hertfordshire, United Kingdom (13). The current WHO reference serum for standardization contains 30 IU per ampoule. WHO_TRS_inside_final_2018_after_Corr_round5.indd 53 24/04/2018 20:50 54 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 7.9 References 1. Rabies vaccines: WHO position paper – recommendations. Vaccine. 2010;28(44):7140–2. 2. WHO policy statement: multi-dose vial policy (MDVP) – revision 2014. Geneva: World Health Organization; 2014 (Report No. WHO/ IVB/14.07). 3. WHO Expert Committee on Biological Standardization: Sixty-third Report. Geneva: World Health Organization; 2013 (WHO Technical Report Series No. 980). 4. Human and dog rabies prevention and control: report of the WHO/Bill & Melinda Gates Foundation consultation, Annecy, France, 7–9 October 2009. Geneva: World Health Organization; 2010 (http://apps.who.int/ iris/bitstream/10665/70253/1/WHO_HTM_NTD_NZD_2010.1_eng. pdf). 5. Servat A, Cliquet F. Mouse potency testing of rabies vaccines. In: Rupprecht C, Nagarajan T, editors. Current laboratory techniques in rabies diagnosis, research and prevention. Vol. 2. Cambridge (MA): Academic Press; 2015:269–79. 6. Kamphuis E, Krämer B, Schildger H, Duchow K. Potency testing of inactivated rabies vaccines using a serological method. Dev Biol (Basel). 2012;134:23–7. 7. Aavula SM, Abhinay G, Nimmagadda SV, Maithal K. A novel in vitro ELISA for estimation of glycoprotein content in human rabies vaccines. J Immunoassay Immunochem. 2017;38(4):400–10. 8. Chabaud-Riou M, Moreno N, Guinchard F, Nicolai MC, Niogret-Siohan E, Sève N et al. G-protein based ELISA as a potency test for rabies vaccines. Biologicals. 2017;46:124–9. 9. Morgeaux S, Poirier B, Ragan CI, Wilkinson D, Arabin U, Guinet-Morlot F et al. Replacement of in vivo human rabies vaccine potency testing by in vitro glycoprotein quantification using ELISA – Results of an international collaborative study. Vaccine. 2017;35(6):966–71. 10. de Moura WC, de Araujo HP, Cabello PH, Romijn PC, Leite JP. Potency evaluation of rabies vaccine for human use: the impact of the reduction in the number of animals per dilution. J Virol Methods. 2009;158(1– 2):84–92. WHO_TRS_inside_final_2018_after_Corr_round5.indd 54 24/04/2018 20:50 Vaccines and rabies immunoglobulin for humans 55 11. Wunderli PS, Dreesen DW, Miller TJ, Baer GM. The rabies peripheral challenge test: more accurate determination of vaccine potency. Vaccine. 2006;24(49–50):7115–23. 12. Stokes W, McFarland R, Kulpa-Eddy J, Gatewood D, Levis R, Halder M et al. Report on the international workshop on alternative methods for human and veterinary rabies vaccine testing: state of the science and planning the way forward. Biologicals. 2012;40(5):369–81. 13. National Institute of Biological Standards and Control. WHO international standard. Sixth international standard for rabies vaccine 2008. Potters Bar; 2013 (http://www.nibsc.org/documents/ifu/07-162. pdf). 14. WHO Expert Committee on the Use of Essential Drugs. Sixth report, Annex 3. Geneva: World Health Organization; 1995 (WHO Technical Report Series No. 850). 15. Hampson K, Cleaveland S, Briggs D. Evaluation of cost–effective strategies for rabies post-exposure vaccination in low-income countries. PLoS Negl Trop Dis. 2011;5(3):e982. 16. Sudarshan MK, Gangaboraiah B, Ravish HS, Narayana DH. Assessing the relationship between antigenicity and immunogenicity of human rabies vaccines when administered by intradermal route: results of a metaanalysis. Human Vaccines. 2010;6(7):562–5. 17. Finke S, Karger A, Freuling C, Müller T. Assessment of inactivated human rabies vaccines: biochemical characterization and genetic identification of virus strains. Vaccine. 2012;30(24):3603–9. 18. Grading of scientific evidence. Table III. Safety of cell-culture-based rabies vaccines. Geneva: World Health Organization; 2010 (http://www. who.int/immunization/rabies_grad_safety.pdf?ua=1). 19. Wilde H. Failures of post-exposure rabies prophylaxis. Vaccine. 2007;25(44):7605–9. 20. Cramer JP, Jelinek T, Paulke-Korinek M, Reisinger EC, Dieckmann S, Alberer M et al. One-year immunogenicity kinetics and safety of a purified chick embryo cell rabies vaccine and an inactivated Vero cell- derived Japanese encephalitis vaccine administered concomitantly according to a new, 1-week, accelerated primary series. J Travel Med. 2016;23(3). WHO_TRS_inside_final_2018_after_Corr_round5.indd 55 24/04/2018 20:50 56 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 21. Kessels JA, Recuenco S, Navarro-Vela AM, Deray R, Vigilato M, Ertl H et al. Pre-exposure rabies prophylaxis: a systematic review. Bull World Health Organ. 2017;95(3):210. 22. Jonker EF, Visser LG. Single visit rabies pre-exposure priming induces a robust anamnestic antibody response after simulated post-exposure vaccination: results of a dose-finding study. J Travel Med. 2017;24(5). 23. Strady A, Lang J, Lienard M, Blondeau C, Jaussaud R, Plotkin SA. Antibody persistence following preexposure regimens of cell-culture rabies vaccines: 10-year follow-up and proposal for a new booster policy. J Infect Dis. 1998;177(5):1290–5. 24. Rupprecht CE, Briggs D, Brown CM, Franka R, Katz SL, Kerr HD et al. Evidence for a 4-dose vaccine schedule for human rabies post- exposure prophylaxis in previously non-vaccinated individuals. Vaccine. 2009;27(51):7141–8. 25. WHO Guide for rabies pre and post exposure prophylaxis in humans. Geneva: World Health Organization; 2014 (http://www.who.int/rabies/ PEP_Prophylaxis_guideline_15_12_2014.pdf). 26. Wilde H, Khawplod P, Hemachudha T, Sitprija V. Postexposure treatment of rabies infection: can it be done without immunoglobulin? Clin Infect Dis. 2002:477–80. 27. Lang J, Attanath P, Quiambao B, Singhasivanon V, Chanthavanich P, Montalban C et al. Evaluation of the safety, immunogenicity, and pharmacokinetic profile of a new, highly purified, heat-treated equine rabies immunoglobulin, administered either alone or in association with a purified, Vero-cell rabies vaccine. Acta Trop. 1998;70(3):317–33. 28. WHO consultation on a rabies monoclonal antibody cocktail for rabies post exposure treatment. Geneva, WHO, 23–24 May 2002. Geneva: World Health Organization; 2002. 29. Gogtay NJ, Munshi R, Ashwath Narayana DH, Mahendra BJ, Kshirsagar V, Gunale B et al. Comparison of a novel human rabies monoclonal antibody to human rabies immunoglobulin for postexposure prophylaxis: a phase 2/3, randomized, single-blind, noninferiority, controlled study. Clin Infect Dis. 2017;66(3):387–95. WHO_TRS_inside_final_2018_after_Corr_round5.indd 56 24/04/2018 20:50 Prevention of human rabies 57 8. Prevention of human rabies Rabies is almost always fatal, but it can be prevented by vaccination before and/or after suspected or proven exposure to the virus. The composition and use of rabies vaccines and immunoglobulins used for prophylaxis should comply with WHO recommendations for production and control and for immunogenicity and safety when given by either the intramuscular or the intradermal route (section 7 and 8.3.4). 8.1 General considerations PrEP is strongly recommended for people who are at high risk of exposure to RABV and other lyssaviruses because of their professional or other activities and, in special cases, because of their residence in a remote area. In travel medicine, PrEP is recommended only for people travelling to remote areas where timely access to adequate PEP cannot be guaranteed or if the individual is at high risk of contact with wild animals, particularly bats (see section 8.7). After exposure to RABV, PEP, i.e. prompt use of rabies vaccine with proper wound washing and management and simultaneous administration of RIG, when indicated, is almost 100% effective in preventing rabies, even if the exposure was severe. When exposure is to an animal that is suspected, probably or confirmed to be rabid (see section 11) or when there is doubt about the factors that led to the exposure, PEP should be initiated and medical advice sought, if available. Vaccines can be administered intradermally or intramuscularly. Rabies vaccines labelled for intramuscular use can be used safely via the intradermal route, even if this constitutes off-label use. For intradermal administration, the recommended sites include the deltoids, lateral thighs or suprascapular areas that drain into regional lymph glands (see annexes 6 and 7). For intramuscular administration, the vaccine should be injected into the deltoid muscle for adults and children aged ≥ 2 years; for children aged < 2 years, the anterolateral thigh is recommended (see Annex 7). Rabies vaccine should not be administered in the gluteal area, as induction of an adequate immune response is less reliable. The site is selected on the basis of the degree of privacy that can be provided and sociocultural acceptance. One intradermal dose is 0.1 mL of vaccine, and one intramuscular dose is an entire vial of vaccine, irrespective of the vial size. Day 0 is the date of administration of the first dose. As far as possible, vaccination schedules should be completed in the stipulated time; however, there is no need to restart the series if the doses are not given on the exact schedule, as variations of a few days are unlikely to affect the response to vaccination. Rabies vaccines and RIG can be used during pregnancy and lactation. WHO_TRS_inside_final_2018_after_Corr_round5.indd 57 24/04/2018 20:50 58 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 8.2 Pre-exposure prophylaxis PrEP is recommended for individuals who are at high risk of exposure to rabies or to bat lyssavirus because of their occupation, travel (see section 8.8) or residence in an endemic setting with limited access to timely, adequate PEP. PrEP obviates administration of RIG after a bite. Vaccine-induced immunological memory is probably life-long if PEP is given after exposure. Published data indicate that periodic booster doses of vaccine are not required after primary rabies vaccination, except as an additional precaution for people whose occupation puts them at continual or frequent risk of exposure (see section 8.2.1). Table 6 provides an overview of WHO-recommended PrEP regimens. To save cost, intradermal PrEP should be given to enough individuals in the same session so that opened vials are used within 6–8 h. There is evidence to support single-day priming vaccination for healthy people aged 5–47 years, by either a two-site intradermal or a one-dose intramuscular vaccination on day 0 (6–9). The single day pre-exposure vaccination should be considered only when time does not permit the two-visit PrEP and before travel to areas with ready access to rabies vaccines in the event of exposure; the second dose should be administered upon return or as soon as possible. In case of exposure before the second dose, a full PEP should be administered. There is no evidence that single-day priming is adequate for inducing long-term immunity (> 1 year). Table 6 WHO-recommended and alternative pre-exposure prophylactic regimens PrEP regimen Duration of course Number of injection sites per clinic visit (days 0, 3, 7, 14, 21–28) References WHO-recommended intradermal regimen Two visits 7 days 2-0-2-0-0 1–4 WHO-recommended intramuscular regimen Two visits 7 days 1-0-1-0-0 5 PrEP under specific circumstances Single visit, intradermal 1 day 2-0-0-0-0 6–9 Single visit, intramuscular 1 day 1-0-0-0-0 6–9 WHO_TRS_inside_final_2018_after_Corr_round5.indd 58 24/04/2018 20:50 Prevention of human rabies 59 Generally, no effective immune response is to be expected in the first 7 days after the first vaccine dose. Therefore, people exposed to rabies during those days should receive a full course of PEP, including RIG (for category III exposure). People who discontinued a PEP series after administrations of at least two doses of vaccine should be considered to be vaccinated before exposure. 8.2.1 Recommendations for occupational and programmatic PrEP administration The risk of infection with RABV depends on the nature of the exposure, the epidemiological setting and the accessibility of biologicals for PEP. PrEP is indicated for individuals who are at risk of occupational exposure, particularly animal health care workers; medical professionals who regularly provide care to people with rabies can consider PrEP. Individuals who work in laboratories with high concentrations of live RABV or lyssavirus should be tested for antibodies every 1–2 years to monitor the levels in order to ensure adequate immune response in case of a detected, unnoticed exposure and to apply risk mitigating measures. The laboratory supervisor or the employer is responsible for assessing the relative risk of exposure and for undertaking extra monitoring of the immunity of laboratory workers. Serological testing and booster vaccination are recommended only if the risk of exposure to RABV continues. If serological testing is not available, a routine booster vaccination before assignment to an at- risk work position might be considered; however, periodic booster injections are recommended as an added precaution only for people whose occupation places them at continual or frequent risk of exposure; antibody monitoring, if available, is preferred. Professionals who are not at continual risk of exposure, such as certain veterinarians and animal health officers, should undergo serological monitoring every 2 years. As vaccine-induced immunity persists in most cases for decades, booster vaccination would be recommended only if RABV neutralizing antibody titres fall to < 0.5 IU/mL. PrEP for entire populations is not cost–effective in most settings and is therefore not recommended; however, widescale PrEP should be considered in remote settings with limited access to PEP if the annual dog bite incidence is > 5% or if exposure to vampire bats is prevalent. The decision should be based on strong epidemiological evidence and the local context. PrEP should not divert attention from essential mass dog vaccination campaigns to control the disease at its source (see section 9). Booster doses of rabies vaccines are not necessary for people living in or travelling to high-risk areas who have received a primary series of PrEP or PEP. 8.2.2 PrEP for immunocompromised people People with documented immunodeficiency should be evaluated individually. Immunodeficient patients should receive an intradermal or intramuscular PrEP WHO_TRS_inside_final_2018_after_Corr_round5.indd 59 24/04/2018 20:50 60 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report regimen as shown in Table 6, plus a third administration of vaccine on days 21–28. Immunodeficient patients who are clinically monitored and well managed, such as HIV-infected people receiving antiretroviral therapy, are considered not to be immunocompromised and have been shown to respond to rabies and other vaccines in the same way as healthy individuals (10). In the event of exposure, a complete PEP course, including RIG, is recommended. 8.3 Post-exposure prophylaxis People with WHO category II or III exposures (see section 8.3.1 and Annex 8) should receive PEP without delay as an emergency procedure. PEP consists of the following steps. ■ All bite wounds and scratches should be attended to as soon as possible after exposure; thorough washing and flushing of the wound for ap- proximately 15 min with soap and copious amounts of water is required. When available, a viricidal topical preparation should be applied to the wound. Application of local remedies is strongly discouraged. ■ RIG should be administered for category III exposures. Wounds that require suturing should be sutured loosely and only after RIG infiltra- tion into the wound, in addition to proper wound care and tetanus boosters, if applicable. ■ A series of potent, effective rabies vaccines that meet WHO recom- mendations (see section 8.3.4) should be administered promptly after exposure. 8.3.1 Evaluation of suspected exposure to RABV Categories of exposure and PEP (see also Annex 8) In countries or areas enzootic for rabies, exposure to suspected, probably or confirmed rabid domestic or wild animals is categorized as follows: ■ category I: touching or feeding an animal or licks on intact skin: no exposure; PEP not indicated; ■ category II: nibbling of uncovered skin, minor scratches or abrasions without bleeding: exposure; PEP indicated with vaccine; to be treated as category III if exposure was to a bat; and ■ category III: single or multiple transdermal bites or scratches, con- tamination of mucous membranes with saliva from licks, licks on broken skin, exposure due to direct contact with bats: severe expo- sure; PEP indicated with vaccine and RIG. WHO_TRS_inside_final_2018_after_Corr_round5.indd 60 24/04/2018 20:50 Prevention of human rabies 61 For categories II and III exposures, thorough local wound treatment (see section 8.3.1) is of paramount importance. The incubation period of the majority of cases is 2–3 months, while 2–3% of cases have had an incubation period > 1 year, with an exceptional case of 8 years (11, 12). Therefore, when the supply of biologics is limited, it may be reserved for suspected and probable exposure within the past 12 months. In the case of exposure to an animal confirmed to be rabid, rabies vaccine should be provided regardless of the time since exposure, even if the exposure is reported years afterwards. Risk assessment of potential exposure to RABV Bites, licks, and scratches, particularly from dogs, are extremely common, and the reported annual bite incidence is 0.1–5% globally (13–15). Even in settings endemic for dog-mediated rabies, most exposure to domestic animals is not to rabid animals (16), although the proportion varies by setting and is underreported. The rates of exposure to RABV among people who seek medical care may be influenced by cultural health-seeking behaviour, rabies surveillance capacity and local epidemiology; national rabies programmes should consider routine evaluation of rabies surveillance systems to improve understanding of the risk for rabies from biting animals. Determination of whether exposure to RABV has occurred should include consideration of factors such as: ■ the epidemiology of rabies in the country; ■ the severity of exposure (see section 8.3.1); ■ the species and clinical features of the animal (see definitions of ani- mal rabies in section 11); ■ the vaccination status of the animal (dogs and cats); ■ the animal’s availability for observation (dogs and cats); and ■ the results of laboratory testing. When possible, the risk presented by the animal should be assessed by trained personnel familiar with the clinical signs of rabies in animals (Table 7). Programmes with such integrated response mechanisms after reported exposure to animal rabies are referred to as “integrated bite case management” programmes (see section 11). They can improve the detection of individuals exposed to RABV, increase adherence to vaccination recommendations and reduce unnecessary administration of vaccine or RIG (16, 17). The risk that wildlife acting unusually have rabies may be high and should be evaluated with regard to suspected exposure in the context of the local epidemiology (18). WHO_TRS_inside_final_2018_after_Corr_round5.indd 61 24/04/2018 20:50 62 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Ta bl e 7 M at rix fo r d et er m in in g th e ris k fo r e xp os ur e to R AB V, b y t yp e of ex po su re an d th e ch ar ac te ris tic s o f t he d og 1 Ex po su re co ns id er a- tio n Pr ob - ab ili ty of d ea th ba se d on le ve l o f ex po su re In fo rm at io n co lle ct ed a t t im e of b ite Q ua ra nt in e or te st in g D og sy m pt o- m at ic D og d ea d at fo llo w - up D og b ite w as n ot pr ov ok ed St ra y do g D og b ite m ul tip le pe op le D og n ot va cc i- na te d D og he al th y an d av ai l- ab le f or qu ar an tin e D og he al th y 10 da ys p os t- bi te Te st ed ne ga tiv e Bi te to he ad /n ec k 45 .0 % H ig h H ig h H ig h H ig h H ig h H ig h Lo w N o ris k N o ris k M ul tip le se ve re b ite w ou nd s 27 .5 % H ig h H ig h H ig h H ig h M od er at e M od er at e Lo w N o ris k N o ris k Bi te s t o yo un g ch ild re n 27 .5 % H ig h H ig h H ig h H ig h M od er at e M od er at e Lo w N o ris k N o ris k Bi te s t o ex tre m iti es 5. 0% H ig h M od er at e M od er at e M od er at e M od er at e Lo w Lo w N o ris k N o ris k M in or bi te s ( no br ea k in sk in ) 1. 0% M od er at e M od er at e M od er at e M od er at e M od er at e Lo w Lo w N o ris k N o ris k Pr ob ab ili ty th e d og h as ra bi es 62 .2 % 39 .7 % 15 .0 % 13 .9 % 10 .6 % 4. 7% 0. 08 % 0. 0% 0. 0% So ur ce : r efe ren ce 19 , w ith pe rm iss ion 1 R isk es tim ate d a s t he pr od uc t o f t he pr ob ab ilit y t ha t t he do g h ad ra bie s a nd th e p ro ba bil ity th at, if it wa s r ab id , th e s ev er ity of ex po su re wo uld re su lt i n d ea th WHO_TRS_inside_final_2018_after_Corr_round5.indd 62 24/04/2018 20:50 Prevention of human rabies 63 Ta bl e 7 M at rix fo r d et er m in in g th e ris k fo r e xp os ur e to R AB V, b y t yp e of ex po su re an d th e ch ar ac te ris tic s o f t he d og 1 Ex po su re co ns id er a- tio n Pr ob - ab ili ty of d ea th ba se d on le ve l o f ex po su re In fo rm at io n co lle ct ed a t t im e of b ite Q ua ra nt in e or te st in g D og sy m pt o- m at ic D og d ea d at fo llo w - up D og b ite w as n ot pr ov ok ed St ra y do g D og b ite m ul tip le pe op le D og n ot va cc i- na te d D og he al th y an d av ai l- ab le f or qu ar an tin e D og he al th y 10 da ys p os t- bi te Te st ed ne ga tiv e Bi te to he ad /n ec k 45 .0 % H ig h H ig h H ig h H ig h H ig h H ig h Lo w N o ris k N o ris k M ul tip le se ve re b ite w ou nd s 27 .5 % H ig h H ig h H ig h H ig h M od er at e M od er at e Lo w N o ris k N o ris k Bi te s t o yo un g ch ild re n 27 .5 % H ig h H ig h H ig h H ig h M od er at e M od er at e Lo w N o ris k N o ris k Bi te s t o ex tre m iti es 5. 0% H ig h M od er at e M od er at e M od er at e M od er at e Lo w Lo w N o ris k N o ris k M in or bi te s ( no br ea k in sk in ) 1. 0% M od er at e M od er at e M od er at e M od er at e M od er at e Lo w Lo w N o ris k N o ris k Pr ob ab ili ty th e d og h as ra bi es 62 .2 % 39 .7 % 15 .0 % 13 .9 % 10 .6 % 4. 7% 0. 08 % 0. 0% 0. 0% So ur ce : r efe ren ce 19 , w ith pe rm iss ion 1 R isk es tim ate d a s t he pr od uc t o f t he pr ob ab ilit y t ha t t he do g h ad ra bie s a nd th e p ro ba bil ity th at, if it wa s r ab id , th e s ev er ity of ex po su re wo uld re su lt i n d ea th In addition to the criteria listed above, PEP may be indicated to alleviate the psychological burden of fear of rabies in animal-bite victims and their relatives. Animals to which humans were exposed that are not available for assessment or observation should be suspected of having rabies, and PEP should be instituted immediately. Exposure of the face or neck and exposure of young children may result in a shorter incubation period, and PEP should be administered immediately if the animal is considered likely to have rabies. People exposed to animals that conform to the definitions of animals suspected, probably or confirmed to be rabid should initiate PEP immediately. When possible, animals that conform to the definition of a suspected or probable case should be killed humanely and the body tested for rabies. If the laboratory tests are negative, PEP can be discontinued. People who have received at least two doses (intradermal or intramuscular) of a cell culture vaccine on an appropriate schedule before discontinuation should be considered as having received PrEP (see section 8.2). Generally, dogs, cats and domestic ferrets that are available for assessment, are deemed healthy by a trained professional and can be observed for 10 days represent a very low risk (20). If the animal does not conform to the definition of a suspected case and is available for observation, the wound should be thoroughly washed and the patient counselled on prevention of rabies, but PEP may be delayed during the observation period. If the animal dies, escapes or shows symptoms consistent with rabies during the observation period, PEP should be instituted immediately. PEP should be delayed only when an advanced surveillance programme is in place, in which trained professionals can assess animal rabies in a timely manner and there is reliable laboratory capacity (Table 8). When an animal has been identified as suspected, probably or confirmed to have rabies (see section 11), a retrospective risk assessment should be conducted immediately to identify everyone who may have been exposed to the same animal, and they should be given PEP. Dogs, cats and domestic ferrets should be considered infectious for the 10 days before onset of clinical signs and throughout their clinical illness (21, 22). The infectious periods of other animals are not well characterized, and a more conservative 14-day clinical investigation is recommended. A retrospective assessment should be conducted when a human rabies case is identified, and PEP should be administered to people who were exposed to the animal responsible for the human case, even months later. WHO_TRS_inside_final_2018_after_Corr_round5.indd 63 24/04/2018 20:50 64 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Table 8 Recommendations for rabies PEP on the basis of surveillance capacity Rabies surveillance programme Programme descrip- tion When to initiate PEP When to discon- tinue PEP No routine surveillance No trained professionals capable of assessing animals for rabies No laboratory capacity for timely testing of samples Initiate PEP immediately Do not discontinue PEP, unless a trained professional has confirmed that the animal is healthy 10 days after the bite Limited surveillance Trained professionals capable of assessing animals for rabies are available in some communities. Laboratory capacity exists, but testing and reporting may be delayed. Initiate PEP immediately Do not discontinue PEP, unless tests at a qualified laboratory give negative results. or A trained professional has confirmed that the animal is healthy 10 days after the bite. Advanced surveillance (i.e. integrated bite case management) Trained professionals capable of assessing animals for rabies are consistently and reliably available in the community in which the exposure occurred. Laboratory capacity exists and can reliably test samples and report results within several days of the bite. Initiate PEP immediately for bites to the head, neck, other highly innervated sites, multiple or deep wounds and for bites to children.a When the animal is available and determined by a trained professional to present a low risk, PEP may be delayed. Do not discontinue PEP, unless tests at a qualified laboratory give negative results. or A trained professional has confirmed that the animal is healthy 10 days after the bite. a Because of their small stature and higher risk of severe exposure, children should recive PEP immediately. PEP is generally not required for people who sustain animal bites, scratches and other contacts (except for contacts with bats) in an area free of terrestrial rabies, confirmed by adequate rabies surveillance; however, the decision should be based on a risk assessment conducted by a medical professional knowledgeable in the local epidemiology of rabies. The recommendations given here are a general guide; they can be adapted to each situation and setting, for instance when a reliable history of exposure cannot be obtained such as from an infant and in areas where rabies is enzootic WHO_TRS_inside_final_2018_after_Corr_round5.indd 64 24/04/2018 20:50 Prevention of human rabies 65 and follow-up observation of the biting animal and/or laboratory testing are not readily available. 8.3.2 Atypical routes of exposure Human-to-human transmission of rabies has not been confirmed, except in the case of transplants and a single case of probable perinatal transmission (23, 24). Therefore, a decision to provide PEP for people who have been exposed to people with rabies should take into consideration the low risk and should not jeopardize the supplies of vaccine or RIG for people with category II or III exposure to animals with suspected rabies (23). RABV can, however, be found in saliva, tears and nervous tissues of people with rabies, which represents a theoretical route of transmission. If category II or III exposure to infectious materials occurred during the infectious period, exposed people should be treated accordingly. Contact investigations should be conducted with medical professionals and other people who may have had close contact with the case. Examples of potential routes of human-to-human exposure include biting and mucosal exposure to infectious materials during medical procedures, kissing or intimate touching. No information is available on the risk of rabies transmission through breastfeeding, but pathobiology and epidemiology indicate that there is no relevant public health risk. Human rabies cases due to exposure to RABV other than through a bite are extremely rare. Rabies can, however, be transmitted by ingestion of experimentally infected animals; however, no human cases resulting from consumption of raw meat from a rabid animal have been documented (25, 26). It is not advisable to consume the meat from a rabid animal, particularly if it is raw. PEP should be considered for people who have a category II or III exposure (see section 8.3.1) due to processing of meat from a rabid animal. Infectious RABV has not been isolated from the milk of rabid cows, and no human rabies cases have been attributed to consumption of raw milk. Although drinking raw milk from a rabid animal is not advised, there is no evidence that this results in exposure to RABV, and PEP is not advised. Milk that has been pasteurized presents no risk for RABV transmission. Bites of wild animals, particularly monkeys, are normal when people feed them or handle their food and when the animal is threatened, cornered or trapped. These situations should be avoided to reduce unnecessary use of PEP. Rabies is very uncommon in rodents (27), and no human rabies cases due to bites by rodents have been reported. Rarely, rabies can be contracted by inhalation of virus-containing aerosols in laboratories in which materials that contain highly concentrated live RABV is handled or in caves with a high density of rabies-infected bats (28). Wild carnivore species and bats (Carnivora and Chiroptera) present a higher risk for rabies transmission than other wildlife, as they are the reservoirs of RABV (18). WHO_TRS_inside_final_2018_after_Corr_round5.indd 65 24/04/2018 20:50 66 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 8.3.3 Local treatment of wounds Prompt local treatment of all bite wounds and scratches is an important step in PEP. The recommended first-aid procedures include immediate, thorough flushing and washing of all wounds with soap and water and application of povidone iodine or another substance with virucidal activity. If soap or a virucidal agent is not available, the wound(s) should be thoroughly and extensively washed with water. Eyes and mucosa should be thoroughly rinsed with water. People who live in areas endemic for rabies should be taught simple local wound treatment and warned not to use procedures that may further contaminate or enlarge the wound. A bleeding wound at any site indicates potentially severe exposure and should be infiltrated with either equine or human RIG. Most severe bite wounds are best treated by a daily dressing, followed by secondary suturing when necessary. If suturing after wound cleansing cannot be avoided, the wound(s) should first be thoroughly infiltrated with human or equine RIG and suturing delayed for several hours to allow diffusion of the immunoglobulin through the tissues before minimal sutures are done. Secondary sutures are less likely to become infected and present better cosmetic results if done under optimal conditions. An infected bite wound is not a contraindication to injection of RIG (29). Bites on the tips of the fingers or toes, ear lobes, nasal area or external genitalia can be safely injected with RIG, provided excessive pressure is avoided, as this can cause compression syndromes (30). Other treatment, such as administration of antibiotics and tetanus prophylaxis, should be given as appropriate for potentially contaminated wounds. 8.3.4 WHO-recommended PEP regimens As clinical care settings and preferences in countries vary, WHO recommendations list preferred PEP regimens and alternatives, all of which have been assessed for immunogenicity, clinical outcome, feasibility and cost- effectiveness (Table 9). WHO recognizes the equivalent clinical effectiveness of the intradermal route, and intradermal administration of PEP is the preferred, most cost–effective route in clinics in which several new bite patients are seen per week. Rabies vaccines labelled for intramuscular use can be used safely via the intradermal route, even if this constitutes off-label use. For adults, vaccine should always be administered in the deltoid area of the arm; for young children (aged < 2 years), the anterolateral area of the thigh is recommended (see Annex 7). One intradermal dose corresponds to 0.1 mL of vaccine and one intramuscular dose is an entire vial of vaccine, irrespective of the vial size. Health care personnel should be careful not to inject less than the full 0.1 mL intradermal dose due to the dead space in the syringe or needle mount (insulin syringes may be used). Day 0 is the date of administration of WHO_TRS_inside_final_2018_after_Corr_round5.indd 66 24/04/2018 20:50 Prevention of human rabies 67 the first dose of vaccine. RABV vaccines and RIG can be used during pregnancy and lactation, and life-saving PEP should never be withheld from pregnant or lactating women; any of the WHO-recommended PEP regimens can be used. Table 9 WHO-recommended and alternative post-exposure prophylactic regimens PEP regimen Duration of course No. of injection sites per clinic visit (days 0, 3, 7, 14, 21–28) References WHO-recommended intradermal regimen 1 week, two sites 7 days 2-2-2-0-0 a WHO-recommended intramuscular regimen 2 weeks 14–28 days 1-1-1-1-0 31 3 weeks 21 days 2-0-1-0-1 32 Alternative immunogenic intradermal regimens 1 month, two sites ≤ 28 days 2-2-2-0-2 33 1 month, simplified four sites ≤ 28 days 4-0-2-0-1 34, 35 1 week, four sites 7 days 4-4-4-0-0 36–38 a Tarantola et al. Intradermal rabies post-exposure prophylaxis can be abridged with no measurable impact on clinical outcome in Cambodia, 2003–2014 (manuscript in preparation). Evidence from an observational study suggests that changes in the rabies vaccine product and/or the route of administration should be allowed in unavoidable circumstances to ensure completion of a PEP schedule (39). PEP need not be restarted, and the schedule of the new administration route should be adopted. 8.3.5 Rabies PEP for immunocompromised individuals Many circumstances lead to immunosuppression and different immunoregulatory pathways to compromised immune response. In most settings, it is not possible to determine the source or severity of immunosuppression when patients consult for PEP. If the condition is well managed, however, such WHO_TRS_inside_final_2018_after_Corr_round5.indd 67 24/04/2018 20:50 68 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report as for HIV patients who are under treatment and monitored, individuals will probably respond to vaccine in the same way as people who are not severely immunocompromised or are healthy, as observed in studies conducted for routine vaccines (10). Clinical experience suggests that, whenever possible, the best PEP options available (the most immunogenic regimen, high-quality vaccines and RIG) should be used, regardless of the route of vaccine administration. Meticulous, very thorough wound-cleaning as first aid to bite victims is of utmost importance in immunocompromised patients. When feasible, the RABV neutralizing antibody response should be determined 2–4 weeks after vaccination to assess whether an additional dose of vaccine is required. If possible, an infectious disease specialist or the patients’ treating clinician with expert knowledge or the patient’s disease history should be consulted. The wide variation in the causes of a compromised immune system and the limited information available indicate the need for targeted studies. 8.3.6 Rabies PEP for previously immunized people For exposed or re-exposed patients who can document previous complete PrEP or PEP and people who discontinued a PEP series after at least two doses of rabies vaccine, the following apply: ■ no RIG indicated; ■ intradermal administration of PEP: ■ one-site intradermal vaccine administration on days 0 and 3; ■ four-site intradermal vaccine administration on day 0 only; ■ one-site intramuscular administration of an entire vaccine vial on days 0 and 3. People who cannot document previous PEP equivalent to PrEP or complete PrEP should receive a full PEP, including RIG if indicated. 8.4 Use of rabies immunoglobulins for passive immunization The role of RIG in passive immunization is to provide neutralizing antibodies at the site of exposure before patients start producing their own antibodies as a result of vaccination. Therefore, RIG should be administered to all patients with a category III exposure when supplies are available, except those who received PrEP, as described in section 8.2. When access to RIG cannot be guaranteed for all people with a category III exposure, it may be used sparingly and prioritized for those at greatest risk, with consideration of additional high- WHO_TRS_inside_final_2018_after_Corr_round5.indd 68 24/04/2018 20:50 Prevention of human rabies 69 risk factors (see section 8.3.1). Vaccine should be administered regardless of the availability of RIG. RIG is administered only once, preferably at or as soon as possible after initiation of post-exposure vaccination. It is not indicated beyond the seventh day after the first dose of rabies vaccine, regardless of whether the doses were received on days 3 and 7, because an active antibody response to the rabies vaccine has already started, and this would represent a waste of RIG. The maximum dose of human RIG is 20 IU/kg of body weight, while that of equine immunoglobulin and F(ab’)2 products is 40 IU/kg of body weight. The entire immunoglobulin dose, or as much as anatomically possible (but avoiding possible compartment syndrome), should be infiltrated carefully into or as close as possible to the wound(s) or exposure sites. Evidence suggests that injecting the remaining RIG volume intramuscularly at a distance from the wound provides no or little additional protection against rabies as compared with infiltration of the wound alone (40–43). If, however, there is a high likelihood that there are additional small wounds (e.g. if a child does not report all wounds), exposure was to bats or exposure was other than through a bite, injection of the remaining RIG volume intramuscularly as close as possible to the presumed exposure site, to the degree that is anatomically feasible, is indicated. The same applies for mucosal exposure with no wound, and rinsing with RIG can be considered. In the case of suspected exposure to RABV in an aerosols, an intramuscular injection of RIG is nevertheless recommended. Use of the same syringe or mixing rabies vaccine and RIG are not advised. For severe and multiple wounds, which require more immunoglobulin than the maximum dose, the product may be diluted with sterile normal saline to a volume sufficient for effective, safe infiltration of all wounds. A mAb product was licenced in 2017 in India and is currently being used there in clinical settings. Depending on the geographical and epidemiological context, use of mAbs is encouraged as an alternative to RIG. WHO recommends that a registry be maintained to monitor the clinical use and outcomes of mAb products for rabies PEP. 8.5 Contraindications and precautions to be taken in post- exposure prophylaxis There are no contraindications to PEP. PEP can be safely given to infants, pregnant women and immunocompromised individuals, including children with HIV/AIDS. It should be given as indicated by the nature of the exposure in a setting in which the staff are adequately trained in its administration and in the management of possible adverse reactions, as for any other vaccination. As for all vaccinations, recipients should be kept under medical supervision for at least 15–20 min after vaccination. A previous severe reaction WHO_TRS_inside_final_2018_after_Corr_round5.indd 69 24/04/2018 20:50 70 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report to any component of a rabies vaccine is a contraindication for use of the same vaccine for PrEP or PEP, and the vaccine product should be changed. 8.6 Supply limitations Governments and responsible agencies should enact regulations to ensure that all people with suspected, probable or confirmed exposure to rabies have timely access to adequate PEP administered by competent staff, including in the private sector. Intradermal administration should be included in the recommendations of all countries. When possible, cost–effectiveness should be studied to determine the best methods of access to rabies vaccines and biologicals (44–47). In settings where there is no regular access to vaccines and RIGs or the supply is insufficient to meet demand, it might be necessary to consider diverting the supplies to people with high-risk exposure. If a limited amount of RIG is available, it should be prioritized for exposed patients on the basis of the following criteria: ■ multiple bites; ■ deep wounds; ■ bites to highly innervated parts of the body, such as the head, neck and hands; ■ severe immunodeficiency; ■ bites from an animal with confirmed or probable rabies; and ■ a bite, scratch or exposure of mucous membranes from a bat. Restricting RIG or vaccine to people with high-risk exposure to rabies may endanger those with lower-risk exposure and should be considered carefully before being implemented. Assessment of the risk associated with animals with suspected rabies, as described in section 8.3.1, can reduce unnecessary use of rabies biologicals and should be considered when the RIG and/or vaccine supply cannot meet demand. 8.7 Travel to rabies-affected countries and areas and indications for pre-exposure prophylaxis Assessment of the individual risk of exposure to RABV is recommended for travellers, which should take into consideration: the remoteness of the destination, the prevailing rabies epidemiology and the cumulative duration of the stay in endemic setting(s). PrEP should be considered for travellers who will WHO_TRS_inside_final_2018_after_Corr_round5.indd 70 24/04/2018 20:50 Prevention of human rabies 71 have extensive outdoor activities in remote rural areas and where timely access to adequate PEP is not guaranteed. PrEP should also be considered for people who regularly participate in activities such as caving that are likely to lead to direct contact with bats. Travellers to rabies-affected countries and areas should be aware of the risk of rabies and the need to seek PEP if they are exposed. Travellers to rabies-affected countries and areas should avoid contact with free-roaming animals, especially dogs, cats and monkeys, and with free-roaming and captive wild animals. For people who visit caves inhabited by bats, casual exposure to cave air is not a concern, but cavers should be warned not to handle bats. Physical contact with bats should be followed by PEP (see section 8.3.1). Fig. 4 shows four categories of countries and areas, from no risk to low, moderate and high risk of circulation of RABV and other lyssaviruses. The categorization is based on the major animal host or transmitter and lyssavirus species involved (for a map of the endemicity of dog-mediated rabies see section 2) and the availability of reliable, laboratory-based surveillance data on the reservoir species. Access to proper medical care and the availability of rabies vaccines and immunoglobulins were also taken into consideration. Figure 4 Countries and areas classified as no, low, medium and high risk of circulation of RABV and other lyssaviruses WHO_TRS_inside_final_2018_after_Corr_round5.indd 71 24/04/2018 20:50 72 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report In both no- and low-risk areas, proper medical care, rabies vaccine and immunoglobulins are accessible in a timely manner, and reliable laboratory- based surveillance data are available. In medium- and high-risk areas, access to proper medical care, rabies vaccines and immunoglobulins depends on the local setting and are not accessible in a timely manner throughout; partial laboratory- based surveillance data are available but may not cover all reservoir species or geographical settings in the country. Suggested certificates for pre- and post-exposure vaccination against rabies are shown in Annex 9. 8.8 Education to prevent bites Programmes to prevent dog bites are conducted in order to reduce the risk of rabies, save the costs of PEP and wound care, eliminate the trauma of dog bites and restore healthy dog–human relationships. Meta-analyses indicate that education programmes to prevent bites are moderately successful in affecting children’s behaviour (48, 49), although the quality of the evidence is low. Currently, there is no direct evidence that such programmes affect dog-bite rates. Human behaviour towards dogs is the result of a complex interaction between knowledge, emotion and experience (19, 50), and education to prevent dog bites is most effective when it involves live dogs. The complexity of such education means that the programmes are likely to require more time and resources than education on other aspects of rabies. Careful consideration should be given to the costs and benefits of the components of a holistic rabies education programme. It is recommended that knowledge, attitude and practice surveys be conducted to determine each stage of an education programmes on rabies. Depending on the setting, bite prevention may also include education on conduct in areas where rabies is circulating in wildlife, with particular emphasis on not touching or handling bats. 8.9 References 1. Lau CL, Hohl N. Immunogenicity of a modified intradermal pre- exposure rabies vaccination schedule using a purified chick embryo cell vaccine: an observational study. Travel Med Infect Dis. 2013;11(6):427– 30. 2. Mills DJ, Lau CL, Fearnley EJ, Weinstein P. The immunogenicity of a modified intradermal pre‐exposure rabies vaccination schedule – a case series of 420 travelers. J Travel Med. 2011;18(5):327–32. WHO_TRS_inside_final_2018_after_Corr_round5.indd 72 24/04/2018 20:50 Prevention of human rabies 73 3. Soentjens P, Andries P, Aerssens A, Tsoumanis A, Ravinetto R, Heuninckx W et al. Pre-exposure intradermal rabies vaccination: a randomized trial in healthy adults on shortening the schedule from 28 to 7 days. Submitted to Clin Infect Dis. 4. Recuenco S, Warnock E, Osinubi MO, Rupprecht CE. A single center, open label study of intradermal administration of an inactivated purified chick embryo cell culture rabies virus vaccine in adults. Vaccine. 2017;35(34):4315–20. 5. Wieten RW, Leenstra T, van Thiel PP, van Vugt M, Stijnis C, Goorhuis A et al. Rabies vaccinations: are abbreviated intradermal schedules the future?. Clin Infect Dis. 2012;56(3):414–9. 6. Khawplod P, Jaijaroensup W, Sawangvaree A, Prakongsri S, Wilde H. One clinic visit for pre-exposure rabies vaccination (a preliminary one year study). Vaccine. 2012;30(19):2918–20. 7. Suandork P, Pancharoen C, Kumperasart S, Sungdee A, Pattamadilok S, Sawanpanyalert P. Accelerated neutralizing antibody response to rabies vaccination six month after a single intramuscular pre-exposure dose. Bangkok: Chulalongkorn University; 2007 (http://cuir.car.chula.ac.th/ handle/123456789/14363). 8. Jonker EF, Visser LG. Single visit rabies pre-exposure priming induces a robust anamnestic antibody response after simulated post-exposure vaccination: results of a dose-finding study. J Travel Med. 2017;24(5). 9. Soentjens P. Preliminary results of intradermal booster doses (two or four) during one visit at one year after a single visit intradermal pre- exposure vaccination: an open-label randomized clinical trial on rabies boostability. Free communication FC6.04 at the 15th Conference of the International Society of Travel Medicine, Barcelona, 14–18 May 2017. 10. Simani OE, Izu A, Violari A, Cotton MF, van Niekerk N, Adrian PV et al. Effect of HIV-1 exposure and antiretroviral treatment strategies in HIV- infected children on immunogenicity of vaccines during infancy. Aids. 2014;28(4):531–41. 11. Boland TA, McGuone D, Jindal J, Rocha M, Cumming M, Rupprecht CE et al. Phylogenetic and epidemiologic evidence of multiyear incubation in human rabies. Ann Neurol. 2014;75(1):155–60. WHO_TRS_inside_final_2018_after_Corr_round5.indd 73 24/04/2018 20:50 74 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 12. Baer GM. The natural history of rabies. 2nd edition. Boca Raton (FL): CRC Press; 1991. 13. Fenelon N, Dely P, Katz MA, Schaad ND, Dismer A, Moran D et al. Knowledge, attitudes and practices regarding rabies risk in community members and healthcare professionals: Pétionville, Haiti, 2013. Epidemiol Infect. 2017;145(8):1624–34. 14. Ponsich A, Goutard F, Sorn S, Tarantola A. A prospective study on the incidence of dog bites and management in a rural Cambodian, rabies- endemic setting. Acta Trop. 2016;160:62–7. 15. Sultanov AA, Abdrakhmanov SK, Abdybekova AM, Karatayev BS, Torgerson PR. Rabies in Kazakhstan. PLoS Negl Trop Dis. 2016;10(8):e0004889. 16. Wallace RM, Reses H, Franka R, Dilius P, Fenelon N, Orciari L et al. Establishment of a canine rabies burden in Haiti through the implementation of a novel surveillance program. PLoS Negl Trop Dis. 2015;9(11):e0004245. 17. Lapiz SM, Miranda ME, Garcia RG, Daguro LI, Paman MD, Madrinan FP et al. Implementation of an intersectoral program to eliminate human and canine rabies: the Bohol Rabies Prevention and Elimination Project. PLoS Negl Trop Dis. 2012;6(12):e1891. 18. Birhane MG, Cleaton JM, Monroe BP, Wadhwa A, Orciari LA, Yager P et al. Rabies surveillance in the United States during 2015. J Am Vet Med Assoc. 2017;250(10):1117–30. 19. Medley AM, Millien MF, Blanton JD, Ma X, Augustin P, Crowdis K et al. Retrospective cohort study to assess the risk of rabies in biting dogs, 2013–2015, Republic of Haiti. Trop Med Infect Dis. 2017;2(2):14. 20. Tepsumethanon V, Wilde H, Meslin FX. Six criteria for rabies diagnosis in living dogs. J Med Assoc Thai. 2005;88(3):419–22. 21. Niezgoda M, Briggs DJ, Shaddock J, Rupprecht CE. Viral excretion in domestic ferrets (Mustela putorius furo) inoculated with a raccoon rabies isolate. Am J Vet Res. 1998;59(12):1629–32. 22. Tepsumethanon V, Lumlertdacha B, Mitmoonpitak C, Sitprija V, Meslin FX, Wilde H. Survival of naturally infected rabid dogs and cats. Clin Infect Dis. 2004;39(2):278–80. WHO_TRS_inside_final_2018_after_Corr_round5.indd 74 24/04/2018 20:50 Prevention of human rabies 75 23. Rupprecht CE, Nagarajan T, Ertl H. Current status and development of vaccines and other biologics for human rabies prevention. Expert Rev Vaccin. 2016;15(6):731–49. 24. Aguèmon CT, Tarantola A, Zoumènou E, Goyet S, Assouto P, Ly S et al. Rabies transmission risks during peripartum – two cases and a review of the literature. Vaccine. 2016;34(15):1752–7. 25. Bell JF, Moore GJ. Susceptibility of carnivora to rabies virus administered orally. Am J Epidemiol. 1971;93(3):176–82. 26. Wertheim HFL, Nguyen KAT, de Jong MD, Taylor WRJ, Le TV, Nguyen HH et al. Furious rabies after an atypical exposure. PLoS Med. 2009;6(3):e1000044. 27. Fitzpatrick JL, Dyer JL, Blanton JD, Kuzmin IV, Rupprecht CE. Rabies in rodents and lagomorphs in the United States, 1995–2010. J Am Vet Med Assoc. 2014;245(3):333–7. 28. Johnson N, Phillpotts R, Fooks AR. Airborne transmission of lyssaviruses. J Med Microbiol. 2006;55(6):785–90. 29. Wilde H, Bhanganada K, Chutivongse S, Siakasem A, Boonchai W, Supich C. Is injection of contaminated animal bite wounds with rabies immune globulin a safe practice? Trans R Soc Trop Med Hyg. 1992;86(1):86–8. 30. Suwansrinon K, Jaijaroensup W, Wilde H, Sitprija V. Is injecting a finger with rabies immunoglobulin dangerous? Am J Trop Med Hyg. 2006;75(2):363–4. 31. Kamoltham T, Singhsa J, Promsaranee U, Sonthon P, Mathean P, Thinyounyong W. Elimination of human rabies in a canine endemic province in Thailand: five-year programme. Bull World Health Organ. 2003;81(5):375–81. 32. Chutivongse S, Wilde H, Fishbein DB, Baer GM, Hemachudha T. One- year study of the 2-1-1 intramuscular postexposure rabies vaccine regimen in 100 severely exposed Thai patients using rabies immune globulin and Vero cell rabies vaccine. Vaccine. 1991;9(8):573–6. 33. Madhusudana SN, Sanjay TV, Mahendra BJ, Sudarshan MK, Narayana DH, Giri A et al. Comparison of safety and immunogenicity of purified chick embryo cell rabies vaccine (PCECV) and purified vero cell rabies vaccine (PVRV) using the Thai Red Cross intradermal regimen at a dose of 0.1 mL. Hum Vaccin. 2006;2(5):200–4. WHO_TRS_inside_final_2018_after_Corr_round5.indd 75 24/04/2018 20:50 76 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 34. Warrell MJ, Riddell A, Yu LM, Phipps J, Diggle L, Bourhy H et al. A simplified 4-site economical intradermal post-exposure rabies vaccine regimen: a randomised controlled comparison with standard methods. PLoS Negl Trop Dis. 2008;2(4):e224. 35. Ambrozaitis A, Laiškonis A, Balčiuniene L, Banzhoff A, Malerczyk C. Rabies post-exposure prophylaxis vaccination with purified chick embryo cell vaccine (PCECV) and purified Vero cell rabies vaccine (PVRV) in a four-site intradermal schedule (4-0-2-0-1-1): an immunogenic, cost– effective and practical regimen. Vaccine. 2006;24(19):4116–21. 36. Narayana A, Manoharan A, Narayan MS, Kalappa SM, Biligumba G, Haradanahalli R et al. Comparison of safety and immunogenicity of 2 WHO prequalified rabies vaccines administered by one week, 4 site intra dermal regimen (4-4-4-0-0) in animal bite cases. Hum Vaccin Immunother. 2015;11(7):1748–53. 37. Shantavasinkul P, Tantawichien T, Wilde H, Sawangvaree A, Kumchat A, Ruksaket N et al. Postexposure rabies prophylaxis completed in 1 week: preliminary study. Clin Infect Dis. 2010;50(1):56–60 38. Sudarshan MK, Narayana DH, Madhusudana SN, Holla R, Ashwin BY, Gangaboraiah B et al. Evaluation of a one week intradermal regimen for rabies post-exposure prophylaxis: results of a randomized, open label, active-controlled trial in healthy adult volunteers in India. Hum Vaccin Immunother. 2012;8(8):1077–81. 39. Ravish HS, Sudarshan MK, Madhusudana SN, Annadani RR, Narayana DH, Belludi AY et al. Assessing safety and immunogenicity of post- exposure prophylaxis following interchangeability of rabies vaccines in humans. Hum Vaccin Immunother. 2014;10(5):1354–8. 40. Bharti OK, Madhusudana SN, Gaunta PL, Belludi AY. Local infiltration of rabies immunoglobulins without systemic intramuscular administration: an alternative cost effective approach for passive immunization against rabies. Hum Vaccin Immunother. 2016;12(3):837–42. 41. Bharti OK, Madhusudana SN, Wilde H. Injecting rabies immunoglobulin (RIG) into wounds only: a significant saving of lives and costly RIG. Hum Vaccin Immunother. 2017;13(4):762–5. WHO_TRS_inside_final_2018_after_Corr_round5.indd 76 24/04/2018 20:50 Prevention of human rabies 77 42. Madhusudana SN, Ashwin BY, Sudarshan S. Feasibility of reducing rabies immunoglobulin dosage for passive immunization against rabies: results of in vitro and in vivo studies. Hum Vaccin Immunother. 2013;9(9):1914–7. 43. Saesow N, Chaiwatanarat T, Mitmoonpitak C, Wilde H. Diffusion and fate of intramuscularly injected human rabies immune globulin. Acta Trop. 2000;76(3):289–92. 44. Abbas SS, Kakkar M, Rogawski ET. Costs analysis of a population level rabies control programme in Tamil Nadu, India. PLoS Negl Trop Dis. 2014;8(2):e2721. 45. Fitzpatrick MC, Shah HA, Pandey A, Bilinski AM, Kakkar M, Clark AD et al. One health approach to cost–effective rabies control in India. Proc Natl Acad Sci U S A. 2016;113(51):14574–81. 46. Hampson K, Cleaveland S, Briggs D. Evaluation of cost–effective strategies for rabies post-exposure vaccination in low-income countries. PLoS Negl Trop Dis. 2011;5(3):e982. 47. Mindekem R, Lechenne MS, Oussiguéré A, Kebkiba B, Moto DD, Alfaroukh IO et al. Cost description and comparative cost efficiency of post-exposure prophylaxis and canine mass vaccination against rabies in N’Djamena, Chad. Front Vet Sci. 2017;4:38. 48. Duperrex O, Blackhall K, Burri M, Jeannot E. Education of children and adolescents for the prevention of dog bite injuries. Cochrane Database Syst Rev. 2009;15(2):CD004726. 49. Shen J, Rouse J, Godbole M, Wells HL, Boppana S, Schwebel DC. Systematic review: interventions to educate children about dog safety and prevent pediatric dog-bite injuries: a meta-analytic review. J Pediatr Psychol. 2016;42(7):779–91. 50. Mathews JR, Lattal KA. A behavioral analysis of dog bites to children. J Dev Behav Pediatr. 1994;15(1):44–52. WHO_TRS_inside_final_2018_after_Corr_round5.indd 77 24/04/2018 20:50 78 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 9. Prevention and control of rabies in dogs As more than 95% of human rabies cases are transmitted by dogs, the control and elimination of rabies in dogs prevent rabies at its source. Dog- mediated rabies has been eliminated in North America, western Europe, Japan and parts of Asia and South America; however, it is still widespread, in over 100 countries and territories, predominantly in the developing world (see section 2). 9.1 Case definition of animal rabies The clinical signs of rabies in animals vary widely. A case is clinically defined as that in an animal that presents with any of the following signs: ■ hypersalivation ■ paralysis ■ lethargy ■ unprovoked abnormal aggression (e.g. biting two or more people or animals and/or inanimate objects) ■ abnormal vocalization ■ diurnal activity of nocturnal species. Cases of animal rabies are classified as: ■ suspected: a case that is compatible with a clinical case definition of animal rabies; ■ probable: a suspected case with a reliable history of contact with a suspected, probably or confirmed rabid animal and/or an animal with suspected rabies that is killed, died or disappeared within 4–5 days of illness being observed; ■ confirmed: a suspected or probable case that is confirmed in a labora- tory; and ■ not a case: a suspected or probable case that is ruled out by laboratory tests or epidemiological investigation (i.e. appropriate quarantine pe- riod of eligible animals). Laboratory confirmation should be performed with a standard diagnostic test defined by WHO or OIE (see section 5) (1). If other diagnostic tests are used, confirmation of the results with an internationally recognized secondary test may be required (particularly for negative results), depending on the sensitivity and WHO_TRS_inside_final_2018_after_Corr_round5.indd 78 24/04/2018 20:50 Prevention and control of rabies in dogs 79 specificity of the initial tests. Accurate diagnosis of rabies in animals is especially important when human exposure to the suspected animal has been reported. 9.2 Methods for controlling dog rabies As rabies control programmes involve multiple agencies and sectors, including those of animal and public health, they require a “one health” approach, with effective intersectoral cooperation. Mass parenteral canine vaccination campaigns with vaccines manufactured according to international standards are the mainstay of dog-mediated rabies control (1–4). To achieve control and eventual elimination of rabies, campaigns must be conducted recurrently (usually annually) with a vaccination coverage of at least 70% (5, 6), which should be sufficient to maintain the required level of herd immunity in the susceptible population despite dog population turnover (births, deaths, animal movement) in the period between campaigns. The coverage should be evaluated routinely, with appropriate epidemiological counselling to ensure that the goals are met in all target areas. It is of utmost importance that rabies vaccination programmes are flexible enough to allow timely, adequate responses to changes in epidemiological conditions. Greater community awareness, engagement and mobilization can improve the turn-out for vaccination campaigns, their cost–effectiveness and sustainability and the surveillance and management of rabies cases. When dogs cannot be handled by their owners or when no single owner claims responsibility for vaccination, professional dog handlers can catch and restrain dogs humanely for vaccination after suitable training to ensure they can catch dogs efficiently, reliably and humanely; inexpert handling can injure both handlers and dogs and may make future vaccination more difficult. As handlers are likely to have a higher rate of dog-bite injuries, pre-exposure vaccination is highly recommended (see section 8.2). Oral rabies vaccination (ORV) of dogs may improve coverage in situations in which dogs cannot be restrained or caught and should be used as a complementary measure to improve overall vaccination coverage in dog rabies control programmes (see section 9.2.3). Directors of vaccination programmes should take into account the local ecology of the dog population, including whether they are owned and confined, owned and roaming, owned by the community or ownerless. This information ensures that the method maximizes access to dogs and is adapted to the sociocultural context. Free-roaming dogs play a key role in the transmission of rabies and must be included in vaccination campaigns. Mass dog vaccination has repeatedly been shown to be effective for controlling dog-mediated rabies, whereas removal of dogs does not decrease dog density or control rabies in the long run. Mass culling of dogs should therefore not WHO_TRS_inside_final_2018_after_Corr_round5.indd 79 24/04/2018 20:50 80 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report be a part of a rabies control strategy: it is ineffective and may be counterproductive to vaccination programmes, particularly when they target free-roaming dogs. For more information on humane dog population management, see Chapter 7.7 of the OIE Manual of diagnostic tests and vaccines for terrestrial animals: “Stray dog population management” (7). Euthanasia of a dog suspected of being rabid prevents further transmission to humans and animals and prevents further suffering of the dog (see section 9.1 for a case definition of animal rabies). If the clinical diagnosis of rabies is unclear, the dog can be quarantined and observed; however, if the signs progress, humane euthanasia should be performed (7). 9.2.1 Main components of a dog rabies control programme The elements to be included in a dog rabies control programme are listed below. ■ Establish a national strategy, focal points and committees to prepare, implement and monitor long-term plans for rabies elimination based on understanding of the local epidemiology, education and aware- ness campaigns, mass dog vaccination and provision of PEP or PrEP to populations at risk (see section 8). ■ Enhance intersectoral cooperation among veterinary services, public health and wildlife management to design evidence-based approach- es to the elimination of human and animal rabies. ■ Support integration of rabies control activities into all levels of the health service, and align them with other public health or animal dis- ease control programmes. Integrated delivery of rabies control meas- ures may have wider benefits in terms of strengthening health and veterinary service delivery, particularly in remote areas and neglect- ed communities, improving intersectoral collaboration and building community trust. ■ Stimulate cooperation with the pharmaceutical industry and institu- tions for the provision of vaccines, both human and veterinary, and technical cooperation to ensure correct storage, prompt delivery and appropriate administration of high-quality vaccines. ■ Seek funding from bilateral, multilateral, public and private agencies and other donors in the framework of technical cooperation or hu- manitarian aid. WHO_TRS_inside_final_2018_after_Corr_round5.indd 80 24/04/2018 20:50 Prevention and control of rabies in dogs 81 ■ Conduct campaigns and education programmes to increase aware- ness of the benefits of responsible dog ownership, basic care of bites from animals with suspected rabies and avoiding exposure to ani- mals. ■ Strengthen surveillance and diagnostic capacity to include rapid di- agnostic tests and rabies notification systems. ■ Institute effective cross-border collaboration for rabies control and elimination. 9.2.2 Strategic planning and management of dog vaccination campaigns Vaccination campaigns should be strategically planned and well managed, with adequate resources. The “rabies blueprint” prepared by the Partners for Rabies Prevention provides guidance on planning and implementing parenteral dog vaccination campaigns (http://caninerabiesblueprint.org/) (8). Another tool that could be used for strategic planning and allocation of funding is the “Planning aid for the control of dog-mediated human rabies deaths based on dog vaccination” (9). Studies of dog ecology In planning a vaccination campaign, the dog population should be estimated and dog-keeping practices ascertained to calculate the resources required and the appropriate methods for accessing dogs for vaccination (8). The dog population can be estimated from the human:dog ratio; however, this ratio varies widely, and poor human census data may reduce the accuracy of estimates of the dog population. Furthermore, low reporting and variable patterns of dog ownership in urban areas make it difficult to estimate dog populations accurately. Other methods for estimating dog populations include surveys and capture–mark– recapture approaches, which cover the free-roaming population. Details of these methods are given in the “canine rabies blueprint”. Such surveys are often usefully combined with post-vaccination surveys to evaluate vaccination coverage, and population estimates can be revised for future campaigns (10, 11). Information from dog registries can be useful, but, as these do not include unregistered or ownerless dogs, use of this source alone will result in underestimation of the total dog population. Vaccination and immunization coverage Low or patchy vaccination coverage of dogs, missing even a small proportion of communities, may facilitate the persistence of rabies and jeopardize the prospects of elimination, even if the average coverage of the region is high. WHO_TRS_inside_final_2018_after_Corr_round5.indd 81 24/04/2018 20:50 82 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Vaccination is most effective when carried out over contiguous areas with comprehensive coverage rather than many small, separate areas (12). Reactive vaccination in an outbreak is not recommended as an alternative to regular (e.g. annual), systematic, proactive vaccination campaigns, unless greater surveillance shows that the incidence has been reduced to low levels in a few remaining foci. Reactive strategies take longer to control rabies and are less likely to be successful than systematic vaccination in an entire area. The required immunization coverage can be achieved if the vaccination programme includes well-designed educational campaigns, intersectoral and interdisciplinary cooperation, community participation, local commitment to planning and execution, the availability of high-quality vaccine, media support and effective general coordination and supervision of activities by the appropriate authorities. Implementing and monitoring dog vaccination campaigns During mass vaccination campaigns, all dogs should be vaccinated, including newborn puppies, regardless of weight, state of health or prior vaccination. Although the aim should be to vaccinate as many dogs as possible, herd immunity is achieved by vaccinating at least 70% of the rabies-susceptible dog population. One reason for low vaccination coverage is that puppies, which often comprise a large proportion of the population, are not vaccinated (13), mainly because it is not recommended by the vaccine manufacturer or by national guidelines. Studies in South Africa, Tunisia and the United Republic of Tanzania indicate, however, that young pups (<  3 months of age) mount an effective immune response when given a high-quality vaccine, with no adverse effects. Owners and vaccination teams should therefore be aware that puppies, including newborns, should also be vaccinated to ensure adequate population coverage, even though this may represent off-label use. Four basic approaches have been described to access dogs for vaccination campaigns: house-to-house visits, fixed vaccination posts in well-recognized sites in a community, temporary vaccination posts set up by mobile teams and mobile “street vaccination” teams. Posts are usually sufficiently attended only when they are located fewer than 500 m or about a 10-min walk away. The choice of approach should be decided at local level, as it depends on the sociocultural context of the community. A combination of approaches may be used. Administration of rabies vaccine can be linked with other health interventions (e.g. deworming, neutering and other vaccination programmes), which might provide additional health benefits for the dog and provide an incentive for engagement of both owners and veterinary practitioners in vaccination campaigns (14). WHO_TRS_inside_final_2018_after_Corr_round5.indd 82 24/04/2018 20:50 Prevention and control of rabies in dogs 83 Timing of campaigns Rabies vaccination campaigns are generally conducted annually, but more frequent campaigns may be necessary in areas in which the incidence of rabies in dogs and/or population turnover is high or the programme has not yet achieved its desired outcome. Intensive vaccination campaigns lasting less than 1 month have been effective in rabies control in Latin America, Asia and Africa. Campaigns should, however, reach at least 70% of the dog population, and coverage should not be compromised in the pursuit of speed. Campaigns might be organized on weekends or during school time or holidays to improve turn-out, as children often bring their dogs for vaccination. Monitoring vaccination campaigns Registration and permanent identification of vaccinated dogs is recommended; however, research is still required to identify methods of identification that are cost–effective, safe, quick and simple to apply in the field and well accepted by both dogs and owners. Lack of resources or capacity to permanently identify dogs should not preclude implementation of a vaccination campaign. The use of coloured tags, paint or spray marks or plastic collars as temporary marking has proven to be useful in identifying vaccinated dogs and can motivate owners to take their dogs for vaccination. Temporary or permanent identification of vaccinated dogs is necessary for evaluating the vaccination coverage rate and for differentiating unvaccinated dogs for follow-up vaccination. Routine serological monitoring in the context of mass dog vaccination campaigns, including ORV campaigns, can be expensive and is not necessary if: ■ a high-quality vaccine manufactured according to international standards has been used; ■ vaccination teams have been trained and have used a proper injection technique, dog handling and vaccine vial management; and ■ the cold chain has been maintained throughout. If repeated annual vaccination campaigns that reach the targeted coverage do not result in a decrease in the number of animal rabies cases, one or more of the above elements may not have been complied with, or the estimate used to calculate dog vaccination coverage is not accurate. Well-designed serological and other studies (e.g. vaccine potency, cold chain monitoring) may then be warranted to determine post-vaccination antibody responses. Serological testing should be carried out during the period of peak antibody response, at or around 28 days post-vaccination, as rapidly declining antibody titres can make interpretation of serological results difficult if sampling is carried out longer after vaccination. WHO_TRS_inside_final_2018_after_Corr_round5.indd 83 24/04/2018 20:50 84 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Properly validated ELISAs can be used as an alternative to seroneutralization assays (see section 5). Cost–effectiveness of dog vaccination Dog vaccination in combination with PEP is more cost–effective in preventing human deaths from rabies than PEP alone (15–17). The demand for PEP does not, however, invariably decrease with a decrease in the incidence of dog rabies. A study in Chad on the effect of a contribution of dog owners to the costs of dog registration or vaccination campaigns showed that fee-based vaccination campaigns increased the cost per dog vaccinated and lowered the vaccination coverage of dog populations as compared with free vaccination campaigns (18). In the Philippines, the willingness of residents to pay an average of US$ 1.67 for dog vaccination and US$ 0.70 for dog registration depended on socioeconomic and demographic factors such as age, income, number of dogs owned and municipality of residence (19). These factors should therefore be considered before introducing such fees. If a paid contribution jeopardizes vaccination, the intervention (registration, marking, vaccination, certificate delivery) should be provided free of charge and the cost balanced against the public health benefits of rabies control. Vaccines to be used Vaccines are susceptible to changes in temperature, including freezing, and care must be taken to ensure that the cold chain is maintained within an acceptable temperature range (2–8  °C). Vaccines that induce immunity for a minimum duration of 2 years should be used in annual campaigns to revaccinate all dogs. Revaccination has no adverse effects. Although annual booster vaccination of dogs may not be necessary if they have received a vaccine that induces long-term immunity and more selective vaccination could potentially save costs, turning people and their dogs away at vaccination points could send out a confusing message. Further, in many campaigns, the direct cost of revaccination is likely to be lower than the fixed costs of the campaign. Vaccination of puppies < 3 months of age with high-quality, inactivated rabies vaccine has been shown to result in effective seroconversion (20). All dogs, including puppies < 3 months of age, should be included in vaccination campaigns in endemic regions. Where vaccination certificates are issued, pre-printed certificates may increase efficiency. As maternal antibody may interfere with vaccination, puppies should receive a vaccination certificate only after they have received a booster dose. WHO_TRS_inside_final_2018_after_Corr_round6.indd 84 06/06/2018 20:53 Prevention and control of rabies in dogs 85 Vaccines available Veterinary vaccines have been developed for use against rabies in domestic mammals and wildlife. They are either inactivated (killed), modified- live or recombinant products. Whatever the method for vaccine production, the quality of the source material and standards (e.g. virus master seed, specific pathogen-free eggs, cell seed) should be clearly documented, particularly with regard to sterility, safety and potency. Rabies vaccines for animals should be approved by the competent State authorities and comply with national requirements for vaccines. If there are no adequate national regulations for veterinary biologicals with regard to potency, sterility, safety and efficacy, reference should be made to the relevant international standards. For further information on veterinary vaccines available for rabies in dogs and wildlife, including potency requirements, see Chapter 2.1.17, Rabies (infection with rabies virus), of the OIE Manual of diagnostic tests and vaccines for terrestrial animals (1). Nerve tissue vaccines induce more severe adverse reactions and are less immunogenic than modern cell culture vaccines. WHO and OIE strongly recommend discontinuation of the production and use of nerve tissue vaccines and their replacement by modern cell culture vaccines. The use of modified live- virus vaccines produced from egg- or cell culture-adapted strains for parenteral vaccination of dogs is also discouraged. Vaccination should be undertaken with inactivated vaccines (with or without adjuvant). Safety considerations All members of a vaccination team who handle dogs should receive PrEP before the campaign. Adequate PEP should be available for people who are exposed during the campaign. In the event of accidental exposure to modified live RABV vaccines, medical assistance should be sought and PEP considered. The potential risk to animals, humans and the environment of recombinant vaccines, such as those containing live pox or adenovirus vectors, should be assessed, and methods for mitigation or treatment, particularly in humans, should be identified before field use. For detailed information on the minimal requirements for animal rabies vaccine safety, see Chapter 2.1.17, Rabies (infection with rabies virus), of the OIE Manual of diagnostic tests and vaccines for terrestrial animals (1). 9.2.3 Oral vaccination campaigns ORV has been successfully used to control the disease in certain wildlife reservoir species (21). ORV of dogs is a complementary measure that can be used WHO_TRS_inside_final_2018_after_Corr_round5.indd 85 24/04/2018 20:50 86 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report to increase vaccination coverage in mass parenteral dog vaccination campaigns, e.g. in contexts where reaching 70% vaccination coverage is compromised by the presence of free-roaming dog populations. Countries should assess the suitability and necessity for both parenteral vaccination and ORV in their rabies control strategy. Annex 10 gives an overview of currently available ORV products. Target populations Only semi-restricted and unrestricted dogs (and owned, fully restricted dogs that cannot be handled) that cannot be vaccinated parenterally under normal conditions should be considered for ORV. It is likely that these dogs will be identified only after mass parenteral vaccination campaigns have been attempted. ORV may help to improve vaccination coverage in these hard-to- reach dog subpopulations. Methods of distribution ORV has been used to vaccinate dogs in relatively small field trials (22– 25). To limit the possibility of contact of non-target species (including humans) with vaccine and bait, the “hand-out” model has been used, in which baits are presented directly to dogs (owned or unowned) on the street. Oral vaccine baiting can be implemented simultaneously with door-to-door or central point parenteral campaigns, e.g. for aggressive dogs and those that are difficult to handle. ORV should always be conducted by trained vaccinators. Efficacy Parenteral vaccination must remain the primary method of immunization. It has been shown repeatedly to result in a robust immune response in > 95% of dogs that are vaccinated appropriately. Parenteral vaccines are injected directly into subcutaneous or muscle tissue, nearly guaranteeing that the vaccine will be recognized by a competent host immune system. Oral vaccination of dogs cannot be guaranteed to achieve such high seroconversion rates because of several important issues in delivery and immunology. Oral vaccines require that a dog is attracted to the bait, chews it and breaks the sachet or blister and that the vaccine is deposited in the correct amount onto the oral mucosa. Furthermore, oral vaccines are modified live or recombinant constructs and must replicate in the host in order to induce an immune response. For these reasons, parenteral vaccination with inactivated vaccines is the preferred choice for accessible dogs; the utility of ORV for semi-restricted, non-restricted and unapproachable dog subpopulations can nevertheless be clearly beneficial (25). WHO_TRS_inside_final_2018_after_Corr_round5.indd 86 24/04/2018 20:50 Prevention and control of rabies in dogs 87 Safety Oral rabies vaccines licensed according to international standards are considered to be safe; however, safety should always be thoroughly assessed before ORV in the field. In Haiti, assessment of the safety of a modified-live RABV oral vaccine showed that the probability of a human death due to contact with the oral rabies vaccine was 0 per 1 billion baits distributed by the hand-out method, and the probability of a human death due to a dog bite was 0.3 per 1 billion baits distributed by the hand-out method (assuming PEP was not given to any exposed person). In Tunisia, no exposure to the vaccine bait occurred when baits were distributed door to door (equivalent to the hand-out method), whereas a 1.4% rate of contact was observed with “transect line” distribution (26). It is the responsibility of countries to study the opportunity of introducing ORV into their rabies control strategy. If an oral vaccine includes a genetically modified organism, the legal implications of its release into the environment should be considered. WHO recommends that ORV be used in pilot studies to evaluate its feasibility and efficacy before widescale application. Researchers and project designers should assess the product, identify potential hazards and evaluate the risks associated with its introduction into the environment. Guiding principles for investigating and conducting ORV are described in Chapter 2.1.17, Rabies (infection with rabies virus), of the OIE Manual of diagnostic tests and vaccines for terrestrial animals (1). Countries that are considering use of ORV of dogs should ensure the safety of the viral construct on the target and non-target species, including humans (25). As shown in Europe and the USA with regard to rabies vaccination of wildlife, selection of safe, effective oral rabies vaccine constructs and appropriate contingency plans for non-target exposure to the vaccine can make the human risk nearly negligible (27). Particular attention should be paid to safety in lower-income communities where ORV may be administered in areas of high human population density, the prevalence of immunodeficiency is higher, access to medical care may be less reliable and the literacy rate may be low so that people cannot read warning labels. After a vaccine and baiting system has been selected and before positioning of vaccine baits in the environment, sufficient information should be provided to the public so that, in general, public support and cooperation are elicited. The information should include the potential risks associated with the vaccine and the assistance that will be available if contact with humans or other non-target occurs. Setting up surveillance systems to detect human contact with vaccine and/or bait and establishing rules for documentation and follow-up of cases of human exposure to the vaccine are of utmost importance. In the event of accidental exposure to modified live RABV vaccine, medical assistance should WHO_TRS_inside_final_2018_after_Corr_round5.indd 87 24/04/2018 20:50 88 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report be sought and PEP considered (see section 8). Both exposure by direct contact with the vaccine and exposure to animals that were vaccinated recently (i.e. one to several hours previously) should be reported. There is no evidence that oral rabies vaccines are actively excreted in saliva, but, because of the presence of liquid vaccine in the oral cavity after consumption, contact with dogs that have just been given oral vaccine should be avoided or minimized for at least 1 h and preferably longer (25). Surveillance programmes should be capable of detecting rabid dogs in the area of ORV, and all positive samples should be characterized molecularly to ensure that the vaccine did not revert to a state of virulence. International organizations, particularly WHO and OIE (including their networks of reference centres), collaborate with governments in assessing the risks associated with the use and application in the field of each type of product (modified live vaccine, recombinant vaccine and other constructs) for target and non-target species; identifying the efficacy and safety requirements for each type of product; and defining the criteria for distribution in the field. The main criteria for assessing use of oral rabies vaccines in dogs are: ■ the origin (manufacturer); ■ vaccine type: modified live virus, recombinant live virus or other construct; ■ safety in the target animal(s); ■ safety in non-target animals; ■ safety in non-human primates; ■ development of humoral immunity in the vaccinated primary target animal; ■ results of virulent challenge protection studies; ■ bait contact rates for a bait distribution method; ■ bait matrix attractiveness to confined and free-roaming dogs; ■ thermostability of the bait matrix under field conditions and forecast; ■ excretion of viable RABV into the environment (saliva and faecal samples); ■ cost–benefit; WHO_TRS_inside_final_2018_after_Corr_round5.indd 88 24/04/2018 20:50 Prevention and control of rabies in dogs 89 ■ current licensure of the product in any country and/or currently rec- ommended by an international public and/or animal health body for field use; ■ community support for oral vaccination of dogs against rabies; ■ possibility of post-vaccination monitoring for people potentially ex- posed directly to the vaccine or as a result of contact with recently vaccinated dogs; and ■ access to PEP for humans exposed or potentially exposed to the vac- cine (PEP adapted to the vaccine construct, which may include agents other than lyssaviruses). Full details of relevant procedures, tests and protocols should be obtained from relevant national regulatory authorities and/or relevant international guidelines (OIE, WHO, European Pharmacopeia, US Code of Federal Regulations). Licensure Preferably, countries in which ORV is used will license the product for use in dogs; however, many countries affected by dog-mediated rabies lack the regulatory bodies to license biological products and rely on other countries to obtain licensure. This creates a global dilemma, in that countries (and vaccine manufacturers) that can license vaccine products are usually not affected by dog- mediated rabies and have no incentive to license these oral products for use in dogs. Manufacturers are encouraged to license ORV products for dogs, according to international standards, to assist regulatory authorities in endemic countries in expeditiously approving ORVs for use in their rabies programmes. Countries in which use of ORV is being considered and that have the capacity to license products should prioritize the evaluation and licensure of ORV products before widescale field use. When licensure is not available, countries should consider off-label use of ORV products that have been licensed for species other than dogs, provided adequate studies of safety and efficacy have been conducted. 9.3 International movement of animals International movement of animals is of significance for human public health as it can facilitate the introduction, emergence or re-emergence of rabies in new countries or areas. Regulations for importing domestic, captive wild and wild mammals from rabies-free countries or from countries that are considered to be infected with rabies should comply with OIE international standards, including presentation of a valid international veterinary certificate (28). For WHO_TRS_inside_final_2018_after_Corr_round5.indd 89 24/04/2018 20:50 90 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report further information on international movement of animals, refer to Chapter 8.14 of the OIE Terrestrial Animal Health Code (29). 9.4 Humane dog population management Dog populations are managed humanely mainly by responsible dog ownership and provision of sterilization services and basic dog health care (7). The objective of dog population management in the context of dog-mediated rabies control is to improve and maintain vaccination coverage and reduce risky dog behaviour. Reducing the population size is not an effective means of reducing the number of rabies cases, although it may have other benefits (e.g. with regard to dog welfare or nuisance behaviour) (30). Management of dog populations may therefore be beneficial in dog-mediated rabies control. Humane dog population management is an effective strategy for reducing dog population turnover and creating a healthy, sustainable population. As the status and composition of dog populations varies from country to country, no one intervention will work in all situations. Authorities should work with people who know the local dog population in order to understand ownership, demographics and the attitude of the local community towards dogs. This information can form the basis for a tailored package of tools for long-term, sustainable management (8, 31). For further information on humane dog population, see Chapter 7.7 of the OIE Terrestrial Animal Health Code (7). 9.5 Vaccination versus sterilization Priority should be given to dog vaccination, as it is the most effective means of reducing dog-mediated rabies (32). A publicly available stochastic model allows comparison of the effects of various budget allocations to sterilization and vaccination, in terms of cost and predicted human deaths, which can be accessed at: https://bioecon.shinyapps.io/CanineRabiesWebApp/. Sterilization of dogs should be pursued when: ■ funds and time for sterilization are from a different source from that for vaccinations; ■ high vaccination coverage has already been achieved, and surplus funds are available; and ■ the cost of both sterilization and vaccination is low. Sterilization might also be considered in rare ecological circumstances, such as when it might markedly prolong the longevity of the dogs, when there is no demand or desire for additional dogs and it can be done inexpensively. WHO_TRS_inside_final_2018_after_Corr_round5.indd 90 24/04/2018 20:50 Prevention and control of rabies in dogs 91 Countries are encouraged first and foremost to invest in widescale vaccination campaigns. 9.6 National programmes for dog rabies control: lessons from the field Since formally pledging to eliminate human deaths from dog-mediated rabies in 1983, Latin American countries have decreased the number of cases by over 90%, with a similar decrease in human deaths (4). This has been achieved predominately by mass vaccination of over 50 million dogs annually, with concurrent appropriate treatment of people at risk of rabies (PrEP or PEP) and epidemiological surveillance. The success of vaccination campaigns in Latin America was due to the central coordinating role of the public health sector and the involvement of communities in rabies control (33). Programmes for testing proof of concept in KwaZulu–Natal (South Africa) and the Visayas (Philippines) have also reduced the number of human rabies cases by mass dog vaccination and extended access to PEP. In KwaZulu– Natal, the number of cases was significantly reduced by annual dog vaccination campaigns, and the number of dog-mediated rabies cases was reduced by > 80%. The project is now being extended throughout southern Africa, with renewed support and momentum. The regional programme for rabies elimination in the Visayas is part of the national rabies programme, which is implemented jointly by the departments of agriculture, health and education and involves dog vaccination campaigns in the Western, Eastern and Central Visayas and Bohol (3). Intensive education campaigns were conducted to engage the community, increase dog vaccination and responsible pet ownership and improve surveillance, diagnostic capability and access to PEP. Within 6 years of the start of control activities in the Visayas, the number of human cases approximately halved, and two provinces, five island municipalities and five smaller islands have been declared rabies free (34). In 2010, Bangladesh initiated a national strategy to eliminate rabies by 2020, by intersectoral collaboration of health and livestock ministries and local governments. The strategy includes advocacy, communication and social mobilization, dog-bite management, mass dog vaccination and dog population management. Dog vaccination has been scaled up from one municipality in 2011 to 64 municipalities and city corporations. A snowball technique of capacity- building for dog catchers and vaccinators has resulted in training of several thousand expert dog catchers, which is essential in a country in which 83% of dogs roam freely. The programme achieved a minimum population coverage of 70% within 1 week through local campaigns and reduced unplanned dog killing in municipalities. Three vaccination rounds are planned by 2020 to cover an estimated 1.6 million dogs. With this strategy, the number of human WHO_TRS_inside_final_2018_after_Corr_round5.indd 91 24/04/2018 20:50 92 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report rabies cases decreased from over 2000 annually before 2011 to fewer than 200 as communicated to WHO for 2016 (35, 36). In N’Djaména, Chad, mass dog vaccination campaigns conducted in 2012 and 2013 reached 70% coverage, resulting in a decrease in the annual dog rabies incidence from 0.7/1000 in 2012 to 0.07/1000 in 2014 (37). After the campaigns, no dog rabies cases were reported in N’Djaména for over 9 months (January– October 2014). A deterministic transmission model fitted to demographic and epidemiological data suggested that rabies transmission in dogs has been interrupted by the vaccination campaigns (9). In 2015 and 2016, rabies cases were reported in the periphery of the town and then in the town centre, indicating that reintroduction into areas of previous dog vaccination is a continuous threat and that mass interventions must be coordinated at a higher regional scale for a sustainable effect. Geographical boundaries such as rivers serve as short-term barriers; however, dog movement is strongly driven by human movement, and rabies may be propagated by human transport of dogs across natural barriers and over larger distances. 9.7 References 1. Chapter 2.1.17: Rabies (infection with rabies virus). In: Manual of diagnostic tests and vaccines for terrestrial animals, Vol. 2. Paris: World Organisation for Animal Health; 2016. 2. Harischandra PA, Gunesekera A, Janakan N, Gongal G, Abela-Ridder B. Sri Lanka takes action towards a target of zero rabies death by 2020. WHO South East Asia J Public Health. 2016;5(2):112–6. 3. Lapiz SM, Miranda ME, Garcia RG, Daguro LI, Paman MD, Madrinan FP et al. Implementation of an intersectoral program to eliminate human and canine rabies: the Bohol Rabies Prevention and Elimination Project. PLoS Negl Trop Dis. 2012;6(12):e1891. 4. Vigilato MA, Clavijo A, Knobl T, Silva HM, Cosivi O, Schneider MC et al. Progress towards eliminating canine rabies: policies and perspectives from Latin America and the Caribbean. Phil Trans R Soc B. 2013;368(1623):20120143. 5. Cleaveland S, Kaare M, Tiringa P, Mlengeya T, Barrat J. A dog rabies vaccination campaign in rural Africa: impact on the incidence of dog rabies and human dog-bite injuries. Vaccine. 2003;21(17–18):1965–73. 6. Coleman PG, Dye C. Immunization coverage required to prevent outbreaks of dog rabies. Vaccine. 1996;14(3):185–6. WHO_TRS_inside_final_2018_after_Corr_round5.indd 92 24/04/2018 20:50 Prevention and control of rabies in dogs 93 7. Chapter 7.7. Stray dog population control. In: Manual of diagnostic tests and vaccines for terrestrial animals. Paris: World Organisation for Animal Health; 2016 (http://www.oie.int/index. php?id=169&L=0&htmfile=chapitre_aw_stray_dog.htm). 8. Lembo T, Partners for Rabies Prevention. The blueprint for rabies prevention and control: a novel operational toolkit for rabies elimination. PLoS Negl Trop Dis. 2012;6(2):e1388. 9. Undurraga EA, Meltzer MI, Tran CH, Atkins CY, Etheart MD, Millien MF et al. Cost–effectiveness evaluation of a novel integrated bite case management program for the control of human rabies, Haiti 2014–2015. Am J Trop Med Hyg. 2017;96(6):1307–17. 10. Darkaoui S, Fassi Fihri O, Schereffer JL, Aboulfidaa N, Wasniewski M, Zouine K et al. Immunogenicity and efficacy of Rabivac vaccine for animal rabies control in Morocco. Clin Exp Vaccin Res. 2016;5(1):60–9. 11. Gibson AD, Handel IG, Shervell K, Roux T, Mayer D, Muyila S et al. The vaccination of 35,000 dogs in 20 working days using combined static point and door-to-door methods in Blantyre, Malawi. PLoS Negl Trop Dis. 2016;10(7):e0004824. 12. Townsend SE, Sumantra IP, Bagus GN, Brum E, Cleaveland S, Crafter S et al. Designing programs for eliminating canine rabies from islands: Bali, Indonesia as a case study. PLoS Negl Trop Dis. 2013;7(8):e2372. 13. Kaare M, Lembo T, Hampson K, Ernest E, Estes A, Mentzel C et al. Rabies control in rural Africa: evaluating strategies for effective domestic dog vaccination. Vaccine. 2009;27(1):152–60. 14. Knobel DL, Arega S, Reininghaus B, Simpson GJ, Gessner BD, Stryhn H et al. Rabies vaccine is associated with decreased all-cause mortality in dogs. Vaccine. 2017;35(31):3844–9. 15. Bögel K, Meslin FX. Economics of human and canine rabies elimination: guidelines for programme orientation. Bull World Health Organ. 1990;68(3):281. 16. Cleaveland S, Kaare M, Knobel D, Laurenson MK. Canine vaccination – providing broader benefits for disease control. Vet Microbiol. 2006;117(1):43–50. 17. Léchenne M, Oussiguere A, Naissengar K, Mindekem R, Mosimann L, Rives G et al. Operational performance and analysis of two rabies vaccination campaigns in N’Djamena, Chad. Vaccine. 2016;34(4):571–7. WHO_TRS_inside_final_2018_after_Corr_round5.indd 93 24/04/2018 20:50 94 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 18. Durr S, Mindekem R, Kaninga Y, Moto DD, Meltzer MI, Vounatsou P et al. Effectiveness of dog rabies vaccination programmes: comparison of owner-charged and free vaccination campaigns. Epidemiol Infect. 2009;137(11):1558–67. 19. Birhane MG, Miranda ME, Dyer JL, Blanton JD, Recuenco S. Willingness to pay for dog rabies vaccine and registration in Ilocos Norte, Philippines (2012). PLoS Negl Trop Dis. 2016;10(3):e0004486. 20. Morters MK, McNabb S, Horton DL, Fooks AR, Schoeman JP, Whay HR et al. Effective vaccination against rabies in puppies in rabies endemic regions. Vet Rec. 2015;177(6):150. 21. Freuling CM, Hampson K, Selhorst T, Schröder R, Meslin FX, Mettenleiter TC et al. The elimination of fox rabies from Europe: determinants of success and lessons for the future. Phil Trans R Soc B. 2013;368(1623):20120142. 22. Estrada R, Vos A, De Leon R, Mueller T. Field trial with oral vaccination of dogs against rabies in the Philippines. BMC Infect Dis. 2001;1(1):23. 23. Smith TG, Millien M, Vos A, Fracciterne FA, Crowdis K, Chirodea C et al. Evaluation of immune responses in dogs to oral rabies vaccine under field conditions. Vaccine. 2017: doi: 10.1016/j.vaccine.2017.09.096. 24. Darkaoui S, Boué F, Demerson JM, Fassi Fihri O, Yahia KI, Cliquet F. First trials of oral vaccination with rabies SAG2 dog baits in Morocco. Clin Exp Vaccin Res. 2014;3(2):220–6. 25. Guidance for research on oral rabies vaccines and field application of oral vaccination of dogs against rabies. Geneva: World Health Organization; 2007. 26. Matter HC, Schumacher CL, Kharmachi H, Hammami S, Tlatli A, Jemli J et al. Field evaluation of two bait delivery systems for the oral immunization of dogs against rabies in Tunisia. Vaccine. 1998;16(7):657– 65. 27. Scientific Panel on Animal Health and Welfare (AHAW). Update on oral vaccination of foxes and raccoon dogs against rabies. EFSA J. 2015;13(7):4164. Doi: 10.2903/j.efsa.2015.4164. 28. Chapter 5.11: Model veterinary certificates for international movement of dogs, cats, and ferrets originating from countries considered infected with rabies. In: Terrestrial Animal Health Code. Paris: World Organisation for Animal Health; 2016 (http://www.oie.int/index. php?id=169&L=0&htmfile=chapitre_certif_rabies.htm). WHO_TRS_inside_final_2018_after_Corr_round5.indd 94 24/04/2018 20:50 Prevention and control of rabies in dogs 95 29. Chapter 8.14: Infection with rabies virus. In: Terrestrial Animal Health Code. Paris: World Organisation for Animal Health; 2016 (http://www. oie.int/index.php?id=169&L=0&htmfile=chapitre_aw_stray_dog.htm). 30. Taylor LH, Wallace RM, Balaram D, Lindenmayer JM, Eckery DC, Mutonono-Watkiss B et al. The role of dog population management in rabies elimination – a review of current approaches and future opportunities. Front Vet Sci. 2017;4:109. 31. Macpherson CNL, Meslin FX, Wandeler AI, editors. Dogs, zoonoses and public health. Second edition. Wallingford: CAB International; 2013. 32. Morters MK, Restif O, Hampson K, Cleaveland S, Wood JL, Conlan AJ. Evidence‐based control of canine rabies: a critical review of population density reduction. J Anim Ecol. 2013;82(1):6–14. 33. Background of the Meeting of Directors of National Programs for the Prevention and Control of Rabies (REDIPRA). São Bento: Pan American Foot-and-Mouth Disease Center; 2017 (http://www.paho.org/panaftosa/ index.php?option=com_content&view=article&id=798:antecedentes- de-la-redipra&Itemid=0). 34. From concept to completion (website). Geneva: World Health Organization; 2017 (http://www.who.int/neglected_diseases/news/ from-concept-to-completion-elimination-of-canine-rabies/en/). 35. Annual Report 2012. Dhaka: Communicable Disease Control Unit, Directorate General of Health Services, Ministry of Health and Family Welfare; 2012. 36. Annual report book. Atlanta (GA): Centers for Disease Control and Prevention; 2012. 37. Coleman PG, Dye C. Immunization coverage required to prevent outbreaks of dog rabies. Vaccine. 1996;14(3):185–6. WHO_TRS_inside_final_2018_after_Corr_round5.indd 95 24/04/2018 20:50 96 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 10. Prevention and control of rabies in wild animals Rabies is a viral zoonosis associated with many species of Carnivora and Chiroptera, which are the primary hosts of RABV. Only Chiroptera species are the primary hosts of almost all other lyssaviruses (see section 3). With progress in molecular approaches to the identification and phylogeny of virus variants, understanding of lyssavirus epidemiology has improved significantly. 10.1 Epidemiology and ecology of rabies in carnivore species Table 10 gives an overview of the epidemiology and ecology of rabies in carnivore species. It reflects documented cases of rabies transmission; undocumented transmission of rabies by other carnivore species remains possible. Table 10 Epidemiology and ecology of rabies in carnivore species Country or region Species in which rabies is documented Note (reference) Africa Domestic dog Primary hosts of RABV (1) Frequent RABV spillover threatens endangered wild African canids such as the Ethiopian wolf (C. simensis) and African wild dogs (Lycaon pictus) (2–4) Southern Africa Jackal (Canis adustus and C. mesomelas) Sustained transmission of canid RABV variant (5) Advanced surveillance (i.e. integrated bite case management) Bat-eared fox (Otocyon megalotis) Sustained transmission of canid RABV variant (6) Mongoose (Herpestidae family) Sustained transmission of RABV variant (7) Namibia Kudu (Tragelaphus strepsiceros) Canid RABV cause of significant mortality (8) Direct kudu–kudu oral transmission suspected Continental Asia Red fox (Vulpes vulpes) Found in forest–steppe and steppe zones Russian far east, northern China and Korean Peninsula Raccoon dog (Nyctereutes procyonoides) (9) WHO_TRS_inside_final_2018_after_Corr_round5.indd 96 24/04/2018 20:50 Prevention and control of rabies in wild animals 97 Country or region Species in which rabies is documented Note (reference) Southern China and Taiwan Ferret badger (Melogale moschata) Considered primary host for human rabies May be sole reservoir host in Taiwan (10) Israel, West Bank, Gaza Strip and Turkey Red fox (V. vulpes) Sustained RABV spillover from dogs led to recent emergence in Turkey (11) Islamic Republic of Iran, Oman, Saudi Arabia and Yemen Red fox (V. vulpes) Golden jackal (C. aureus) Increasing numbers of cases reported (12) Other countries in Middle East and Asia Red fox (V. vulpes) Limited phylogenetic evidence suggests that wildlife do not represent an independent transmission cycle in regions where dog rabies is endemic (13). Europe Red fox (V. vulpes) Northern, western and central Europe free (14, 15) Prevalent in eastern and south-eastern Europe Raccoon dog (N. procyonoides) Second most frequently reported infected species Presumed to act as another primary wildlife host (16) No predominant adapted variant identified North America Many primary RABV hosts and overlapping geographical ranges, which poses a challenge to animal rabies control. Each wild species maintains at least one predominant host-adapted RABV but may be infected with other RABV variants. Spillover to other wild and domestic animals is frequent in all areas. Red fox (V. vulpes) Oral vaccination important for control Grey fox (Urocyon cinereoargenteus) Primary host, particularly in southwest USA Eliminated in Texas by oral vaccination Coyote (Canis latrans) Eastern Canadian border, USA Raccoon (Procyon lotor) Primary host (17) WHO_TRS_inside_final_2018_after_Corr_round5.indd 97 24/04/2018 20:50 98 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Country or region Species in which rabies is documented Note (reference) Polar regions Arctic fox (V. lagopus) Primary host (17) Maintains host-adapted RABV variants of Arctic lineage Arctic-like RABV also found in central and South-East Asia (18, 19) Central plains, California Striped skunk (Mephitis mephitis) Primary host (20) Mexico Skunk (Spilogale spp.) Coati (Nasua nasua) Primary host South America Marmoset (Callithrix jacchus) Crab-eating fox (Cerdocyon thous) Kinkajou (Potus flavus) Coati Distinct viruses detected in several species (21–23) Wildlife surveillance insufficient to make major epidemiological inferences Further information available at http:// www.paho.org/panaftosa Caribbean islands, including Cuba, Dominican Republic, Grenada, Haiti and Puerto Rico Indian mongoose (Herpestes auropunctatus) Primary host 10.2 Epidemiology and ecology of rabies in bats Lyssaviruses have been detected in bats throughout the world, although different species are present in different regions (Table 11) (see also Table 3 in section 3). Bats have been identified as vectors for all Lyssavirus species except Mokola virus and Ikoma lyssavirus (see section 3), for which the true primary host are yet to be identified. This observation strongly suggests that bats are true primary hosts for lyssaviruses. Bats have several traits that are different from those of carnivore rabies hosts, such as small size, long life, low intrinsic population growth rates and a variety of well-defined ecological niches. Consequently, the properties of the lyssaviruses adapted to bats are assumed to be different from those that cause rabies in carnivores. The factors involved in maintenance of lyssaviruses in bats are still poorly understood. Little is known about lyssaviruses that have been isolated only once. WHO_TRS_inside_final_2018_after_Corr_round5.indd 98 24/04/2018 20:50 Prevention and control of rabies in wild animals 99 Table 11 Epidemiology and ecology of lyssaviruses in bats Lyssavirus Species in which lyssavirus is documented Note (reference) Rabies virus Haematophagous bats, including Common vampire bat (Desmodus rotundus) Insectivorous bats, including Silver-haired bat (Lasionycteris noctivagans) Big brown bat (Eptesicus fuscus) Free-tailed bat (Tadarida brasiliensis) Eastern tri-coloured bat (Perimyotis subflavus) Mouse-eared bats (Myotis spp.) Distinct variants Frequent spillover to terrestrial animals Major cause of human rabies (24) Lagos bat virus Eidolon helvum (Nigeria) Epomophorus spp. (South Africa) Other bat spp. (Central African Republic, Senegal and South Africa) Nycteris gambiensis (Gambia) No human cases reported to date Infrequent spillover to mammals reported (25) Surveillance and virus characterization probably insufficient Duvenhage virus Miniopterus spp. (South Africa) First isolated from a person in 1970 in Transvaal, South Africa Human cases of rabies due to Duvenhage lyssavirus were reported twice in South Africa (6) and once in The Netherlands (contracted in Kenya) (1) Shimoni bat virus Commerson leaf-nosed bat (Hipposideros commersoni) (Kenya) First detected in 2009 (26) Australian bat lyssavirus Frugivorous megabat spp.: Pteropidae poliocephalus P. alecto P. scapulatus P. conspicillatus Yellow-bellied sheath- tailed bat (Saccolaimus flaviventris) First detected in 1996 Three confirmed human deaths, in 1996, 1998 and 2013 Spillover to horses detected (20) WHO_TRS_inside_final_2018_after_Corr_round5.indd 99 24/04/2018 20:50 100 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Lyssavirus Species in which lyssavirus is documented Note (reference) European bat lyssavirus-1 Serotine bats (Eptesicus serotinus) Sporadic cases of rabies diagnosed in bats Surveillance in Europe remains heterogeneous (27) Three autochthonous human rabies fatalities confirmed: two in the Russian Federation (1977, 1985) and one in Finland (1985) (28) European bat lyssavirus-2 Myotis bats (M. dasycneme and M. daubentonii) One autochthonous human rabies fatality confirmed in Scotland (2002) (28) West Caucasian bat virus Common bent-wing bat (Miniopterus schreibersii) Isolated in the Russian Federation (2002) (29) Bokeloh bat lyssavirus Natterer’s bat (Myotis nattererii) Isolated in Germany (2010) and France (2012) Antigenically and genetically close to European bat lyssavirus-2 and Khujand virus (30) Lleida bat lyssavirus Miniopterus schreibersi Isolated on the Iberian Peninsula (2012) (31) Aravan virus Lesser mouse-eared bat (Myotis blythi) Isolated in an apparently healthy bat in Kyrgyzstan (1991) Khujand virus Whiskered bat (Myotis mystacinus) Isolated in Tajikistan (2001) (32) Irkut virus Tube-nosed bats (Murina spp.) Classified as a lyssavirus in 2002 One human rabies case reported in far- eastern Russian Federation (2007) (29) Gannoruwa bat lyssavirus Indian flying foxes (Pteropus medius) Isolated once in Sri Lanka (2014) (33) 10.2.1 Rabies in insectivorous bats in the Americas To date, all bat lyssaviruses in the Americas have been categorized as RABV. Since the elimination of dog-mediated rabies in North America, most autochthonous case fatalities in humans are caused by bat-associated RABV (23). Many genetically and antigenically distinct variants of RABV circulate in numerous species of insectivorous bats, several within a single species, and the geographical distribution of variants overlaps. There appears to be an inverse correlation between cross-species transmission and phylogenetic distance among insectivorous bat species (34). Spillover to terrestrial animals is observed frequently. WHO_TRS_inside_final_2018_after_Corr_round5.indd 100 24/04/2018 20:50 Prevention and control of rabies in wild animals 101 10.2.2 Vampire bat rabies Vampire bat-mediated rabies is a major public health problem in the subtropical and tropical areas of the Americas, from Mexico to Argentina. An RABV variant related to the other American bat viruses is maintained in haematophagous bats, mainly by different subpopulations of the common vampire bat (Desmodus rotundus) (see Table 11) (34), and is transmitted frequently to domestic animals and humans. During the past decade, the incidence of human infection with RABV spread by D. rotundus increased considerably in South America, especially in remote areas of the Amazon rainforest, where these bats commonly feed on humans (35). Vampire bat-transmitted bovine rabies also has a significant economic effect on the livestock industry. 10.3 Rabies in rodents Testing of tens of thousands of wild and synanthropic rodents in areas endemic for rabies across the world has revealed only exceptional instances of dead-end spillover of RABV infection. This indicates that rodents are not primary hosts and do not play a role in the transmission or maintenance of rabies. PEP is not indicated after a rodent bite (see section 8.3.2). 10.4 Wildlife species of special concern Frequent spillover of RABV from more abundant primary hosts (such as domestic dogs) is considered to contribute to possible extinction for several of the world’s most highly endangered carnivore species. Thus, rabies is a threat to conservation after outbreaks in highly endangered populations of Ethiopian wolves (Canis simensis) in the Bale Mountains National Park, in African wild dogs (Lycaon pictus) in eastern and southern Africa and in the Blanford’s fox (Vulpes cana) in Israel. Elimination of dog-mediated rabies would reduce the threat of disease and the risk of extinction of these endangered populations. Rabies has been recorded in wolves (Canis lupus) everywhere in the northern hemisphere where rabies occurs in wildlife; however, wolves become rabid only due to spillover infection and do not play a major role in rabies transmission. Although wolves are susceptible and readily succumb to the disease, they cannot sustain circulation of RABV independently of other wildlife, as wolf population densities and dynamics do not support epizootics and the highly territorial nature of wolves prevents ready spread of the disease from one pack to another. Once a pack member is infected, however, the disease can decimate the pack because of wolves’ highly social nature, with regular contact among the animals. The genetic make-up of RABV isolated from wolves is identical to that found in more abundant carnivore primary hosts in their vicinity (either domestic dogs or wild species). Although wolves are not a true primary reservoir, WHO_TRS_inside_final_2018_after_Corr_round5.indd 101 24/04/2018 20:50 102 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report wolves and most other carnivores (e.g. foxes, coyotes) can transmit RABV to other naive, susceptible hosts. Because they migrate over long distances, wolves that are incubating RABV are believed to reintroduce wildlife rabies into freed areas. 10.5 Elimination of rabies in wild carnivores 10.5.1 Reduction of animal populations Past strategies for elimination of wildlife rabies included reducing primary host density by culling, on the basis of the rationale that rabies transmission is density-dependent, disease incidence increasing proportionally with host density. Rabies transmission in wildlife may, however, be less dependent on density than was previously assumed; therefore, reducing host population density is unlikely to be effective in controlling or eliminating the disease (36). This conclusion is borne out by observations that widescale culling campaigns to reduce wild carnivore populations have failed to eliminate the disease (37). Reducing the primary host density is therefore not recommended as a means of controlling rabies in wildlife for humane, economic and ecological reasons. 10.5.2 Immunization Mass vaccination is a more effective control method than culling and is efficient for reducing disease incidence in all primary wildlife host species. The method emerged independently in Europe and North America, and the ORV strategy originally developed for foxes in the late 1970s has been used to eliminate fox rabies in large parts of northern, western and central Europe, Canada and the USA. Its success was due to the development of effective, safe vaccines, machine- made baits that are attractive to a variety of species, automated, computer- supported aerial bait distribution, adequate vaccination strategies and strong political commitment (17). An ORV strategy that works for one wild carnivore primary host species will not necessarily work for others. While adapted fox ORV strategies have been used quite successfully for other primary wildlife hosts, including coyotes, grey foxes and raccoon dogs, they require optimization for raccoons, for example (38). Other strategies are also needed for other primary wildlife hosts, such as mongooses and skunks. As ORV programmes are designed to eliminate wildlife rabies from a defined area or to prevent spread of the disease by creating an immunological barrier (containment, cordon sanitaire), they must result in sufficient herd immunity to reduce transmission (i.e. the effective reproductive rate of the disease falls below 1) in the target primary wild host. The level of herd immunity WHO_TRS_inside_final_2018_after_Corr_round5.indd 102 24/04/2018 20:50 Prevention and control of rabies in wild animals 103 required depends on the transmission dynamics of the disease in particular target species and populations and on local conditions. ORVs used in the field must fulfil the requirements of OIE and WHO as well as national or international regulatory authorities for biological products, i.e. immunogenicity, efficacy, safety and stability, and be licensed or registered (see section 9.2.3). Baits should be designed for each target wild animal species to ensure that the vaccine is released onto a susceptible target tissue (oropharyngeal mucosa or tonsils) to elicit an immune response. The bait casing should fulfil three functions: carry the attractant for the target species, contain a biomarkers used in baits (e.g. tetracycline) for assessment of bait uptake by the target population and protect the vaccine blister, capsule or sachet from ultraviolet light to ensure the stability of the virus titre. Specific requirements for bait casings are laid down in relevant standards (39). The bait must be thermostable in order to guarantee its palatability and the stability of the vaccine strain titre. It should be tested before marketing authorization at various temperatures under various field conditions of landscape, temperature and humidity (39). Vaccine baits distributed from the air should not break when they fall onto the ground. Warning labels should be printed on the blister or bait matrix. If oral rabies vaccine baits of proven efficacy, stability and bait-casing attractiveness are used, bait uptake and herd immunity in the target population depend on other factors, such as the baiting method, adequate spatial distribution of baits, timing and frequency of ORV campaigns and the abundance of bait competitors. 10.5.3 Planning, implementing and evaluating ORV programmes for wildlife Oral rabies vaccine has become the essential tool for preventing geographical spread and for controlling and eliminating rabies when the primary host is wildlife. An epidemiological assessment of the prevailing rabies situation based on results from reliable surveillance and laboratory studies of rabies cases in target and non-target species (wild and domestic) is the foundation of ORV programme planning. The basic requirements for planning, implementing and evaluating widescale vaccination campaigns or field trials are available online: https://rabiesblueprint.org/. ORV programmes should include a cost–benefit analysis for public health. Planning Strong political commitment is a prerequisite for any ORV programme to ensure its legal framework, planning, organization and evaluation, and an inclusive national rabies committee should be constituted. An effective ORV programme is based on a comprehensive plan that outlines the benefits, the objectives, roles (the agencies to be involved), responsibilities and chains of command as well as WHO_TRS_inside_final_2018_after_Corr_round5.indd 103 24/04/2018 20:50 104 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report infrastructure (laboratory requirements and equipment, cold chain), time frame of the programme, estimated costs and funding. The plan should also include information on the areas to be covered in consecutive years, taking into account the patterns of movement of wildlife populations, geographical characteristics, the rabies situation in neighbouring countries, the vaccination strategy (timing, mode of bait distribution, bait density, flight line distance), safety considerations and surveillance and monitoring of campaigns. The size of the target population should be estimated, with baseline levels of the biomarker (if applicable) in the target species before implementation of the programme. As a long-term, widescale approach is the most effective, the programme should be sustainable in the long term, with adequate financial, administrative and logistic support. ORV campaigns should continue for at least 2 years after the last confirmed case of rabies. WHO can provide the necessary expertise upon request. Implementation Adequate infrastructure and logistics should be available to guarantee optimal bait distribution (airports, aircraft, storage facility for baits, personnel) and eventual coverage over wide areas. The timing of ORV campaigns and the pattern of distribution of vaccine baits should be based on the biology and habitat of the target species and landscape features. ORV campaigns are usually conducted twice a year, in spring and in autumn, in temperate climate zones (Europe) or once a year in regions with a lower density of target species (North America) and subtropical climate zones (Mediterranean Basin). Bait is delivered mainly from fixed-wing aircraft or helicopters (38). Manual distribution should complement aerial distribution or may be the only way to distribute baits in densely populated or settled areas. Before vaccine bait is distributed, local meetings should be organized by the national rabies committee for all stakeholders, including hunters, trappers, wildlife service staff, forest officers, physicians, veterinarians and local authorities, to discuss the programme in detail and agree on the responsibilities of each. Press releases to inform the public should be issued, with information on the area to be covered by the programme, the timing of campaigns and appropriate measures to be taken in case of accidental exposure to the vaccine. Appropriate storage, transport conditions and cold-chain requirements should be strictly adhered to during handling and delivery of vaccine baits in the field. In Europe, for example, the optimal pattern for the distribution of vaccine bait is parallel flight lines approximately 500 m apart, although the flight line distances may be adapted according to the population density of the target species and landscape features. A global positioning system (GPS) and digital recording of flight routes and the coordinates of bait drops may be used during aerial distribution. WHO_TRS_inside_final_2018_after_Corr_round5.indd 104 24/04/2018 20:50 Prevention and control of rabies in wild animals 105 Adequate laboratory facilities and trained personnel should be available to conduct the recommended standard tests for routine diagnosis of rabies (see section 5) and for monitoring campaigns by detecting biomarkers, serology, virus titration and characterization of RABV isolates. Quality assurance systems should be in place. Evaluation The responsible authorities and personnel should be sensitized to the importance of adequate surveillance and monitoring of ORV campaigns. This includes sampling of specimens, timely reporting of rabies cases, database management, timely epidemiological data analysis and interpretation of results to monitor the progress of the vaccination campaign. Regular dissemination of information to stakeholders, including competent authorities, is crucial. Specialists should be assigned to investigate the prevailing and changing epidemiological situation in both humans and animals, evaluate the campaign and report regularly to the responsible authorities. National meetings should be held with all stakeholders to discuss the progress of the programme and any adaptation of the strategy that might be required for future campaigns. Surveillance and monitoring of the effectiveness of vaccination are important for assessing and adjusting vaccination campaigns. The incidence of rabies is the main indicator of the performance of any ORV programme and for certifying freedom from disease. A risk-based sampling scheme should be used, in which “indicator animals” that are ill, suspected of being rabid, have abnormal behaviour, are found dead or were involved in human exposure are examined. The number of animals should be sufficient to demonstrate a statistically acceptable degree of certainty (40). Surveillance should generally be conducted before, during and after distribution of vaccine, not only in the vaccination areas but also in neighbouring areas, particularly those free of rabies, in order to detect spread of the epizootic or re-infection as early as possible to ensure a swift response and countermeasures. RABV isolated from animals in the vaccination area should be characterized. The efficacy of ORV programmes with respect to bait uptake, seroprevalence and characterization of RABV isolates is measured by adequate sampling of hunted or trapped animals of the target species. In the USA, for example, the programme consists of pre- and post-bait serology and targeted (e.g. “roadkill” and reports of “nuisance” animals) public health surveillance. Reference zones for monitoring ORV campaigns should be selected in the vaccination area, in which a statistically sufficient, homogeneously distributed sample can be guaranteed in order to test for the presence of tetracycline (used in baits) and serological markers in the target species. WHO_TRS_inside_final_2018_after_Corr_round5.indd 105 24/04/2018 20:50 106 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Basic denominators, e.g. species, dates of finding and submission, location (latitude and longitude), age, sex, results of laboratory investigations (fluorescent antibody or cell culture isolation test, virus characterization, biomarker detection, serology) should be collected for all animals for epidemiological analyses, including temporal and spatial patterns. To eliminate rabies in wildlife, “progressive control pathways” and procedures for international certification of rabies-free status should be established. International cooperation International cooperation and coordination in planning, implementing and evaluating ORV programmes ensure success and cost–effectiveness. Contact should be made with neighbouring countries in deciding on a policy and should be maintained until the disease is eliminated. Regular multilateral meetings with representatives of the public health and veterinary authorities of neighbouring regions and countries ensure coordination of activities along common borders and transparency. Involvement of WHO collaborating centres, OIE reference laboratories and other international organizations is recommended. Presentation of the results of ORV programmes at international conferences helps maintain awareness and commitment to rabies elimination. Other options Strategic trapping of wild carnivores and releasing them after parenteral vaccination (trap–vaccinate–release) has been used with apparent success in some areas of North America, primarily for skunks and raccoons (39). 10.6 Control of rabies in bats Eliminating the disease in bats is challenged by the lack of effective vaccines against many of the lyssaviruses and lack of effective delivery systems for bat vaccination. Therefore, elimination of bat rabies not feasible. The public health risk associated with bat rabies (except that transmitted by vampire bats) is lower than that associated with rabies in carnivores, although the consequences of infection are also severe. Chiroptera play an important role in global ecology, such as in seed dispersal and pollination of many valuable plants, thereby restoring cleared or damaged rainforests and ensuring the production of fruit that support local economies and diverse animal populations. Furthermore, many of the more than 1300 bat species consume vast amounts of insects, including some of the most damaging agricultural pests. Therefore, any method for indiscriminate destruction of bats should be excluded, especially as nonhaematophagous bats are protected in most countries. WHO_TRS_inside_final_2018_after_Corr_round5.indd 106 24/04/2018 20:50 Prevention and control of rabies in wild animals 107 Education of the public is the key to preventing bat-transmitted human rabies. This should include basic information on avoiding potentially infectious contact with bats, seeking proper medical attention after exposure and preventing bats from establishing colonies in “sensitive” buildings such as hospitals and schools. Vampire bat-transmitted bovine rabies can be controlled by vaccinating cattle and by other sanitary measures, such as identifying, monitoring and georeferencing natural and artificial shelters of haematophagous bats. In national sanitary legislation in many Latin America countries, the approach to controlling vampire bat-transmitted rabies is to control the population of the primary host species, which has been successful in preventing rabies in cattle populations. Current strategies should be reviewed and updated, with studies to promote innovation in the control of haematophagous bats. As for other potential exposure to rabies, prompt PEP is recommended in cases of human exposure to vampire bats. Given the high exposure of some remote populations to vampire bat rabies, preventive vaccination of populations living in highly enzootic areas with limited access to anti-rabies biologicals should be considered. 10.7 Other public health measures The general public should be better advised to avoid direct contact with wildlife in general and with animals that are behaving abnormally and are sick in particular. Anyone bitten by a wild or domestic animal, particularly in areas where wildlife rabies is endemic, should seek medical attention (see section 8.3). In countries that have been declared free of terrestrial rabies, it is important that the public be aware that anyone potentially exposed to bat rabies should receive prompt PEP. Translocation of wildlife for any purpose except conservation should be banned or strongly discouraged. 10.8 References 1. Weyer J, Szmyd-Potapczuk AV, Blumberg LH, Leman PA, Markotter W, Swanepoel R et al. Epidemiology of human rabies in South Africa, 1983– 2007. Virus Res. 2011;155(1):283–90. 2. Haydon DT, Randall DA, Matthews L, Knobel DL, Tallents LA, Gravenor MB et al. Low-coverage vaccination strategies for the conservation of endangered species. Nature. 2006;443(7112):692. 3. Woodroffe R, Prager KC, Munson L, Conrad PA, Dubovi EJ, Mazet JA. Contact with domestic dogs increases pathogen exposure in endangered African wild dogs (Lycaon pictus). PloS One. 2012;7(1):e30099. WHO_TRS_inside_final_2018_after_Corr_round5.indd 107 24/04/2018 20:50 108 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 4. Johnson N, Mansfield KL, Marston DA, Wilson C, Goddard T, Selden D et al. A new outbreak of rabies in rare Ethiopian wolves (Canis simensis). Arch Virol. 2010;155(7):1175–7. 5. Zulu GC, Sabeta CT, Nel LH. Molecular epidemiology of rabies: focus on domestic dogs (Canis familiaris) and black-backed jackals (Canis mesomelas) from northern South Africa. Virus Res. 2009;140(1–2):71–8. 6. Sabeta CT, Mansfield KL, McElhinney LM, Fooks AR, Nel LH. Molecular epidemiology of rabies in bat-eared foxes (Otocyon megalotis) in South Africa. Virus Res. 2007;129(1):1–10. 7. Van Zyl N, Markotter W, Nel LH. Evolutionary history of African mongoose rabies. Virus Res. 2010;150(1–2):93–102. 8. Scott TP, Hassel R, Nel LH. Rabies in kudu (Tragelaphus strepsiceros). Berl Münch Tierärztl Wochenschr. 2012;125:226–41. 9. Shao XQ, Yan XJ, Luo GL, Zhang HL, Chai XL, Wang FX et al. Genetic evidence for domestic raccoon dog rabies caused by Arctic-like rabies virus in Inner Mongolia, China. Epidemiol Infect. 2011;139(4):629–35. 10. Chang JC, Tsai KJ, Hsu WC, Tu YC, Chuang WC, Chang CY et al. Rabies virus infection in ferret badgers (Melogale moschata subaurantiaca) in Taiwan: a retrospective study. J Wildl Dis. 2015;51(4):923–8. 11. Vos A, Freuling C, Eskiizmirliler S, Ün H, Aylan O, Johnson N et al. Rabies in foxes, Aegean region, Turkey. Emerg Infect Dis. 2009;15(10):1620. 12. Aylan O, El-Sayed AF, Farahtaj F, Janani AR, Lugach O, Tarkhan-Mouravi O et al. Report of the first meeting of the Middle East and Eastern Europe rabies expert bureau, Istanbul, Turkey (June 8–9, 2010). Adv Prev Med. 2011;2011:812515. 13. Horton DL, McElhinney LM, Freuling CM, Marston DA, Banyard AC, Goharrriz H et al. Complex epidemiology of a zoonotic disease in a culturally diverse region: phylogeography of rabies virus in the Middle East. PLoS Negl Trop Dis. 2015;9(3):e0003569. 14. Cliquet FE. Picard-Meyer E, Robardet E. Rabies in Europe: what are the risks? Milton Park: Taylor & Francis; 2014:905–8. WHO_TRS_inside_final_2018_after_Corr_round5.indd 108 24/04/2018 20:50 Prevention and control of rabies in wild animals 109 15. Freuling CM, Hampson K, Selhorst T, Schröder R, Meslin FX, Mettenleiter TC et al. The elimination of fox rabies from Europe: determinants of success and lessons for the future. Phil Trans R Soc B. 2013;368(1623):20120142. 16. Bourhy H, Kissi B, Audry L, Smreczak M, Sadkowska-Todys M, Kulonen K et al. Ecology and evolution of rabies virus in Europe. J Gen Virol. 1999;80(10):2545–57. 17. Rupprecht CE, Barrett J, Briggs D, Cliquet F, Fooks AR, Lumlertdacha B et al. Can rabies be eradicated?. Dev Biol (Basel). 2008;131:95–121. 18. Nadin-Davis SA, Sheen M, Wandeler AI. Recent emergence of the Arctic rabies virus lineage. Virus Res. 2012;163(1):352–62. 19. Kuzmin IV, Hughes GJ, Botvinkin AD, Gribencha SG, Rupprecht CE. Arctic and Arctic-like rabies viruses: distribution, phylogeny and evolutionary history. Epidemiol Infect. 2008;136(4):509–19. 20. Gould AR, Kattenbelt JA, Gumley SG, Lunt RA. Characterisation of an Australian bat lyssavirus variant isolated from an insectivorous bat. Virus Res. 2002;89(1):1–28. 21. Vargas-Linares E, Romaní-Romaní F, López-Ingunza R, Arrasco- Alegre J, Yagui-Moscoso M. Rabia en Potos flavus identificados en el departamento de Madre de Dios, Perú [Rabies identified in Potos flavus in the province of Madre de Dios, Peru]. Rev Peru Med Exp Salud Publica. 2014;31(1):88–93. 22. Aréchiga-Ceballos N, Velasco-Villa A, Shi M, Flores-Chávez S, Barrón B, Cuevas-Domínguez E et al. New rabies virus variant found during an epizootic in white-nosed coatis from the Yucatan Peninsula. Epidemiol Infect. 2010;138(11):1586–9. 23. Condori-Condori RE, Streicker DG, Cabezas-Sanchez C, Velasco-Villa A. Enzootic and epizootic rabies associated with vampire bats, Peru. Emerg Infect Dis. 2013;19(9):1463. 24. De Serres G, Dallaire F, Côte M, Skowronski DM. Bat rabies in the United States and Canada from 1950 through 2007: human cases with and without bat contact. Clin Infect Dis. 2008;46(9):1329–37. 25. Markotter W, Van CE, Kuzmin IV, Rupprecht CE, Paweska JT, Swanepoel R et al. Epidemiology and pathogenicity of African bat lyssaviruses. Dev Biol (Basel). 2008;131:317–25. WHO_TRS_inside_final_2018_after_Corr_round5.indd 109 24/04/2018 20:50 110 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 26. Kuzmin IV, Mayer AE, Niezgoda M, Markotter W, Agwanda B, Breiman RF et al. Shimoni bat virus, a new representative of the Lyssavirus genus. Virus Res. 2010;149(2):197–210. 27. Schatz J, Fooks AR, McElhinney L, Horton D, Echevarria J, Vázquez‐ Moron S et al. Bat rabies surveillance in Europe. Zoonoses Public Health. 2013;60(1):22–34. 28. Banyard AC, Hayman D, Johnson N, McElhinney L, Fooks AR. Bats and lyssaviruses. Adv Virus Res. 2011;79:239–89. 29. Kuzmin IV, Hughes GJ, Botvinkin AD, Orciari LA, Rupprecht CE. Phylogenetic relationships of Irkut and West Caucasian bat viruses within the Lyssavirus genus and suggested quantitative criteria based on the N gene sequence for lyssavirus genotype definition. Virus Res. 2005;111(1):28–43. 30. Picard-Meyer E, Servat A, Robardet E, Moinet M, Borel C, Cliquet F. Isolation of Bokeloh bat lyssavirus in Myotis nattereri in France. Arch Virol. 2013;158(11):2333–40. 31. Ceballos NA, Morón SV, Berciano JM, Nicolás O, López CA, Juste J et al. Novel lyssavirus in bat, Spain. Emerg Infect Dis. 2013;19(5):793. 32. Kuzmin IV, Orciari LA, Arai YT, Smith JS, Hanlon CA, Kameoka Y et al. Bat lyssaviruses (Aravan and Khujand) from Central Asia: phylogenetic relationships according to N, P and G gene sequences. Virus Res. 2003;97(2):65–79. 33. Gunawardena PS, Marston DA, Ellis RJ, Wise EL, Karawita AC, Breed AC et al. Lyssavirus in Indian flying foxes, Sri Lanka. Emerg Infect Dis. 2016;22(8):1456. 34. Streicker DG, Recuenco S, Valderrama W, Benavides JG, Vargas I, Pacheco V et al. Ecological and anthropogenic drivers of rabies exposure in vampire bats: implications for transmission and control. Proc R Soc B. 2012;279(1742):3384–92). 35. Schneider MC, Romijn PC, Uieda W, Tamayo H, Silva DF, Belotto A et al. Rabies transmitted by vampire bats to humans: an emerging zoonotic disease in Latin America? Rev Panam Salud Publica. 2009;25(3):260–9. 36. Morters MK, Restif O, Hampson K, Cleaveland S, Wood JL, Conlan AJ. Evidence‐based control of canine rabies: a critical review of population density reduction. J Anim Ecol. 2013;82(1):6–14. WHO_TRS_inside_final_2018_after_Corr_round5.indd 110 24/04/2018 20:50 Surveillance of rabies 111 37. King AA, Fooks AR, Aubert M, Wandeler AI. Historical perspective of rabies in Europe and the Mediterranean Basin. Paris: World Organisation for Animal Health; 2004. 38. Slate D, Algeo TP, Nelson KM, Chipman RB, Donovan D, Blanton JD et al. Oral rabies vaccination in North America: opportunities, complexities, and challenges. PLoS Negl Trop Dis. 2009;3(12):e549. 39. Scientific Panel on Animal Health and Welfare (AHAW). Update on oral vaccination of foxes and raccoon dogs against rabies. EFSA J. 2015;13(7):4164. Doi: 10.2903/j.efsa.2015.4164. 40. Cliquet F, Freuling C, Smreczak M, Van der Poel WH, Horton D, Fooks AR et al. Development of harmonised schemes for monitoring and reporting of rabies in animals in the European Union. Scientific report submitted to EFSA. Parma: European Food Safety Authority; 2010 (https://www.efsa.europa.eu/en/supporting/pub/67e). 11. Surveillance of rabies Effective control and elimination of a disease require effective surveillance. Public health surveillance consists of continuous, systematic collection, analysis, interpretation and dissemination of information on health events (1, 2). Its aim may be to demonstrate the presence and distribution of the disease in humans and animals as part of control, improve awareness of the situation or, ultimately, document the absence of disease (3). According to this definition, surveillance is always linked to specific control activities and immediate response and is therefore distinct from monitoring. Monitoring is conducted intermittently and consists of analysis of routine processes within a surveillance system or intervention. In rabies control, monitoring may include cross-sectional measurements of animal populations and vaccination coverage, observation of marks applied to dogs during mass parenteral vaccination or bait uptake after oral vaccination campaigns (4). Less systematic monitoring may include cross-sectional measurements of animal populations and vaccination coverage in certain activities. Further details of monitoring in ORV programmes and enhanced surveillance of wildlife are given in section 10. The capacity to detect, assess, notify and report on health events is a critical component of the International Health Regulations (2005) (5) and a principle of high-quality veterinary services. WHO_TRS_inside_final_2018_after_Corr_round5.indd 111 24/04/2018 20:50 112 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 11.1 Surveillance systems The design and implementation of a surveillance system should be customized to stated public health objectives or interventions (6, 7). With respect to rabies, the interventions should be adapted to the epidemiology of the disease and capacity in the areas of study. During the endemic phase, if there is no systematic rabies control, the main objective should be to determine the disease burden in humans and animals spatiotemporally and in populations at risk. In practice, surveillance at this stage may be passive, as cases are likely to be detected even if fewer humans or animals are evaluated, because of the high incidence of disease. Other than the diagnostic tests for animals involved in human exposure, those described in section 5 and in Chapter 2.1.17 of the OIE Manual of diagnostic tests and vaccines for terrestrial animals (8) may be used to supplement “gold-standard” diagnostics, such as direct fluorescent antibody and direct rapid immunohistochemical tests, to increase the case detection rate when resources or logistics might otherwise make confirmatory testing impossible (9). The objectives of surveillance should be adapted as rabies control programmes are established in an area. In addition to continued passive public health surveillance, targeted, active monitoring is necessary to verify animal vaccination and other interventions. Use of more sensitive, gold-standard diagnostic tests and ensuring the proficiency of the staff who conduct the tests become increasingly important as control is extended. The quality of surveillance data is directly related to its use to inform management decisions about interventions. As control activities reduce the number of human rabies cases to zero (validation) and eventually result in elimination of rabies in the targeted animals (verification), additional surveillance will be necessary, as discussed in section 12. Regardless of the state of rabies control, the probability of detecting rabies during surveillance is a function of its incidence, the level of awareness and vigilance and also appropriate infrastructure and logistics to collect and transport samples to confirm rabies. To promote awareness and vigilance and to ensure that rabies is recognized as a priority, human and animal rabies must be notifiable nationally. Standard case definitions (Tables 12 and 13) should be disseminated widely by national health and veterinary services. Surveillance data should be reported through appropriate channels according to published protocols to facilitate timely data-sharing and analysis, when possible through existing national electronic surveillance or health management information systems for infectious disease reporting. WHO_TRS_inside_final_2018_after_Corr_round5.indd 112 24/04/2018 20:50 Surveillance of rabies 113 Table 12 Animal case definitions and corresponding surveillance activity Case Definition Surveillance activity Suspected A case that is compatible with a clinical case definition of animal rabies Clinical case definition: An animal that presents with any of the following signs (10, 14) ■ hypersalivation, ■ paralysis, ■ lethargy, ■ unprovoked abnormal aggression (biting two or more people or ani- mals and/or inanimate objects), ■ abnormal vocalization and ■ diurnal activity of noc- turnal species Notify appropriate local authorities of a suspected rabid animal. Collect the primary history of an animal if available (ownership status, vaccination status, previous exposure, date of onset of signs) (see Annex 2). Collect central nervous system samples for laboratory diagnosis, if available. Probable A suspected case plus a reliable history of contact with a suspected, probably or confirmed rabid animal and/or An animal with suspected rabies that is killed, died or disappears within 4–5 days of observation of illness Systematically record secondary information, and link to primary history. Notify the appropriate authorities according to national protocols. Confirmed A suspected or probable animal case confirmed in a laboratorya Notify the appropriate authorities for follow-up of any human or animal exposure. Systematically record laboratory diagnosis, and link with case record. Not a case A suspected or probable case that is ruled out by laboratory tests or epidemiological investigation (i.e. appropriate quarantine period in eligible animals). Notify the appropriate authorities for follow-up of any human or animal exposure. Systematically record laboratory diagnosis, and link with primary history. a Laboratory confirmation should be performed with a standard diagnostic test, as defined by WHO (see section 5) or the OIE manual (8). If other diagnostic tests are used, depending on their sensitivity and specificity, confirmation with a validated secondary test may be required, particularly in the case of negative results. WHO_TRS_inside_final_2018_after_Corr_round5.indd 113 24/04/2018 20:50 114 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Table 13 Human case definitions and corresponding surveillance activity Case Definition Surveillance activity Suspected A case that is compatible with the clinical case definition: a person presenting with an acute neurological syndrome (i.e. encephalitis) dominated by forms of hyperactivity (furious rabies) or a paralytic syndrome (paralytic rabies) that progresses towards coma and death, usually due to cardiac or respiratory failure, typically within 7–10 days of the first sign if no intensive care is instituted. The syndrome may include any of the following signs: aerophobia, hydrophobia, paraesthesia or localized pain, dysphagia, localized weakness, nausea or vomiting. Notify the appropriate local authorities according to national protocols. Collect appropriate samples from the patient according to national protocols. Conduct a verbal autopsy to collect a case history for the patient for further characterization (Annex 11). Probable A suspected case plus a reliable history of contact with a suspected, probably or confirmed rabid animal (see Table 12). Identify contacts of the patient and/or animal involved for follow-up. Confirmed A suspected or probable case that is confirmed in a laboratory.a Systematically record the laboratory diagnosis and link with verbal autopsy information. Notify the appropriate authorities of a confirmed human rabies case according to national protocols. a Ante-mortem diagnosis of human rabies depends on the samples collected and the diagnostic tests available (see section 5). The minimum epidemiological indicators to be provided by rabies surveillance are information on the annual incidence of the disease in both humans and animals and the incidence of PEP (as a proxy for suspected and confirmed exposure to rabies) (Table 14). Measures of incidence are essential in WHO_TRS_inside_final_2018_after_Corr_round5.indd 114 24/04/2018 20:50 Surveillance of rabies 115 rabies control and prevention to ensure appropriate management of cases and outbreaks, to monitor trends, to evaluate the effectiveness of interventions and to estimate the burden of disease. Measurement of rabies-specific antibodies is not recommended for routine rabies surveillance. Table 14 Monitoring use of human rabies post-exposure prophylaxis Exposure or PEP category Surveillance activity Suspected exposure Person presenting for health care with a history of a bite, scratch or contact with infectious material from a suspected, probably or confirmed rabid animal (see Table 12). Assess risk (see section 8) according to national protocols to determine whether additional investigation is required. PEP received PEP has been recommended for the person with suspected exposure. and The person has received at least one dose of rabies vaccine and/or rabies immunoglobulin. The appropriate authorities notified according to national standard protocol. As indicated by protocols, investigation of exposure to identify the suspected rabid animal and whether other people or animals were exposed. Systematic recording of information from the investigation. Systematic recording of information on the patient receiving PEP, including basic demographics and the date biologicals were received, until completed or lost to follow-up. PEP not received A person with suspected exposure who has been recommended for PEP and A person who did not receive rabies vaccine or rabies immunoglobulin When indicated, initiate investigation of suspected exposure in order to document why PEP was not initiated and to identify suspected rabid animals and further exposure. Appropriate authorities notified according to the national standard protocol. Optimal surveillance will target all cases of suspected human and animal rabies. Case definitions should facilitate systematic recognition of suspected cases and further categorization of cases on the basis of clinical, epidemiological and diagnostic features. Surveillance protocols should specify the activities required for each case classification (e.g. suspected case is identified, local health authorities notified, primary data collection started). Surveillance and case management WHO_TRS_inside_final_2018_after_Corr_round5.indd 115 24/04/2018 20:50 116 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report protocols should be circulated to the relevant people and officials in the reporting structure. Diagnostic confirmation is the gold standard for human and animal cases, although clinical cases may also be confirmed by verbal autopsy (Annex 11) for human cases and by evaluating dogs according to the case definitions (Table 12) and on the investigation form (Annex 12). Active surveillance of healthy animals to which human exposure has not been reported rarely returns valuable surveillance data, because large numbers of animals must be tested to identify a single rabies case. When the large number of negative animals is aggregated into passive surveillance data, the proportion of cases observed among animals at higher risk (e.g. involved in human exposures, “roadkill”) may be diluted, suggesting a lower overall risk of exposure to rabies if not interpreted correctly. Animal health professionals (e.g. private and public veterinarians, veterinary paraprofessionals, animal control officers and game wardens) are those most likely to see a clinically rabid animal in a professional setting. They are also most likely to be engaged in animal rabies surveillance at community level, where cases are first identified. They should be aware of the clinical signs in a suspected case, methods for sample collection and the process for reporting. All components typically intersect when a person has been bitten by a suspected rabid animal. “Integrated bite case management” involves conducting investigations of suspected rabid animals and sharing information with both animal and human health investigators for appropriate risk assessments (section 8). Such programmes are resource intensive but ultimately help to prevent human deaths from rabies by active identification of suspected exposure (particularly in areas endemic for dog-mediated rabies) and can improve the overall quality of surveillance (10, 12). Bites should trigger immediate triage, including determining the vaccination status of the biting animal and follow- up if rabies is suspected, such as by observing the animal (10 days for cats and dogs) or testing post mortem. Furthermore, a timely response by medical and veterinary staff in the field ensures appropriate management and follow-up of cases and improves case detection rates; it can also motivate field and hospital staff to continue reporting cases. The response should include prompt feedback on reports and diagnostic test results, advice on management of cases and rabies control measures to be taken. In countries where rabies control programmes are well established, integrated bite case management may ensure more targeted use of PEP on the basis of risk assessments and diagnostic input, thus reducing administration of PEP for low-risk exposure. WHO_TRS_inside_final_2018_after_Corr_round5.indd 116 24/04/2018 20:50 Surveillance of rabies 117 In addition to routine reporting, epidemiological analysis of surveillance data allows estimation of trends and spatial dynamics; understanding of trends by species (including humans) is the foundation for any intervention programme. Such analyses should be done routinely (e.g. monthly) and more detailed reports at least annually. The basic trends should be estimated for the numbers of investigations and cases (for human PEP, rabid humans and rabid animals, see Tables 12–14). Maps of surveillance data should be drawn to identify the distribution of cases. When possible, both cases and non-cases reported to the surveillance system should be mapped in order to identify any gaps in surveillance coverage that might be responsible for a lack of observed cases. More detailed reports should include control activities and their impact on the rabies burden. The surveillance system should also be monitored and evaluated routinely to determine whether the surveillance objectives are being achieved and to improve the overall system (1, 5). Routine monitoring may include assessment of the timeliness and completeness of monthly reporting. Action should be taken when deficiencies are identified to ensure that annual results can be analysed promptly and accurately. Surveillance systems should periodically be evaluated more extensively (e.g. every few years or if the objectives change) to ensure that they are operating efficiently and delivering high-quality data that are useful for public health interventions. Guidelines for evaluating a public health surveillance system have been published (1). In all situations and particularly in areas in which elimination is the aim, routine characterization of virus isolates from human and animal cases is encouraged in order to identify the sources of infection and their geographical origin (13). Surveillance of humans and animals should be maintained even after elimination, with viral characterization to document importation of rabies or unrecognized domestic circulation of rabies (3). 11.2 Global reporting Timely notification of animal rabies cases to the OIE through the World Animal Health Information System (www.oie.int/wahid) is a legal obligation of OIE members (3). For transparency and to allow comparison and aggregation of global data for advocacy, national data should be shared with other regional and global reporting systems, such as the WHO Global Health Observatory (http://www.who.int/gho/neglected_diseases/rabies/en/), the WHO District Health Information Software system (version 2; DHIS2) and other regional databases, such as the Rabies Bulletin Europe (http://www.who-rabies-bulletin. WHO_TRS_inside_final_2018_after_Corr_round5.indd 117 24/04/2018 20:50 118 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report org/); the Regional Information System for Epidemiological Surveillance of Rabies (SIRVERA; sirvera.panaftosa.org.br/index.php) and the System of Epidemiological Inormation on Rabies (SIEPI) in Latin America; and the Rabies epidemiological bulletin of the Pan-African Rabies Control Network (PARACON) in Africa (paracon.rabiesalliance.org/bulletin/). A template has been prepared for recording minimum data for indicators (Annex 13). It can be completed online by downloading it at: http://www.who.int/ rabies/advancing_global_rabies_data_collection/en/. It is part of an integrated platform for surveillance and control of neglected tropical diseases (based on DHIS2)  to facilitate integration of disease-specific surveillance activities into a more efficient, sustainable health information system. Many  programmes  of the Neglected Tropical Diseases and other WHO departments, including on tuberculosis, HIV/AIDS, malaria, health information systems and information management and technology, collaborate to build in-house capacity and support integration. At global level, the system will act as a data warehouse for good- quality data and permit the identification and analysis of trends and monitoring and evaluation of all programmes at a single site. The platform will also contribute to validation or verification of elimination goals (see section 12). Publicly available data will continue to be displayed on the Global Health Observatory. When possible, the operators of these global and regional reporting systems should collaborate to improve interoperability among the systems in order to reduce redundant data requests and entries by national authorities. 11.3 References 1. German RR, Lee LM, Horan J, Milstein R, Pertowski C, Waller M. Updated guidelines for evaluating public health surveillance systems. MMWR Recomm Rep. 2001;50 (1–35). 2. Kasolo F, Yoti Z, Bakyaita N, Gaturuku P, Katz R, Fischer JE et al. IDSR as a platform for implementing IHR in African countries. Biosecur Bioterror. 2013;11(3):163–9. 3. Section 1. Animal disease diagnosis, surveillance and notification. In: Terrestrial Animal Health Code. Paris: World Organisation for Animal Health; 2016. 4. Cliquet F, Freuling C, Smreczak M, Van der Poel WH, Horton D, Fooks AR et al. Development of harmonised schemes for monitoring and reporting of rabies in animals in the European Union. Scientific report submitted to EFSA. Parma: European Food Safety Authority; 2010 (https://www.efsa.europa.eu/en/supporting/pub/67e). WHO_TRS_inside_final_2018_after_Corr_round5.indd 118 24/04/2018 20:50 Surveillance of rabies 119 5. International Health Regulations (2005). Geneva: World Health Organization; 2005 (http://apps.who.int/iris/bitstre am/10665/246107/1/9789241580496-eng.pdf?ua=1). 6. Technical guidelines for integrated disease surveillance and response in the African Region. Second edition. Brazzaville: WHO Regional Office for Africa; 2010 (http://www.afro.who.int/publications/technical- guidelines-integrated-disease-surveillance-and-response-african- region-0). 7. Thulke HH, Eisinger D, Freuling C, Fröhlich A, Globig A, Grimm V et al. Situation-based surveillance: adapting investigations to actual epidemic situations. J Wildl Dis. 2009;45(4):1089–103. 8. Chapter 2.1.17: Rabies (infection with rabies virus). In: Manual of diagnostic tests and vaccines for terrestrial animals, Vol. 2. Paris: World Organisation for Animal Health; 2016. 9. Duong V, Tarantola A, Ong S, Mey C, Choeung R, Ly S et al. Laboratory diagnostics in dog-mediated rabies: an overview of performance and a proposed strategy for various settings. Int J Infect Dis. 2016;46:107–14. 10. Undurraga EA, Meltzer MI, Tran CH, Atkins CY, Etheart MD, Millien MF et al. Cost–effectiveness evaluation of a novel integrated bite case management program for the control of human rabies, Haiti 2014–2015. Am J Trop Med Hyg. 2017;96(6):1307–17. 11. Rabies (infection with rabies virus). Chapter 2.1.17. Manual of diagnostic tests and vaccines for terrestrial animals. Vol. 2. Paris: World Organisation for Animal Health; 2017. 12. Wallace RM, Reses H, Franka R, Dilius P, Fenelon N, Orciari L et al. Establishment of a canine rabies burden in Haiti through the implementation of a novel surveillance program. PLoS Negl Trop Dis. 2015;9(11):e0004245. 13. Mollentze N, Weyer J, Markotter W, Le Roux K, Nel LH. Dog rabies in southern Africa: regional surveillance and phylogeographical analyses are an important component of control and elimination strategies. Virus Genes. 2013;47(3):569–73. 14. Tepsumethanon V, Wilde H, Meslin FX. Six criteria for rabies diagnosis in living dogs. J Med Assoc Thai. 2005 Mar 1;88(3):419–22. WHO_TRS_inside_final_2018_after_Corr_round5.indd 119 24/04/2018 20:50 120 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 12. Reaching zero human deaths from rabies With a global target of zero human deaths due to dog-mediated rabies by 2030, worldwide, harmonized processes are required to acknowledge and measure country progress towards this goal (1). The processes must allow for differing states of advancement, i.e. some countries have yet to reach zero human rabies deaths (see validation, below), while others have, or are close to, interrupting rabies disease transmission. Fig. 5 is based on country data and shows rabies elimination (in terms of canine and human rabies cases) in a continuum of five phases, from endemicity, to elimination, to maintaining freedom from disease. “Endemic” indicates the number of confirmed rabies cases per month in an endemic country with limited control measures in place. “Control” indicates a steep decrease in rabies incidence after mass interventions. “Zero Human Deaths” shows interruption of dog–human rabies transmission and no human deaths. “Elimination” shows interruption of rabies transmission and no canine cases. “Maintenance” refers to continuing freedom from disease, e.g. by preventing incursion and/or re- emergence of canine or human rabies. Figure 5 Progression of countries from endemic rabies to elimination of dog-mediated rabies by implementation of sustained mass dog vaccination programmes WHO_TRS_inside_final_2018_after_Corr_round5.indd 120 24/04/2018 20:50 Surveillance of rabies 121 This aim of this section is to define activities that allow countries to: ■ Validate elimination of rabies as a public health problem, i.e. reaching zero human rabies deaths, defined as the absence of a human death from dog-mediated rabies for at least 24 months in a country that is operating and continues to maintain adequate surveillance for rabies and demonstrates an effective rabies control programme in human and animal populations. The occurrence of cases caused by rabies variants other than canine rabies should not preclude validation of reaching zero human rabies deaths or verification of interrupting ra- bies transmission. Validation of reaching zero human rabies deaths will be conducted by WHO in a desk review of evidence (see section 12.3 and Annex 14). ■ Verify elimination of dog-mediated rabies, i.e. interrupting rabies transmission, defined as the absence of dog-mediated rabies cases for a period of at least 24 months in the presence of high-quality surveil- lance according to international standards. The proposed procedures for verification of the interruption of rabies disease transmission are being discussed with the international organizations involved (see section 12.4 and Annex 14). ■ Be declared rabies-free, which follows from verification, and recog- nizes countries or areas that are free of both dog rabies and terrestrial rabies. The aim of these definitions is to assist public health authori- ties in assessing the risk for contracting rabies after contact with ani- mals. They differ from the current OIE definition of rabies-free coun- tries for the purpose of animal movement (2). A country or area that is free of dog rabies is one in which: ■ No case of indigenously acquired infection due to dog-mediated RABV has been confirmed in humans, dogs or cats or any other ani- mal species at any time during the previous 24 months. ■ Any autochthonous positive case was shown by molecular charac- terization and epidemiological investigation to be a spillover from wildlife. If an imported case in carnivores is confirmed, the status of the country or area shall not be affected if molecular characterization confirms the non-indigenous source of the virus, and epidemiologi- cal tracing backwards and forwards reveals no evidence of secondary dog infections. WHO_TRS_inside_final_2018_after_Corr_round5.indd 121 24/04/2018 20:50 122 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report A country or area that is free of terrestrial rabies is one in which: ■ No case of indigenously acquired infection due to dog-mediated RABV or wild carnivore RABV has been confirmed in humans or any domestic or wild animal species (excluding bats) at any time during the previous 24 months. ■ Any autochthonous positive case was shown by molecular characteri- zation and epidemiological investigation to be a spillover from bats (both bat rabies variants and bat lyssaviruses). If an imported case is confirmed, the status of the country or area shall not be affected if a risk assessment and/or molecular characterization confirms the nonindigenous source of the virus and epidemiological tracing backwards and forwards reveals no evidence of secondary infections in any wild or domestic carnivore. Laboratory-confirmed infection in some wild animals (e.g. mongooses) should be considered an indicator of the presence and circulation of rabies. 12.1 Core elements of validation, verification and rabies-freedom Measures to validate rabies freedom must be underpinned by robust evidence and data that can be assessed independently, as premature cessation of control could result in resurgence of the disease, with major public health, economic and political ramifications. The core requirements for validation, verification and rabies-freedom are as follows. ■ Rabies in all animal species and humans is notifiable. ■ Continuous, effective surveillance is in operation and meets WHO and OIE standards for surveillance and diagnostic testing (see sec- tions 5 and 11). ■ Adequate, targeted sampling is performed among the main suscepti- ble domestic and wild animal species throughout the country. ■ A national rabies control strategy (with mass dog vaccination and ac- cess to human PEP) has been effective in controlling rabies. ■ Measures to prevent importation of rabies-infected animals are in place (see section 9.3). WHO_TRS_inside_final_2018_after_Corr_round5.indd 122 24/04/2018 20:50 Surveillance of rabies 123 Sections 12.2 and 12.3 provide more detailed summaries of the proposed processes for validation and verification, respectively. Regional platforms for data collection ensure consistency among regions and sufficiency for both validation and verification, e.g. European rabies bulletin, the Rabies epidemiological bulletin of the Pan-African Rabies Control Network (PARACON) and the Regional Information System for Epidemiological Surveillance of Rabies in Latin America. Timely notification to OIE through the World Animal Health Information System and, when appropriate, to regional platforms for data collection is required. These platforms should support submission of data on essential indicators for validation and verification and also provide a valuable repository of dossiers containing information for other countries and regions. The objective of all countries in endemic regions is to reach zero human rabies deaths and, ultimately, to interrupt dog-mediated rabies transmission nationally and then regionally. As in the model for poliomyelitis, annual regional meetings could be held to review rabies-free documentation submitted by national programme coordinators or relevant OIE delegates after 2 years without detection of a case under enhanced surveillance, leading to regional verification of interrupting rabies disease transmission. 12.2 Validation of zero human deaths from rabies Indicator: Absence of human deaths from rabies for 24 months For a country to be recognized internationally as having eliminated rabies as a public health problem, with zero human deaths over 24 months, rabies must be notifiable in humans and animals, and the country must provide evidence of: ■ an effective national rabies control and elimination strategy; ■ a decrease in the number of dog rabies cases due to implementation of the national rabies control and elimination strategy; and ■ a decrease in the number of human deaths from rabies due to im- plementation of the national rabies control and elimination strategy. If a country has verified interruption of transmission of dog-mediated rabies (see below), it will be considered also to have validated elimination of rabies as a public health problem. Annex 14 presents a draft template for the proposed documentation required to validate reaching zero human deaths from rabies. WHO_TRS_inside_final_2018_after_Corr_round5.indd 123 24/04/2018 20:50 124 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 12.3 Verification of interruption of rabies transmission The following is proposed as a means of verifying the interruption of rabies transmission; however, the requirements for verification remain under discussion. Indicator: Absence of dog-mediated rabies cases for 24 months For a country to be recognized internationally as having eliminated dog- mediated rabies, rabies must be notifiable in humans and animals, the country should be able to document the absence of dog-mediated rabies cases (i.e. the absence of animal cases due to a canine RABV variant) for at least 24 months and provide evidence: ■ of a post-elimination strategy or contingency plan that covers access to dog vaccine and PEP, procedures for surveillance and epidemio- logical investigation of any introduction of rabies from other coun- tries or regions; ■ that the decrease in the number of cases of dog-mediated animal ra- bies to zero is due to implementation of the national rabies elimina- tion strategy; and ■ maintenance of zero dog-mediated human rabies cases. Given the time required for verification, countries are recommended to first self-declare freedom from dog-mediated rabies, according to OIE procedures (3). The documentation required for an OIE self-declaration will subsequently be taken into consideration and reviewed to verify that rabies transmission has been interrupted. Annex 14 shows a template of the proposed dossier required to verify interruption of rabies disease transmission. 12.4 References 1. Abela-Ridder B, Knopf L, Martin S, Taylor L, Torres G, De Balogh K. 2016: the beginning of the end of rabies? Lancet Global Health. 2016;4(11):e780–1. 2. Terrestrial animal health code. Paris: World Organisation for Animal Health; 2011 (https://www.oie.int/doc/ged/D10905.PDF). 3. Chapter 1.6. Procedures for self declaration and for official recognition by the OIE. In: Terrestrial Animal Health Code. Paris: World Organisation for Animal Health; 2011 (http://www.oie.int/index. php?id=169&L=0&htmfile=chapitre_selfdeclaration.htm). WHO_TRS_inside_final_2018_after_Corr_round5.indd 124 24/04/2018 20:50 Global and regional activities on rabies 125 13. Global and regional activities on rabies Since rabies was identified as a tripartite (WHO, FAO and OIE) priority in 2011, the disease has become a model for a coordinated “one health” approach between the human and the animal health sectors (1, 2). This commitment was renewed in 2017, with the launch of an updated tripartite concept note (3). In 2015, WHO and OIE, in collaboration with FAO and the Global Alliance for Rabies Control (GARC), organized a global rabies conference in Geneva, bringing together partners and stakeholders in veterinary and human health, government and the private sector (4), and launched the Global framework for the elimination of dog-mediated human rabies, outlining the commitment and actions required to achieve a common goal of zero human rabies deaths by 2030, worldwide (5). Many partners contribute to the prevention, control and elimination of human and animal rabies at global, regional and national levels, including the Association of South-East Asian Nations (ASEAN), the South Asian Association for Regional Cooperation, Humane Society International, Mission Rabies, Vets Beyond Borders, World Animal Protection and the Bill & Melinda Gates Foundation. They aid in preparing global standards and policies, resource mobilization, regional coordination and direct support of national programmes. 13.1 WHO global and regional activities 13.1.1 WHO headquarters WHO sets global norms and standards, engages partners and stakeholders and supports countries in the control and elimination of rabies. Since 2002, WHO has maintained a website that provides information on rabies in humans and animals, awareness materials and a selection of WHO reports and peer-reviewed articles (http://www.who.int/rabies/en/). WHO facilitates data collection on human rabies cases around the world and is working with OIE to harmonize country, regional and global reporting systems for animal (through the World Animal Health Information System) and human rabies (through WHO). Data have been used to generate maps of global rabies distribution (6), which are also published on the Global Health Observatory (http://www.who.int/gho/neglected_diseases/rabies/en/), so that they can be shared among stakeholders and sectors. Between 2009 and 2015, WHO managed a rabies elimination pilot programmes funded by the Bill & Melinda Gates Foundation in KwaZulu– Natal, South Africa, south-eastern United Republic of Tanzania and the Visayas archipelago in the Philippines (7). The success of these projects in reducing the numbers of cases of canine and human rabies provides proof of concept that WHO_TRS_inside_final_2018_after_Corr_round5.indd 125 24/04/2018 20:50 126 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report rabies elimination is feasible in various country contexts. Lessons learnt from the projects are now being used in international initiatives to catalyse rabies control (8). Since the launch of the Global framework, WHO has been working with partners to prepare a global strategic plan to end human deaths from dog-mediated rabies by 2030. This includes a country-centric approach, with international partners (WHO, FAO, OIE and GARC) to support, empower and catalyse national entities to control and eliminate rabies. In 2017, WHO revised its Position on rabies vaccine and rabies immunoglobulins, which was endorsed by the Strategic Advisory Group of Experts on Immunization. The updated document provides more feasible programme recommendations to improve access to affordable rabies biologicals, especially for underserved populations. The PEP and PrEP regimens and guidance for the prudent use of vaccine and RIG have also been updated. It has been estimated that using the updated intradermal PEP regimen would allow almost 500 additional patients to be treated for every 1000 vials of rabies vaccine, an increase over the numbers treated with traditional intramuscular regimens such as the Essen. WHO is building the evidence base for inclusion of human rabies vaccine in the 2018 Vaccine Investment Strategy of Gavi, the Vaccine Alliance. If successful, this would ensure subsidized access to human rabies vaccine in low- and middle-income, Gavi-eligible countries. In 2013, Gavi invested in evaluating the operational feasibility, public health impact and cost of improving access to rabies PEP in low-income settings in Africa and Asia. Studies were conducted in over 20 countries to characterize PEP distribution and delivery systems, the demand for rabies vaccine and how vaccine needs can be forecast. The studies clarified the availability, accessibility and cost of PEP and RIG, by country and in urban and rural areas, indicating the causes and risk factors for: ■ the limited availability and supply of PEP in some countries, ■ underreporting of rabies cases, ■ lack of regular monitoring of PEP use and ■ patients not seeking or not completing PEP. Stock-outs were frequent, due to either low budget allocation for rabies biologicals at central level, ineffective use of PEP at treatment centres and/or lack of accurate vaccine forecasting. In all the countries, the projects triggered additional activities, such as updating of the national rabies strategy or guidelines and improving rabies reporting and surveillance systems. WHO_TRS_inside_final_2018_after_Corr_round5.indd 126 24/04/2018 20:50 Global and regional activities on rabies 127 13.1.2 WHO regional offices South-East Asia The WHO Regional Office for South-East Asia has been proactive in preparing standards and guidelines, issuing recommendations and providing technical support to Member States for the prevention and control of human and animal rabies in the Region. It advocates use of cost–effective intradermal vaccination to improve the availability and affordability of modern rabies vaccines and phasing out of the production and use of nerve tissue vaccine. Nerve tissue vaccines have now been abandoned in Bangladesh, Cambodia, India, the Lao People’s Democratic Republic, Myanmar, Nepal, Pakistan and Viet Nam. In Bangladesh, India and Sri Lanka, practical training was conducted for medical and veterinary laboratory professionals in the use of DRIT and direct fluorescent antibody tests for rabies diagnosis. The aim of the ASEAN regional elimination strategy is to eliminate human rabies in the Region by 2020 by progressive control of dog rabies and human prophylaxis in rabies-endemic countries and maintaining the status of rabies-free areas (9, 10). WHO is working with the ASEAN Secretariat, member countries, FAO and OIE to provide technical support for the development and implementation of the strategy. The WHO Regional Office for South-East Asia is also working with the Secretariat of the South Asian Association for Regional Cooperation and member countries to advocate for regionally coordinated rabies control activities in South Asia. A workshop on prevention and control of rabies in the Region, held in Colombo, Sri Lanka, in 2015, recommended strengthening of rabies surveillance, laboratory networks, dog vaccination campaigns and humane dog population management (11). Americas In 1983, the Veterinary Public Health unit of the Pan American Health Organization (PAHO)/WHO Regional Office for the Americas began an official programme for elimination of dog-mediated human rabies in the Americas. The initial objective was to eliminate rabies from the principal cities of Latin America. In 1992, the objective was extended to include elimination of dog-mediated human rabies in small conglomerates and rural areas. Since its inception, the programme has resulted in a decrease by more than 90% in the numbers of human and canine rabies cases in the Americas. The programme made surveillance a priority and improved access to human prophylaxis, mass dog vaccination and good governance. The Regional Information System for Epidemiologic Surveillance of Rabies in the Americas (http://sirvera.panaftosa.org.br/) issues reports on human and animal rabies on the basis of official data entered by health and agriculture ministries in Member WHO_TRS_inside_final_2018_after_Corr_round5.indd 127 24/04/2018 20:50 128 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report States. Data from 1970 onwards are available for consultation on-line. From the PAHO revolving fund, PAHO Member States can procure high-quality, life- saving human rabies vaccines and immunoglobulin for prophylaxis. In 2015, procuration of canine rabies vaccine was included in the revolving fund for national rabies programmes for use in dog mass vaccination campaigns. Every 2 years, a meeting is convened of the Directors of National Programs for the Prevention and Control of Rabies (REDIPRA) in the Americas to discuss and update the epidemiological situation and strategies for the prevention and control of rabies. The conclusions and recommendations of REDIPRA are submitted for their consideration and endorsement to ministers of health and agriculture during high-level inter-American ministerial meetings on health and agriculture, organized by PAHO’s department of Veterinary Public Health. In 2016, during the 59th Directing Council of PAHO, Resolution CD55. R9 was approved, which includes the Plan of action for the elimination of neglected infectious diseases and post-elimination actions for 2016–2022 and promotes elimination of dog-mediated human rabies in all remaining areas of the Americas by 2022 or earlier (12). 13.1.3 WHO network of collaborating centres on rabies A network of WHO collaborating centres on rabies support WHO activities at country, intercountry, regional, interregional and global levels (http://apps.who.int/whocc/List.aspx?tor=rabies&). The collaborating centres strengthen the institutional capacity of Member States by providing information, services, research and training for rabies-related activities, including diagnosis, surveillance, research, monitoring and evaluation of human and animal rabies elimination programmes. Collaborating centres are officially designated by WHO on the basis of a jointly agreed work plan, usually for 4 years, which is renewable after annual evaluation of their performance by WHO. The work plan depends on the expertise or specificity of the centre but usually covers: ■ collection, collation and dissemination of information on rabies; ■ standardization of rabies diagnostic reagents and prophylactic and therapeutic substances, as well as methods and procedures for their application; ■ design and application of appropriate techniques; ■ provision of reference substances and other services; ■ participation in collaborative research under the Organization’s lead- ership; WHO_TRS_inside_final_2018_after_Corr_round5.indd 128 24/04/2018 20:50 Global and regional activities on rabies 129 ■ training, including research training; and ■ coordination of activities carried out by several institutions. There are 14 designated WHO collaborating centres for reference research on rabies. Four are in Asia, five in Europe and five in the Americas (Annex 15). 13.2 Examples of activities by partners The three major international organizations involved in rabies (WHO, FAO and OIE) and GARC, as well as nongovernmental organizations, animal welfare organizations and other public and private stakeholders are united to reduce the global burden of rabies. 13.2.1 Global activities Food and Agriculture Organization of the United Nations (FAO) FAO contributes to rabies control by raising awareness and providing policy advice and technical support for animal rabies control. It is supporting the establishment of animal health clubs in schools in Sierra Leone and has a special interest in the impact of rabies on livestock production (13). As part of the stepwise approach towards rabies elimination, FAO has organized global stakeholder consultations on rabies prevention in Africa, the Caucasus and Asia to assist countries in identifying their needs with regard to rabies control (14). At country level, FAO has sent missions of its Emergency Management Centre–Animal Health to control rabies outbreaks in Bali, Indonesia, and Viet Nam. In Bali, this led to integrated bite case management, with improved communication between the human and animal health sectors and team training to ensure successful capture and vaccination of street dogs that are difficult to handle (15). FAO strengthens diagnostic capacity through the Institute for Experimental Zooprophylaxis in Venice, Italy (the FAO reference centre for rabies) and the Network of West African Rabies Laboratories (RESOLAB) and by conducting proficiency testing in laboratories in southern Africa. FAO is also involved in dog population management and, with World Animal Protection, conducted training on dog catching, handling and vaccination after a rabies outbreak in the Republic of the Congo (16). In 2013, rabies was listed as a priority in the FAO Global framework for the progressive control of transboundary animal diseases (17). World Organisation for Animal Health (OIE) The OIE is an intergovernmental organization that issues science-based standards, guidelines and recommendations for the improvement of animal health and welfare while promoting strong veterinary services worldwide. WHO_TRS_inside_final_2018_after_Corr_round5.indd 129 24/04/2018 20:50 130 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Internationally agreed diagnostic laboratory methods and requirements for the production and control of animal rabies vaccines and other biological products are published in the OIE Manual of diagnostic tests and vaccines for terrestrial animals (18). The OIE Terrestrial animal health code (19) lists measures adopted internationally for the control of rabies in animals and for control of the stray dog population, which includes promotion of responsible dog ownership. The World Animal Health Information System (www.oie.int/wahid) is a global online web-based notification system that supports OIE Member Countries in reporting animal rabies. The “performance of veterinary services pathway”, a laboratory twinning programme and the network of reference laboratories and collaborating centres provide policy advice, strategy design and technical assistance for the diagnosis, control and elimination of rabies in animals and aid countries in strengthening their veterinary services, laboratories, surveillance and reporting. At the 2016 OIE World Assembly of the Delegates, Member Countries agreed to maintain the efforts to foster political will and long-term social commitment towards rabies elimination (20). They requested the OIE and interested parties to sustain their commitment to the elimination of dog-mediated human rabies by 2030 as a priority in the public interest. Global Alliance for Rabies Control (GARC), Partners for Rabies Prevention and World Rabies Day GARC is the foremost registered charity dedicated specifically to reducing the global burden of rabies. Its mission is to eliminate human deaths from rabies and to relieve the burden of rabies in animals, especially dogs (www. rabiesalliance.org/). GARC was instrumental in establishing the Partners for Rabies Prevention (21), an informal group that comprises the main international agencies with an interest in rabies, including WHO, FAO, OIE, WHO and OIE rabies collaborating centres and reference laboratories, nongovernmental organizations for animal welfare, networks of rabies experts and representatives of industry. The Partners for Rabies Prevention have initiated studies and projects for control activities and advocacy for rabies elimination, including: a reassessment of the global burden of dog-mediated rabies (22), a global survey of rabies notifiability (23) and the Blueprint for rabies prevention and control (24), which includes the stepwise approach to rabies elimination (25). GARC’s World Rabies Day campaign (rabiesalliance.org/world-rabies- day/) was initiated in 2006 to raise awareness and mobilize resources for prevention of human rabies and control of animal rabies. During the past 10 years, the campaign has held 1717 registered events in 116 countries, with activities ranging from awareness campaigns to dog walks to professional training seminars, which WHO_TRS_inside_final_2018_after_Corr_round5.indd 130 24/04/2018 20:50 Global and regional activities on rabies 131 have resulted in announcements of improvements to rabies control policies by governments (26). More recently, GARC has organized several certificate courses to build capacity in rabies control, which are freely available from the GARC educational platform (https://rabiesalliance.org/ capacity-building/gep). The courses include a rabies educator certificate (to train community educators), an animal handling and vaccination certificate (for animal health technicians and dog vaccination staff), a community caregivers certificate (for community volunteers) and a community health care certificate (for health care professionals). Mission Rabies Mission Rabies is an international nongovernmental organization that implements rabies elimination programmes in endemic regions. Flagship projects are based in the Indian state of Goa, Ranchi city in Jharkhand and the southern region of Malawi through partnership with local governments. The campaigns include mass dog vaccination, rabies education, community awareness and surveillance of dog-mediated rabies. A unique smartphone app based on geospatial technology has been developed to improve epidemiological assessment of control strategies and direct teams to remote areas. To date, over 800 000 data entries have been made on the platform in Asia, Africa and Europe. In 2016, a total of 213 423 dogs were vaccinated, 540 000 children were taught about rabies, and 64 rabid dogs tested positive for rabies. The Malawi campaign is based on a combination of central and door-to-door vaccination, while in the campaigns in India a net catch–vaccinate–release and door-to-door approaches are used. In Goa, financial support for the campaign is provided by the Government of Goa, and FAT testing facilities have been established in the Government diagnostic investigation unit to provide timely testing and reporting of rabies cases. Since an increase in rabies control in 2014, the number of reported human deaths from rabies has fallen from 17 in 2014, to 5 in 2015 and 1 in 2016. Pilot campaigns have also been undertaken in Sri Lanka, Uganda and the United Republic of Tanzania through partner organizations to support effective field protocols for wider application. World Animal Protection World Animal Protection is an international nongovernmental organization committed to ending cruelty to animals; it has particular expertise in managing free-roaming dogs in communities around the world. The organization works with governments and international bodies, including WHO, OIE, FAO and GARC, other nongovernmental organizations and local communities to ensure that dog populations are managed humanely (www.worldanimalprotection.org). World Animal Protection advocates a “one health” approach to managing WHO_TRS_inside_final_2018_after_Corr_round5.indd 131 24/04/2018 20:50 132 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report dog populations and for effective, ethical, sustainable interventions to create harmonious coexistence between dogs and people (27). The aim of their “Red collar” campaign in 2011–2016 was to end inhumane culling of dogs in response to rabies in Bangladesh, China, Indonesia, the Philippines and the United Republic of Tanzania (Zanzibar). In Africa, World Animal Protection is working with the Government of Kenya to pilot test their national rabies elimination strategy and with Sierra Leone in development of their national rabies elimination and dog population management strategy. It works in partnership with GARC in rabies elimination in several other African countries through PARACON and is also working in Brazil, China and Costa Rica to develop a “one health” dog population management approach. 13.2.2 Regional networks Africa PARACON was founded in 2015 to strengthen the capacity of a network of rabies experts in Africa. It resulted from the merging of the Southern and Eastern African Rabies Group and the African Rabies Expert Bureau and included African countries that were not previously associated with either organization. Through workshops held through PARACON and similar regional networks, GARC and international partners use tools such as the “rabies blueprint” and the stepwise approach to rabies elimination to support countries in progressing towards elimination of dog-mediated rabies (28). The new PARACON Epidemiological bulletin will improve the collection and visibility of surveillance and other data necessary to monitor the progress of control (29). Americas In Latin America, the REDIPRA is held every 2 years to review strategies for rabies control, make recommendations for countries and coordinate the regional response. The 15th REDIPRA, held in Brazil in 2015, urged surveillance of the last sites of dog-mediated rabies (30). In 2015, a subgroup was created for Bolivia, Chile, Colombia, Ecuador, Peru and Venezuela, coordinated by PANAFTOSA–PAHO, the Andean Health Organization and the Amazon Cooperation Treaty Organization. An international conference on rabies in the Americas (http://www.rabiesintheamericas.org/) is organized annually to review and discuss rabies research and control in the region. The meeting has an international committee consisting of members from Brazil, Canada, Mexico and the USA. Asia WHO, FAO and OIE have established a functional coordination mechanism for intersectoral collaboration to prevent and control zoonoses WHO_TRS_inside_final_2018_after_Corr_round5.indd 132 24/04/2018 20:50 Global and regional activities on rabies 133 in the Asia–Pacific, supported by the European Commission-funded “highly pathogenic emerging diseases” project, established in 2010 (31). A tripartite workshop has since been organized to operationalize the “one health” concept in Member countries. WHO, the Institut Pasteur and the University of Lausanne organized the first international training course on rabies surveillance and control for Asian countries in Phnom Penh, Cambodia, in October 2015 to establish networks of local champions in seven countries. The course was first held in Senegal in 2013 and was conducted in Cambodia in 2015 and in Cameroon in 2016. The next course will be organized in Tehran, Islamic Republic of Iran, in October 2017 for countries in the Middle East and Central Asia. Europe The WHO Rabies bulletin Europe was created in 1977 and is hosted by the WHO Collaborating Centre for Rabies Surveillance and Research at the Friedrich-Loeffler Institute in Germany. The database is used in more than 40 European countries to report confirmed rabies cases in humans and in wild and domestic animal species every 3 months. Aggregated country and surveillance data maps are freely available online (www.who-rabies-bulletin.org/). Human rabies cases and the epidemiology of rabies are also presented in Eurosurveillance, a peer-reviewed scientific journal published by the European Centre for Disease Prevention and Control (http://www.eurosurveillance.org/) The European Union rabies subgroup of the task force on the eradication of animal diseases comprises private and governmental experts. Its task is to assess and provide recommendations on co-financed ORV campaigns in European member states and neighbouring non-member countries. The reports are publicly available online (http://ec.europa.eu/food/animals/animal-diseases_ en). Since 2008, the European Union Reference Laboratory for Rabies in Nancy, France, has organized annual meetings of European national rabies laboratories to standardize diagnostic techniques. Middle and Near East The Middle East and eastern Europe rabies expert bureau is an inter- regional network established in 2010. It is composed of representatives of countries in Central Asia, Europe, the Middle East and North Africa that are enzootic for rabies, who work to improve rabies control and prevention at local, regional and global levels. The members met for the third time in 2015 in Lyon, France, to review the current rabies situation in the network and to discuss use of the “one health” approach against rabies (32). WHO_TRS_inside_final_2018_after_Corr_round5.indd 133 24/04/2018 20:50 134 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 13.3 References 1. Rabies is a tripartite (WHO–FAO–OIE) priority. Paris: World Organisation for Animal Health; 2014. 2. The FAO–OIE–WHO collaboration. A tripartite concept note. Geneva: World Health Organization; 2010. 3. FAO, OIE, WHO. The tripartite’s commitment. Providing multi-sectoral, collaborative leadership in addressing health challenges. Rome: Food and Agriculture Organization of the United Nations; 2017 (I7377EN/1/06.17) (http://www.fao.org/3/b-i7377e.pdf). 4. Global elimination of dog-mediated rabies: report of a global rabies conference, 10–11 December 2015. Geneva: World Health Organization; 2016 (http://apps.who.int/iris/bitstream/10665/204621/1/WHO_HTM_ NTD_NZD_2016.02_eng.pdf). 5. Fahrion AS, Taylor LH, Torres G, Müller T, Dürr S, Knopf L et al. the road to dog rabies control and elimination – What keeps us from moving faster? Front Public Health. 2017;5:103. 6. Fahrion AS, Mikhailov A, Abela-Ridder B, Giacinti J, Harriesa J. Human rabies transmitted by dogs: current status of global data, 2015. Wkly Epidemiol Rec. 2016;91(2):13–20. 7. From concept to completion (website). Geneva: World Health Organization (http://www.who.int/neglected_diseases/news/from- concept-to-completion-elimination-of-canine-rabies/en/). 8. Stimulus package for eliminating dog-mediated human rabies: a concept. Geneva: World Health Organization; 2016 (http://apps.who.int/iris/ bitstream/10665/254044/1/WHO-HTM-NTD-NZD-2016.6-eng.pdf). 9. Gongal G, Wright AE. Human rabies in the WHO Southeast Asia Region: forward steps for elimination. Adv Prev Med. 2011;2011:383970. 10. Strategic framework for elimination of human rabies transmitted by dogs in the South-East Asia region. Geneva: World Health Organization; 2012. 11. Prevention and control of Rabies in SAARC countries. New Delhi: WHO Regional Office for South East Asia; 2016 (http://www.searo.who.int/ entity/emerging_diseases/documents/sea_cd_316.pdf). WHO_TRS_inside_final_2018_after_Corr_round5.indd 134 24/04/2018 20:50 Global and regional activities on rabies 135 12. Resolution CD55R9. Plan of action for the elimination of neglected infectious diseases and post-elimination actions 2016–2022. 55th Directing Council. 68th Session of the Regional Committee of WHO for the Americas; Wahington DC: Pan American Health Organization; 2016 (http://www.paho.org/hq/index.php?option=com_docman&task=doc_ download&gid=36408&Itemid=270&lang=en). 13. AGA in action (website). Rome: Food and Agriculture Organization of the United Nations; 2012 (http://www.fao.org/ag/againfo/home/en/ news_archive/aga_in_action/2010_Animal_Health_Clubs_3.html). 14. An introduction to FAO’s rabies stakeholder consultations (RASC) (website). Rome: Food and Agriculture Organization of the United Nations; undated (http://aphca.org/publications/Tool_I_Introduction_ FAO_Rabies_stakeholder_consultations1_final.pdf). 15. The rabies A-teams in action on Bali! (video). Rome: Food and Agriculture Organization of the United Nations; 2014; (https://www.youtube.com/ watch?v=ZFZxfnQsPyw). 16. Dog population management. FAO/WSPA/IZSAM expert meeting, Banna, 2011. Rome: Food and Agriculture Organization of the United Nations; 2014. 17. Sixth meeting of the GF-TADs Global Steering Committee. Rome: Food and Agriculture Organization of the United Nations; 2013 (http://www. fao.org/3/a-bl340e.pdf). 18. Rabies (infection with rabies virus). In: Manual of diagnostic tests and vaccines for terrestrial animals, Vol. 2. Paris: World Organisation for Animal Health; 2016 (http://www.oie.int/fileadmin/Home/eng/Health_ standards/tahm/2.01.17_RABIES.pdf). 19. Terrestrial animal health code. Paris: World Organisation for Animal Health; 2011 (https://www.oie.int/doc/ged/D10905.PDF). 20. Resolutions adopted by the World Assemby of Delegates of the OIE during its 84th General Session. Paris: World Organisation for Animal Health; 2017 (http://www.oie.int/fileadmin/Home/eng/About_us/docs/ pdf/Session/2016/A_RESO_2016_public.pdf). 21. Lembo T, Attlan M, Bourhy H, Cleaveland S, Costa P, De Balogh K et al. Renewed global partnerships and redesigned roadmaps for rabies prevention and control. Vet Med Int. 2011;2011:923149. WHO_TRS_inside_final_2018_after_Corr_round5.indd 135 24/04/2018 20:50 136 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 22. Hampson K, Coudeville L, Lembo T, Sambo M, Kieffer A, Attlan M et al. Estimating the global burden of endemic canine rabies. PLoS Negl Trop Dis. 2015;9(4):e0003709. 23. Taylor LH, Knopf L. Surveillance of human rabies by national authorities – a global survey. Zoonoses Public Health. 2015;62(7):543–52. 24. Lembo T, Partners for Rabies Prevention. The blueprint for rabies prevention and control: a novel operational toolkit for rabies elimination. PLoS Negl Trop Dis. 2012;6(2):e1388. 25. Coetzer A, Kidane AH, Bekele M, Hundera AD, Pieracci EG, Shiferaw ML et al. The SARE tool for rabies control: current experience in Ethiopia. Antiviral Res. 2016;135:74–80. 26. Balaram D, Taylor LH, Doyle KA, Davidson E, Nel LH. World rabies day – a decade of raising awareness. Trop Dis Travel Med Vacc. 2016;2(1):19. 27. Humane dog management (website). London: World Animal Protection (https://www.worldanimalprotection.org/sites/default/files/int_files/ humane-dog-management.pdf). 28. Scott TP, Coetzer A, De Balogh K, Wright N, Nel LH. The Pan-African rabies control network (PARACON): a unified approach to eliminating canine rabies in Africa. Antiviral Res. 2015;124:93–100. 29. Scott TP, Coetzer A, Fahrion AS, Nel LH. Addressing the disconnect between the estimated, reported, and true rabies data: the development of a regional African rabies bulletin. Front Vet Sci. 2017;4:18. 30. EU funded Highly Pathogenic and Emerging Diseases 3rd Steering Committee Meeting 2012. Paris: World Organisation for Animal Health; 2012 (https://www.oie.int/doc/ged/D11881.PDF). 31. 15th REDIPRA, 16–17 September 2015, Brasilia (http://www.panaftosa. org/redipra15/index.php?option=com_content&view=article&id=81&I temid=78&lang=en). 32. Picot V, Rasuli A, Abella-Rider A, Saadatian-Elahi M, Aikimbayev A, Barkia A et al. The Middle East and eastern Europe rabies expert bureau (MEEREB) third meeting: Lyon, France (7–8 April, 2015). J Infect Public Health. 2017;10(6):695–701. WHO_TRS_inside_final_2018_after_Corr_round5.indd 136 24/04/2018 20:50 Research 137 14. Research The areas for future research are means for limiting the impact of rabies on individuals and populations and evidence and new tools to improve prevention and management strategies, including improved delivery of interventions for humans and animals. The areas identified as priorities for future research are listed below. 14.1 Improve programmatic delivery of rabies interventions Better methods for delivering interventions in current programmes for both human and animal rabies are needed. In operational research, well-designed protocols, rigorous statistical standards and unbiased sampling are essential. In the evaluation of interventions, appropriate comparison groups should be included, when possible. Research should include: ■ Innovation and development of new vaccines in collaboration with manufacturers to optimize cost–effectiveness, delivery in the com- munity, easy storage, thermostability and shelf-life, while maintain- ing vaccine safety and efficacy. ■ Innovative, cost–effective methods for delivering rabies biologicals to remote populations with limited or no access to health care. The methods being considered include training of health care staff in in- tradermal administration of rabies vaccines, innovation in the con- trolled temperature chain, research to facilitate administration of ra- bies vaccines (e.g. subcutaneously), coordinated use of existing cold chains and decentralization of animal-bite treatment clinics. ■ Proof-of-concept studies on the impact of bite prevention education in reducing the number of dog bites and the potential exposure of people to rabies. ■ Refinement of the current recommendations to achieve vaccination of 70% of the dog population to interrupt rabies transmission. These should indicate whether targeted vaccination of dogs at risk in high- transmission areas should be a priority. ■ Applied research on integration of dog rabies control into other hu- man and animal health programmes. WHO_TRS_inside_final_2018_after_Corr_round5.indd 137 24/04/2018 20:50 138 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 14.2 Improve the quality and availability of data on rabies Accurate data on the disease burden and risk are essential for setting regional, national and subnational priorities for rabies prevention and control. Research is required to improve diagnostic and surveillance capability, particularly in low-resource, endemic settings. The priorities include: ■ Evaluation of novel methods for improving surveillance in endemic settings, such as proof-of-concept studies of the role of integrated bite case management (1), verbal autopsy, testing of encephalitic patients (2) and new technology to improve rabies case detection and report- ing. ■ Innovation in strategies to enhance uptake of decentralized, field- based rabies diagnostics and evaluation of their impact on the ef- fectiveness (i.e. sensitivity, representiveness and timeliness) of sur- veillance, for example by optimizing methods for collecting and preparing diagnostic samples in the field or at the bedside or by de- veloping and validating a sensitive, specific ante-mortem test suitable for use in the field or at points of care. ■ Robust, sustainable data capture platforms to facilitate the flow of data from the field to central health services and regional and global repositories. This would improve estimates of the global, regional and country burdens of rabies. Modelling could be used to obtain esti- mates if there are gaps in the available data. ■ International standards for rabies diagnosis, including for molecular techniques, and means for quality control of rabies diagnostic testing to ensure reliable results. ■ Methods to quantify the strength of rabies surveillance systems that could be used in conjunction with processes to validate and verify the attainment of zero human rabies deaths (see section 12). This might include better understanding of the processes responsible for the maintenance and elimination of rabies in certain geographical lo- cations and viral characterization to infer linkages among infections and establish the origin of transmission. WHO_TRS_inside_final_2018_after_Corr_round5.indd 138 24/04/2018 20:50 Research 139 14.3 Evidence and new tools to improve the prevention and management of rabies New tools can simplify programme delivery, improve diagnostic capacity and make PEP and RIG more affordable. With regard to rabies biologicals, research should be done to obtain robust clinical data on the immunological outcomes of accelerated PEP and PrEP schedules and on alternatives to RIG, such as mAbs. The priorities include: ■ Further research on the cost–effectiveness, feasibility and potential of novel tools for vaccine delivery, such as needle-free jet injection, microneedle injection systems and topical patches. ■ Use of novel immunocontraceptive products to improve manage- ment of animal populations and to combine surgical or non-surgi- cal sterilization with parenteral or oral rabies vaccination (3). These should be tested in dogs that can be closely monitored to determine humaneness, long-term effect at population level, feasibility and cost–effectiveness. ■ Protocols for data and sample size to prove the non-inferiority of new PEP and PrEP regimens, which would also be important for estab- lishing regulation of rabies biologicals and other novel products such as mAbs. ■ Recommendations for immunization of individuals with repeated exposure, optimal spacing of PEP and the number of boosters over a lifetime. Better understanding of the factors that determine serocon- version and clinical outcomes in immunocompromised individuals would be helpful. ■ Vaccines that protect against other lyssavirus strains (i.e. phylogroup II and III lyssaviruses) could be investigated as multivalent vaccines, and further studies should be conducted on the activation and pro- tection induced by novel vaccine carriers and adjuvants when used for PEP. Characterization of new lyssavirus species should indicate whether commercially available rabies biologicals are likely to be pro- tective. ■ Studies on intravenous administration of RIG (particularly for non- bite exposures) and the levels of antibody required for passive immu- nization and their duration (particularly for mAbs). WHO_TRS_inside_final_2018_after_Corr_round5.indd 139 24/04/2018 20:50 140 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report ■ Development and validation of effective therapeutics for PEP and/ or antiviral therapy for the treatment of clinically rabid patients (see section 6). Novel therapies should be validated only in well-resourced reference centres with trained teams experienced (or under expert guidance) in managing rabies patients, with ethically accepted proto- cols, after discussions with the family and a collegial decision and af- ter other life-threatening but curable illnesses (differential diagnoses to rabies encephalitis) have been ruled out. The Consultation emphasized the importance of programme-directed research to overcome current challenges in rabies control, which will catalyse efforts to reach the global goal of zero human rabies deaths by 2030, worldwide. Beyond that goal, research should be conducted on interruption of rabies transmission, monitoring of rabies-free status and broadening the research agenda to include lyssaviruses other than rabies. These research priorities may be biased, as the survey was open only to the participants of the meeting. Overall, research should improve public health outcomes for populations at risk of rabies. 14.4 References 1. Undurraga EA, Meltzer MI, Tran CH, Atkins CY, Etheart MD, Millien MF et al. Cost–effectiveness evaluation of a novel integrated bite case management program for the control of human rabies, Haiti 2014–2015. Am J Trop Med Hyg. 2017;96(6):1307–17. 2. Mallewa M, Fooks AR, Banda D, Chikungwa P, Mankhambo L, Molyneux E et al. Rabies encephalitis in malaria-endemic area, Malawi, Africa. Emerg Infect Dis. 2007;13(1):136. 3. Carroll MJ, Singer A, Smith GC, Cowan DP, Massei G. The use of immunocontraception to improve rabies eradication in urban dog populations. Wildl Res. 2011;37(8):676–87. WHO_TRS_inside_final_2018_after_Corr_round5.indd 140 24/04/2018 20:50 Concluding remarks 141 15. Concluding remarks Dr Rungrueng Kitphati (Director, Thailand Department of Disease Control) closed the meeting by thanking the participants, the organizers, the media and Chulalongkorn University on behalf of the Thai Ministry of Public Health. Dr Bernadette Abela-Ridder thanked Chulalongkorn University and the organizers, working groups and participants for their contributions, input and advocacy. Dr Gowri Yale, Mission Rabies, shared a success story from Goa, a small Indian state with a population of approximately 2.4 million and an estimated 150 000 dogs. Since 2013, the project has vaccinated 50 000 dogs annually and has provided an education team to build awareness of rabies in schools and communities and a hotline to signal rabid dogs for removal. Human deaths from rabies per year in Goa decreased from 24 to 5, and no cases have been reported thus far in 2017. This compelling example adds to the body evidence that rabies elimination is feasible with existing tools. Sustained commitment, collaboration and support to implement control measures remain the key to reaching zero human rabies deaths by 2030, worldwide. 16. Acknowledgements The Expert Consultation and the WHO Secretariat acknowledge the contributions to drafting the background documents and updating sections of Dr A. Be-Nazir, Dr J. Blanton, Dr H. Bourhy, Dr D. Briggs, Dr S. Cleaveland, Dr F. Cliquet, Dr V. Del Rio Vilas, Dr H. Ertl, Dr C. Fehlner-Gardiner, Dr T. Fooks, Dr C. Freuling, Dr G. Gongal, Dr K. Hampson, Dr A. Jackson, Dr J. Kotze, Dr M. Lechenne, Dr R. Mani, Dr F.X. Meslin, Dr S. Moore, Dr T. Müller, Dr S. Recuenco, Dr C.E. Rupprecht, Dr S. Shwiff, Dr R. Steffen, Dr A. Tarantola, Dr L. Taylor, Dr G. Torres, Dr A. Vos, Dr M. Vigilato and Dr R. Wallace. The work of Chulalongkorn University, WHO Collaborating Centre for Research and Training on Viral Zoonoses, in hosting the Consultation is greatly appreciated, with special thanks to Dr Thiravat Hemachudha, Dr Supaporn Wacharapleusadee and Ms Siriporn Ghai. WHO_TRS_inside_final_2018_after_Corr_round6.indd 141 06/06/2018 20:54 142 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annexes Annex 1. List of participants WHO collaborating centres Dr Jesse D. Blanton, WHO Collaborating Centre for Reference and Research on Rabies, Centers for Disease Control and Prevention, Atlanta (GA), USA Dr Hervé Bourhy, WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, Paris, France Dr Florence Cliquet, WHO Collaborating Centre on Research and Management on Zoonoses Control, Laboratory of Rabies and Wild Animals of Nancy, French Agency for Food Environmental and Occupational Health and Safety, Malzeville, France Dr Christine Fehlner-Gardiner, WHO Collaborating Centre for Control and Epidemiology of Rabies in Carnivores, Centre of Expertise for Rabies, Ottawa Laboratory Fallowfield, Canadian Food Inspection Agency, Ottawa, Canada (Co-Chair) Dr Anthony R. Fooks, WHO Collaborating Centre for the Characterization of Rabies and Rabies-related Viruses, Department of Virology, Animal and Plant Health Agency, Weybridge, United Kingdom Dr Thiravat Hemachudha, WHO Collaborating Centre for Research and Training on Viral Zoonoses, Faculty of Medicine, Chulalongkorn University, King Chulalongkorn Memorial Hospital, Bangkok, Thailand (Co-Chair) Dr Boonlert Lumlertdacha, WHO Collaborating Centre for Research on Rabies Pathogenesis and Prevention, Queen Saovabha Memorial Institute, Thai Red Cross Society, Bangkok, Thailand Dr Reeta S. Mani, WHO Collaborating Centre for Reference and Research in Rabies, Department of Neurovirology, National Institute of Mental Health and Neurosciences, Bengaluru, India Dr Thomas Müller, WHO Collaborating Centre for Rabies Surveillance and Research, Institute of Molecular Virology and Cell Biology, Friedrich-Loeffler-Institut, Federal Research Institute for Animal Health, Greifswald-Insel Riems, Germany Dr Simmi, WHO Collaborating Centre for Rabies Epidemiology, Division of Zoonosis, National Centre for Disease Control, New Delhi, India Dr Ravi Vasanthapuram, WHO Collaborating Centre for Reference and Research in Rabies, Department of Neurovirology, National Institute of Mental Health and Neurosciences, Bengaluru, India WHO_TRS_inside_final_2018_after_Corr_round5.indd 142 24/04/2018 20:50 Annexes 143 Members of the WHO Expert Advisory Panel on Rabies Dr François-Xavier Meslin, Consultant, Geneva, Switzerland Dr Louis Hendrik Nel, Global Alliance for Rabies Control and University of Pretoria, Pretoria, South Africa Dr Beatriz Quiambao, Research Institute for Tropical Medicine, Manila, Philippines Dr Charles E. Rupprecht, The Wistar Institute, Philadelphia (PA), USA Dr Naseem Salahuddin, The Indus Hospital Karachi, Karachi, Pakistan Dr Mysore Kalappa Sudarshan, Rajiv Gandhi Institute of Public Health and Centre for Disease Control, Bengaluru, India Other experts Dr Hossein Bannazadeh Baghi, Infectious and Tropical Diseases Research Centre, Tabriz University of Medical Science,Tabriz, Islamic Republic of Iran Dr Deborah Briggs, Kansas State University College of Veterinary Medicine, Manhattan (KS), USA Dr Andrea Britton, Vets Beyond Borders, Melbourne (VIC), Australia Dr Joel Jackson Changalucha, Ifakara Health Centre, Morogoro, United Republic of Tanzania Dr Sarah Cleaveland, University of Glasgow, Glasgow, United Kingdom Dr Victor J. Del Rio Vilas, School of Veterinary Medicine, University of Surrey, Guildford, United Kingdom Dr Sampath Gade, Secunderabad, India Dr Amila Gunesekera, National Hospital Sri Lanka, Mattegoda, Sri Lanka Dr Katie Hampson, Glasgow University, Glasgow, United Kingdom Dr Soawapak Hinjoy, Ministry of Public Health, Bangkok, Thailand Dr Alan C. Jackson, Section of Neurology, University of Manitoba, Winnipeg, Canada Dr S.M. Golam Kaisar, Emerging and Re-emerging Disease, Communicable Disease Control, Directorate General of Health Services, Dhaka, Bangladesh Dr Sim Kheng, Ministry of Health, Phnom Penh, Cambodia Dr Rungrueng Kitphati, Department of Disease Control, Ministry of Public Health, Bangkok, Thailand Dr Johann Kotzé, Consultant, Malelane, South Africa Dr Mohammed Lakranbi, Ministry of Health, Rabat, Morocco Dr Monique Léchenne, Swiss Tropical and Public Health Institute, Basel, Switzerland WHO_TRS_inside_final_2018_after_Corr_round5.indd 143 24/04/2018 20:50 144 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Dr Sowath Ly, Institut Pasteur of Cambodia, Phnom Penh, Cambodia Dr Gina R Manlapig, Department of Health, Regional Office III, San Fernando, Philippines Dr Susan Moore, College of Veterinary Medicine, Kansas State University, Manhattan (KS), USA (Co-Rapporteur) Dr Thumbi Mwangi, Kenya Medical Research Institute and Washington State University, Kisumu, Kenya Dr Athman Mwatondo, Department of Preventive and Promotive Health Services, Zoonotic Diseases Unit, Ministry of Health, Nairobi, Kenya Dr Ashwath Narayana, Kempegowda Institute of Medical Sciences, Bengaluru, India Dr Thi Thanh Huong Nguyen, National Institute of Hygiene and Epidemiology, Hanoi, Viet Nam Dr Sergio Recuenco Cabrera, Department of Preventive Medicine and Public Health, National University of San Marcos, Lima, Peru Dr Amadou Sall, Institut Pasteur of Senegal, Dakar, Senegal Dr Robert Steffen, WHO Collaborating Centre for Travellers’ Health, Epidemiology, Biostatistics and Prevention Institute, University of Zurich, Zurich, Switzerland Dr Richard Suu-Ire, The Forestry Commission of Ghana, Accra, Ghana Dr Arnaud Tarantola, Institut Pasteur of New Caledonia, Noumea, New Caledonia Dr Tenzin Tenzin, National Centre for Animal Health, Timphu, Bhutan Dr Pornchai Thurin, Ministry of Public Health, Bangkok, Thailand Dr Caroline Trotter, University of Cambridge, Department of Veterinary Medicine, Cambridge, United Kingdom Dr Eduardo Undurraga, Centers for Disease Control and Prevention, Atlanta (GA), USA Dr Ryan Wallace, Centers for Disease Control and Prevention, Atlanta (GA), USA Dr Henry Wilde, WHO Collaborating Centre for Research and Training on Viral Zoonoses, Faculty of Medicine, Chulalongkorn University, King Chulalongkorn Memorial Hospital, Bangkok, Thailand Dr Wenwu Yin, Chinese Centre for Disease Control and Prevention, Beijing, China Representatives of other organizations Dr Katinka de Balogh, Food and Agriculture Organization of the United Nations, Bangkok, Thailand WHO_TRS_inside_final_2018_after_Corr_round5.indd 144 24/04/2018 20:50 Annexes 145 Observers Dr Xinghua Che, International Regulation Affairs, Liaoning Cheng Da Biotechnology Co. Ltd, Shenyang, China Dr Nirav Desai, CPL Biologicals Pvt. Ltd., Gujarat, India Ms Siriporn Ghai, WHO Collaborating Centre for Research and Training on Viral Zoonoses, Faculty of Medicine, Chulalongkorn University, King Chulalongkorn Memorial Hospital, Bangkok, Thailand Mr Saleh Khan, Consultant, Geneva, Switzerland Dr Sanjeev Kumar, Zydus Cadila, Gujarat, India Dr Emily Mudoga, World Animal Protection, Nairobi, Kenya Dr Valentina Picot, Fondation Mérieux, Lyon, France Dr Scott Preiss, GlaxoSmithKline, Wavre, Belgium Ms Gill Sivyer, Consultant, Geneva, Switzerland Dr Supaporn Wacharapluesadee, WHO Collaborating Centre for Research and Training on Viral Zoonoses, Faculty of Medicine, Chulalongkorn University, King Chulalongkorn Memorial Hospital, Bangkok, Thailand Dr Gowri Yale, Mission Rabies, Bengaluru, India WHO secretariat Dr Bernadette Abela-Ridder, Team Leader, Neglected Zoonotic Diseases, Department of Control of Neglected Tropical Diseases Dr Elkhan Gasimov, Malaria and Other Vector-borne Diseases, Regional Office for Europe, Copenhagen, Denmark Dr Gyanendra Gongal, Food Safety and Zoonoses, Regional Office for South-East Asia, New Delhi, India Ms Joss Kessels, Neglected Zoonotic Diseases, Department of Control of Neglected Tropical Diseases (Co-Rapporteur) Dr Lea Knopf, Neglected Zoonotic Diseases, Department of Control of Neglected Tropical Diseases Dr Marco Vigilato, Zoonoses, Pan American Health Organization/Regional Office for the Americas, Washington DC, USA Ms Naoko Obara, Neglected Zoonotic Diseases, Department of Control of Neglected Tropical Diseases Dr Nhu Nguyen Tran Minh, Technical Officer, Regional Office for the Eastern Mediterranean, Cairo, Egypt WHO_TRS_inside_final_2018_after_Corr_round5.indd 145 24/04/2018 20:50 146 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 2. Record form for cases of possible exposure to rabies Case no.: Date: Time: Patient details Name: Age: Sex: Address: Telephone (home and mobile): Telephone (work): GP and Tel: Details of exposure Country and town: Date of exposure: Date of travel: Nature of exposure: bite/lick/saliva/scratch/other (to specify): Site of exposure: Was the skin broken? Yes/No Did the wound/s bleed? Yes/No Number of wounds: Depth of bite(s): Superficial/deep WHO category of exposure: I / II / III: Details of animal Type of animal: wild/domestic Species: Bite: provoked/unprovoked: (details): Is the animal’s owner/home known? Yes/No Were efforts made to trace the animal? Yes/No When was the animal last seen alive? Animal’s vaccination status, if known: Details of treatment Rabies vaccination history of the patient: Did s/he previously receive at least two doses of intramuscular/intradermal rabies vaccination, either as pre-exposure or post-exposure prophylaxis? Yes/No Details (day/ date/ vaccine name / batch no): Did s/he previously receive rabies immunoglobulin? Yes/No Details (date / type (eRIG/hRIG/mAb) / location / volume): Other information: WHO_TRS_inside_final_2018_after_Corr_round5.indd 146 24/04/2018 20:50 Annexes 147 Contact on-call virologist/physician for advice with above information. If unavailable, contact: Was anti-rabies post-exposure prophylaxis given previously? Yes/No Which rabies vaccine was given? Details (day/date etc.): Was rabies immunoglobulin given? Yes/No Locally/systemically: Other information Contact on-call virologist/physician for advice with above information If unavailable, contact: Recommended treatment Thorough wound washing with water/ soap/ antiviral agent. Rabies immunoglobulin: Human rabies immunoglobulin, max dose 20 IU/kg body weight Equine rabies immunoglobulin, max dose 40 IU/kg body weight Injection site: Patient weight (kg): Volume recommended (IU and mL): Post-exposure course arranged? Yes/No ■ Rabies vaccination (recommended for WHO category II and III exposures): – Two-day, two-site intradermal: days 0 and 3 (2 sites) – Two-day, one-site intramuscular: days 0 and 3 (1 site) – One-day, four-site intradermal: day 0 (4 sites) ■ Standard course for non-previously immunized people*: – One-week, two-site intradermal: (2 sites) days 0, 3 and 7 – Two-week, one-site intramuscular: (1 site) days 0, 3, 7, and between days 14 to 28 – Three-week intramuscular: days 0 (2 sites), 7 (one site), and 21 (one site) – Other (specify) * People are considered previously vaccinated for rabies if they received at least two doses of intramuscular/intradermal rabies vaccination, either as pre-exposure or post- exposure prophylaxis. General practitioner informed via letter/e-mail/phone/SMS text? Yes/No Name, telephone and signature of completing physician: WHO_TRS_inside_final_2018_after_Corr_round5.indd 147 24/04/2018 20:50 148 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 3. Human rabies vaccines and producers worldwide, as of August 2017 Vaccine Brand Producer Country Cell line WHO prequali- fied Type PVRV N/A Butantan Institute Brazil Vero cells No Liquid HDCV Chengdu Kanghua Chengdu Kanghua China Human diploid cells No Lyophilized PVRV SPEEDA Liaoning Chengda Co. China Vero cells No Lyophilized PVRV N/A Changchun Changsheng Life Sciences Ltd. China Vero cells No Lyophilized PVRV N/A Guangzhou Nuocheng Biological Products Co. China Vero cells No Lyophilized PVRV N/A Ningbo RongAn Biological Pharmaceutical Co. China Vero cells No Lyophilized PVRV N/A Jilin Maifeng Biological Pharmaceutical Co. China Hamster kidney cells No Liquid PPHKCV N/A Zhongke Biological Pharmaceutical Co. China Hamster kidney cells No Liquid PPHKCV N/A Henan Yuanda Biological Pharmaceutical Co China Vero cells No Liquid PIKA, inactivated, with TLR3- based adjuvant Yisheng Biopharma Inc. China Vero cells No ? PVRV Verorab Sanofi Pasteur France Vero cells Yes Lyophilized WHO_TRS_inside_final_2018_after_Corr_round5.indd 148 24/04/2018 20:50 Annexes 149 Vaccine Brand Producer Country Cell line WHO prequali- fied Type HDCV Imovax Sanofi Pasteur France Human diploid cells No Lyophilized PCECV Rabavert GSK Germany Chick embryo cells Yes Lyophilized PCECV Rabipur GSK India Chick embryo cells Yes Lyophilized HDCV Rabivax Serum Institute of India France Human diploid cells No Liquid PDEV Lyssavac-N /Vaxirab Zydus-Cadila India Duck embryo cells Production stopped Lyophilized PCECV Vaxirab-N Zydus-Cadila India Chick embryo cells No, successor of Vaxirab Lyophilized PVRV Indirab Bharat Biotech India Vero cells No Lyophilized PVRV Abhayrab Indian Immunologicals India Vero cells No Lyophilized BHKV Kokav Vaccination Tarasevich Institute Russian Federation Hamster kidney cells No ? NTV ? Pasteur Institute Algiers Algeria Mouse brain No Liquid? NTV ? Instituto Biológico “Tomás Perón” Argentina Mouse brain No Liquid NTV ? Instituto Nacional de Laboratorios de Salud INLASA Bolivia Mouse brain No Liquid NTV ? Ethiopian Public Health Institute Ethiopia Sheep brain? No Liquid? BHKV, baby hamster kidney cell vaccine; HDCV, human diploid cell vaccine; N/A, not available; NTV, nerve tissue vaccine; PCECV, purified chick embryo cell vaccine; PDEV, purified duck embryo cell vaccine; PPHKCV, purified primary hamster kidney cell vaccine; PVRV, purified Vero cell vaccine WHO_TRS_inside_final_2018_after_Corr_round5.indd 149 24/04/2018 20:50 150 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 4. Four steps for replacing nerve tissue vaccine by modern rabies vaccines produced on cell culture or embryonated eggs Countries that are still producing or using neural tissue-based vaccines should follow this four-step strategy to replace nerve tissue vaccines by modern vaccines. Step 1: Relevant national authorities, usually under the leadership of national health authorities, should make the final decision to change from nerve tissue vaccines to modern vaccines. After reviewing the safety, immunogenicity and efficacy of modern vaccines, the authorities should evaluate the local conditions and assess the feasibility and cost of replacing nerve tissue vaccine. Consideration should be given to the use of the cost-saving intradermal regimens for rabies pre- and post-exposure prophylaxis. Step 2: National guidelines should be formulated that give clear instructions on use of modern vaccines for pre- and post-exposure prophylaxis, including indications for their use and routes of administration; similarly, guidance should be given for use of rabies immunoglobulin and other products. The guidelines should be drawn up by technically competent experts on the basis of the recommendations in reports of the WHO Expert Advisory Group on Rabies, other WHO advisory groups, up-to-date scientific literature, the experience of international and national experts and observations. They should be disseminated to all centres that provide pre- and post-exposure prophylaxis. The guidelines must be based on clear policies concerning, e.g. vaccine subsidy (if any) and handling leftover vaccine, and should be regularly updated. Step 3: Rabies centres should receive a constant supply of safe, effective, WHO- recommended rabies vaccines and immunoglobulin from a central office. Once the decision is made to stop nerve tissue vaccine production and use, the procurement of modern vaccines should start, to avoid any gap in provision of treatment when the nerve tissue vaccine supplies run out. Coordination with regulatory bodies for registration of new rabies biologicals and for post-marketing surveillance of new rabies vaccines and rabies immunoglobulin is also important. Step 4: A network of specialized bite centres should be set up, in which the staff are trained in giving pre- and post-exposure prophylaxis and managing adverse reactions; adequate quantities of rabies biologicals at these centres must be ensured. A referral system should be established to maximize the benefit of the intradermal regimen and to reduce the amount of leftover vaccine. A quality assurance system should be instituted, with standards that are followed by all centres. Provincial and municipal governments should be involved in establishing new centres, ensuring a sustainable supply of rabies vaccines, immunoglobulin and other supplies and guaranteeing reporting, investigation of human rabies cases and monitoring of the rabies programme. WHO_TRS_inside_final_2018_after_Corr_round5.indd 150 24/04/2018 20:50 Annexes 151 Annex 5. Rabies immunoglobulin (RIG) products and producers worldwide, as of August 2017 Category Product name or brand name Formula- tion Vial size Company Country eRIG Anti-rabies serum 200 IU/mL 5 mL Butantan Institute Brazil eRIG Rabix-IG 200 IU/mL 5 mL Incepta Pharmacueticals India eRIG VINRIG 1500 IU 300 IU/mL 5 mL Vins Bioproducts Ltd India eRIG VINRAB 1000 IU 200 IU/mL 5 mL Vins Bioproducts Ltd India eRIG Abhay-RIG 300 IU/mL 5 mL Indian Immunological India eRIG Anti-rabies serum 300 IU/mL 5 mL Haffkine India eRIG EquiRab 300 IU/mL 5 mL Bharat Serums and Vaccines India eRIG EquiRab 200 IU/mL* 5 mL Bharat Serums and Vaccines India eRIG Anti-rabies serum 300 IU/mL 5 mL Serum Institute of India India eRIG Anti-rabies serum 300 IU/mL 5 mL Central Research Institute Kasauli HP India eRIG Plasmarab 300 IU/mL 5 mL Premium Serums India eRIG PremiRab (Rabies antiserum I.P) 300 IU/mL 5 mL Kings Global Biotech Limited India eRIG PremiRab 300 IU/mL 5 mL Premium Serums India eRIG PremiRab 200 IU/mL* 5 mL Premium Serums India eRIG Vinrig 300 IU/mL 5 mL Vins Bioproducts India eRIG Vinrab 200 IU/mL* 5 mL Vins Bioproducts India eRIG TRCS eRIG 200 IU/mL 5 mL Queen Saovabha Memorial Institute Thailand WHO_TRS_inside_final_2018_after_Corr_round6.indd 151 18/03/2019 18:28 152 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Category Product name or brand name Formula- tion Vial size Company Country hRIG Human rabies immunoglobulin 100 IU/mL 2 or 5 mL Hualan Biological Bacterin Co. China hRIG Human rabies immunoglobulin 100 IU/mL 1, 2 or 5 mL Sichuan Yuanda Shuyang Pharmaceutical Co. Ltd China hRIG Human rabies immunoglobulin 100, 200 or 500 IU/vial N/A China National Biotec Group (Sinopharm subsidiary) China hRIG Human rabies immunoglobulin 200 IU/vial 2 mL China Biologic Product, Inc. China hRIG WeiGuang 100 IU/vial 2 mL Shenzhen Weiguang Biological products Co., Ltd China hRIG Imogram Rabies- HT 150 IU/mL 2 or 10 mL Sanofi Pasteur France hRIG Berirab-P 150 IU/mL 2 or 5 mL CSL Behring AG USA hRIG KamRAB/ KedRAB 150 IU/mL 2 or 10 mL Kamada Ltd Israel hRIG Human rabies immunoglobulin 150 IU/mL 500 IU Bio Products Laboratory Limited United Kingdom hRIG HyperRAB S/D 150 IU/mL 2 or 10 mL Grifols USA USA hRIG Rabigam 150 IU/mL 2 mL National Bioproducts South Africa RmAb Rabishield 40 or 100 IU/mL 2.5 mL Serum Institute of India India *This formulation is used for export to other countries WHO_TRS_inside_final_2018_after_Corr_round6.indd 152 18/03/2019 18:28 Annexes 153 Annex 6. Technique for intradermal administration of rabies vaccine and precautions to be taken The intradermal route is safe, immunogenic and more cost–effective than the standard intramuscular route and is therefore recommended, especially when vaccine and financial resources are in limited supply. Rabies vaccines labelled for intramuscular use can be used safely via the intradermal route, even if this constitutes off-label use. Intradermal administration can be used for immunocompromised individuals or individuals receiving chloroquine, hydroxychloroquine drugs or long-term corticosteroid or other immunosuppressive therapy. As the volume of an intradermal vaccine dose is smaller than that of an intramuscular dose, the intradermal route is especially suitable for treating many patients at the same centre, i.e. within the recommended period of 6 h after reconstitution of the vaccine. As currently available rabies vaccines do not contain preservatives, they must be refrigerated after reconstitution and must be discarded after 6 h. Preliminary steps before administering rabies vaccine intradermally: Before administering rabies vaccine intradermally: ■ All staff must be adequately trained in the intradermal injection technique. ■ If the vaccine is given as part of post-exposure prophylaxis, additional steps should be followed; i.e. the wound must be washed and, if applicable, the appropriate dose of rabies immunoglobulin administered. ■ An appropriate 1.0-mL syringe (insulin or tuberculin syringe) and a short, fine hypodermic needle should be used. More costs are saved if a fixed-nee- dle syringe is used, as the void volume is reduced. ■ The intradermal schedule should be selected. WHO recommends the 1-week, two-site intradermal regimen (2-2-2-0-0) for post-exposure prophy- laxis (see section 8.3.3). WHO_TRS_inside_final_2018_after_Corr_round5.indd 153 24/04/2018 20:50 154 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Administering rabies vaccine intradermally Step 1 Aseptically reconstitute the vaccine immediately before administration with the appropriate volume of diluent provided by the manufacturer. Do not use a different diluent or a different amount of diluent. Draw enough vaccine into the syringe to inject a single patient, using appropriate sterile precautions. Carefully remove any air bubbles. Disinfect the injection site with antiseptic, then stretch the surface of the skin and insert the tip of the needle (bevelled edge facing upwards) into the upper layer of the skin (dermis), ensuring that the needle and syringe are almost parallel to the skin surface. Step 2 BBegin injecting the vaccine. If the needle is in the correct position, there is considerable resistance. A raised papule, which looks like orange peel, will appear immediately, measuring 6-8 mm in diameter. If the vaccine is injected easily, or if the papule does not appear, it has been given subcutaneously, i.e. too deeply. In such cases, the correct injection should be repeated. Step 3 Once all doses of 0.1 mL of vaccine have been injected into the same patient, discard the needle and the syringe. Reconstituted vaccine can be used for more than one patient; however, a sterile syringe and needle must be used to draw up vaccine for each patient. The reconstituted vaccine must be stored in a refrigerator at 2-8 °C and used within 6 h. WHO_TRS_inside_final_2018_after_Corr_round5.indd 154 24/04/2018 20:50 Annexes 155 Annex 7. Sites for intramuscular and intradermal administration of human rabies vaccine Deltoid muscles for adults and children Anterolateral thigh for infants and small children Do NOT inject in the gluteal region Intramuscular and intradermal human rabies vaccine administration 15 minutes + REMINDER Wash immediately for 15 minutes, with soap, water and disinfectant Bite wounds: WHO_TRS_inside_final_2018_after_Corr_round5.indd 155 24/04/2018 20:50 156 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Category of exposure Type of exposure to a domestic or wild animal suspected or confirmed to be rabid or animal unavailable for testing Recommended post-exposure prophylaxis I Touching or feeding animals, licks on intact skin (no exposure) None, if reliable case history is availablea I I Nibbling of uncovered skin Minor scratches or abrasions without bleeding (exposure) Administer vaccine immediately Stop treatment if animal remains healthy throughout an observation period of 10 daysb or is proven to be negative for rabies by a reliable laboratory using appropriate diagnostic techniques. Treat as category III if bat exposure involved. I I I Single or multiple transdermalc bites or scratches, contamination of mucous membrane or broken skin with saliva from animal licks, exposures due to direct contact with bats (severe exposure). Administer rabies vaccine immediately, and rabies immunoglobulin, preferably as soon as possible after initiation of post- exposure prophylaxis. Rabies immunoglobulin can be injected up to 7 days after administration of first vaccine dose. Stop treatment if animal remains healthy throughout an observation period of 10 days or is proven to be negative for rabies by a reliable laboratory using appropriate diagnostic techniques. a If an apparently healthy dog or cat in or from a low-risk area is placed under observation, treatment may be delayed. b This observation period applies only to dogs and cats. Except for threatened or endangered species, other domestic and wild animals suspected of being rabid should be euthanized and their tissues examined for the presence of rabies antigen by appropriate laboratory techniques. c Bites especially on the head, neck, face, hands and genitals are category III exposures because of the rich innervation of these areas. Annex 8. Recommended post-exposure prophylaxis according to type of exposure WHO_TRS_inside_final_2018_after_Corr_round5.indd 156 24/04/2018 20:50 Annexes 157 Annex 9. Suggested rabies vaccination certificates for humans The vaccination certificate below is provided as a model. Certificates should be kept carefully by the vaccinated person with his or her personal health documents. Blank certificates should be supplied by the manufacturer of the vaccines. Certificate of pre- or post-exposure rabies vaccination Name: Date of birth: Sex: Address: Telephone no.: For pre-exposure prophylaxis, see 2.1. Post-exposure prophylaxis Date of exposure: WHO category of exposure: I / II / III Biting animal: healthy/sick Animal vaccinated for rabies: Yes / No RABV neutralizing antibody titre/ method: Observations after 10 days (when relevant): Treatment details 1. Wound washed with water/soap/antiviral agent: Yes / No Rabies immunoglobulin Date of treatment: Clinic / hospital name: Place: Type of rabies immunoglobulin: human/equine/mAb Name of rabies immunoglobulin: Manufacturer (batch no. / expiry date): Patient weight: Dose (IU): Total volume infiltrated into and around wound (mL): 2. Rabies vaccination for pre- or post-exposure prophylaxis 2.1 Pre-exposure vaccination regimens: ■ One week, two-site intradermal: days 0 and 7 ■ One week, one-site intramuscular: days 0 and 7 WHO_TRS_inside_final_2018_after_Corr_round5.indd 157 24/04/2018 20:50 158 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 2.2 Modified post-exposure vaccination regimen (for people immunized previously*): ■ Three-day, two-site intradermal: days 0 and 3 ■ Three-day, one-site intramuscular: days 0 and 3 ■ Single-day, four-site intradermal: day 0 2.3 Post-exposure vaccination regimen (for people not previously immunized*): ■ One-week, two-site intradermal: days 0, 3 and 7 ■ Two-week, one-site intramuscular: days 0, 3, 7 and between days 14–28 ■ Three-week intramuscular: days 0 (2 sites), 7 (one site) and 21 (one site) ■ Other (specify) * People who have received at least two sessions of intramuscular or intradermal rabies vaccination, as either pre- or post-exposure prophylaxis, are considered previously immunized against rabies. Pre- or post-exposure prophylaxis vaccination record Date of vaccination Day 0 Day 3 Day 7 Day 14 Day 21 Day 28 Date of vaccination Vaccination centre/Place Vaccine type/name Manufacturer (batch no.)/ Expiry date Dose (mL) Route (intradermal or intramuscular) Site of vaccination Adverse event, if any RABV neutralizing antibody titre, if done/ method Signature of physician General remarks (if any): WHO_TRS_inside_final_2018_after_Corr_round5.indd 158 24/04/2018 20:50 Annexes 159 Annex 10. Currently available oral rabies vaccine products Vaccine strain Product name or brand name Formula- tion Vial size Company Country SPBN- GASGAS IDT Biologika RABV 3rd Reverse genetics with site-directed mutagenesis Licensed for wildlife ERA G333 Prokov RABV 3rd Reverse genetics with site-directed mutagenesis Licensed for wildlife SAG2* Virbac RABV 2nd Monoclonal selection mutant Licensed for wildlife SAD B19 IDT Biologika RABV 1st Serial (passaged in vivo/in vitro) Licensed for wildlife SAD Bern Bioveta RABV 1st Serial (passaged in vivo/ in vitro) Licensed for wildlife RB-97 FGBI “ARRAIH” RABV 1st Serial (passaged in vivo/ in vitro) Licensed for wildlife VRC-RZ2 No information RABV 1st Serial (passaged in vivo/ in vitro) No information KMIEV-94 No information RABV 1st Serial (passaged in vivo/ in vitro) No information V-RG* Merial Vaccinia virus Recombinant, expressing rabies glycoprotein Licensed for wildlife AdRG1.3 Artemis Technologies Adenovirus Recombinant, expressing rabies glycoprotein Licensed for wildlife WHO_TRS_inside_final_2018_after_Corr_round5.indd 159 24/04/2018 20:50 160 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 11. Verbal autopsy questionnaire Suspected rabies Name of interviewer: _______________________ Date of interview: – – / – – / – – – – Name of deceased: ________________________ State/Province:_________________________City/Locality: __________________ Street: ___________________________________________________________ GPS coordinate: ____________ / ___________ I. Information about respondent 1.1 Name of main respondent _______________________ 1.2 Contact information State/Province:_______________________ City/Locality: ____________________ Street: ________________________________ GPS coordinate: ____________ / ___________ 1.3 Age of main respondent ________ (in years) 1.4 To the main respondent: What was your relationship to [deceased’s name]? ■ Parent ■ Spouse ■ Sibling ■ Child ■ Son-in-law or daughter-in-law ■ Parent-in-law ■ Friend or neighbour ■ Community leader ■ Health care worker (facility name): _________________________ ■ Other (specify)_________________________ WHO_TRS_inside_final_2018_after_Corr_round5.indd 160 24/04/2018 20:50 Annexes 161 II. Information about patient 2. Demographics 2.1 Country of origin of deceased: __________________________ 2.2 Ethnic group (optional) _______________________ 2.3 Nationality (optional) ___________________________ 2.4 Sex ______________ 2.5 Age (years) ________ Unknown 2.5.1 For infants, record the most appropriate: Month(s) ____Week(s) ____ Days ____ 2.6 Occupation _____________________________ 2.7 Level of education ■ Illiterate ■ Below primary ■ Primary or middle ■ Secondary or high ■ College graduate ■ Postgraduate ■ Professional degree ■ Other (specify) ________________________________ ■ Unknown III. Exposure (during previous 12 months) 3.1 Did any family pets or livestock die during the 12 months before the patient’s illness? ■ Yes (Date of death: – – / – – / – – – –) ■ No ■ Unknown 3.2 Did [deceased’s name] have any contact with animals (bite, scratch, lick) within the 12 months before the illness that led to death? ■ No ■ Yes ■ Unknown WHO_TRS_inside_final_2018_after_Corr_round5.indd 161 24/04/2018 20:50 162 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 3.3 If yes, please describe the animal contact events Animal 1 Animal 2 Animal 3 3.3.1 On what date did [deceased] have contact with this animal? – – / – – / – – – – – – / – – / – – – – – – / – – / – – – – 3.3.2 What type of animal? – Dog – Cat – Bat – Livestock – Other: __________ – Dog – Cat – Bat – Livestock – Other: __________ – Dog – Cat – Bat – Livestock – Other: __________ 3.3.3 Was the animal owned? – Owned by deceased – Owned by community – Not owned – Wild – Unknown – Owned by deceased – Owned by community – Not owned – Wild – Unknown – Owned by deceased – Owned by community – Not owned – Wild – Unknown 3.3.4 Did the animal have any signs of disease (Describe)? �Yes �No �Unknown �Yes �No �Unknown �Yes �No �Unknown – Aggression – Paralysis – Biting – Hypersalivation – Lethargy – Other: – Aggression – Paralysis – Biting – Hypersalivation – Lethargy – Other: – Aggression – Paralysis – Biting – Hypersalivation – Lethargy – Other: 3.3.5 Is the animal alive today? (If no, estimate date of death?) �Yes �No �Unknown – – / – – / – – – – �Yes �No �Unknown – – / – – / – – – – �Yes �No �Unknown – – / – – / – – – – 3.3.6 Was the animal observed for at least 10 days after the exposure? – Yes, alive after 10 days – Yes, died during observation – No – Unknown – Yes, alive after 10 days – Yes, died during observation – No – Unknown – Yes, alive after 10 days – Yes, died during observation – No – Unknown 3.3.7 Was the animal tested for rabies? – Yes, rabies positive – Yes, rabies negative – No – Unknown – Yes, rabies positive – Yes, rabies negative – No – Unknown – Yes, rabies positive – Yes, rabies negative – No – Unknown WHO_TRS_inside_final_2018_after_Corr_round5.indd 162 24/04/2018 20:50 Annexes 163 Animal 1 Animal 2 Animal 3 3.3.8 Was the deceased bitten by this animal? �Yes �No �Unknown Location of bite: – Head – Trunk – Upper limb – Hands – Lower limb – Genitalia – Other: �Yes �No �Unknown Location of bite: – Head – Trunk – Upper limb – Hands – Lower limb – Genitalia – Other: �Yes �No �Unknown Location of bite: – Head – Trunk – Upper limb – Hands – Lower limb – Genitalia – Other: 3.3.9 Did the deceased have other contact with the animal (i.e. licked, scratched)? – Scratch – Saliva contact with open wound or mucous membrane – Neural tissue contact with open wound or mucous membrane – Other: – Scratch – Saliva contact with open wound or mucous membrane – Neural tissue contact with open wound or mucous membrane – Other: – Scratch – Saliva contact with open wound or mucous membrane – Neural tissue contact with open wound or mucous membrane – Other: 3.3.10 What treatment did the patient recieve for this contact? – Washed the wound – Sought medical care – Received rabies vaccination – Washed the wound – Sought medical care – Received rabies vaccination – Washed the wound – Sought medical care – Received rabies vaccination Notes: WHO_TRS_inside_final_2018_after_Corr_round5.indd 163 24/04/2018 20:50 164 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 4. Rabies treatment 4.1 Did [deceased’s name] receive treatment for any of the animal exposures above? ■ Yes ■ No ■ Don’t know 4.2 Was any of this treatment received at home? ■ Wound washing ■ Over the counter medications ■ Traditional medicines ■ Other: ______________________________ ■ None ■ Unknown 4.3 Where did [deceased’s name] go for medical care for any of the exposures listed above? Traditional healer Medical practitioner Other: _____________ Facility name Facility location Date(s) visited 1: – – / – – / – – – – 2: – – / – – / – – – – 3: – – / – – / – – – – 1: – – / – – / – – – – 2: – – / – – / – – – – 3: – – / – – / – – – – 1: – – / – – / – – – – 2: – – / – – / – – – – 3: – – / – – / – – – – – Antibiotics – Tetanus – Wound washing – Rabies post-exposure prophylaxis or treatment – Traditional medicine – Other (specify) – Antibiotics – Tetanus – Wound washing – Rabies post-exposure prophylaxis or treatment – Traditional medicine – Other (specify) – Antibiotics – Tetanus – Wound washing – Rabies post-exposure prophylaxis or treatment – Traditional medicine – Other (specify) WHO_TRS_inside_final_2018_after_Corr_round5.indd 164 24/04/2018 20:50 Annexes 165 4.4 If the patient received rabies vaccination, please record the type of vaccine and dates received: ■ Nerve tissue vaccine ■ No. of injections ____________________ ■ Date started: – – / – – / – – – – ■ Vaccination series completed? ____Yes _____No _____Donít know ■ If yes, date completed: – – / – – / – – – – ■ Nerve tissue vaccine ■ Cell culture vaccine ■ No. of injections ____________________ ■ Date started: – – / – – / – – – – CCV RIG Vaccine 1 Vaccine 2 Vaccine 3 Vaccine 4 Vaccine 5 Dose received? – Yes – No – Unknown – Yes – No – Unknown – Yes – No – Unknown – Yes – No – Unknown – Yes – No – Unknown – Yes – No – Unknown Date received? 4.5 Had the patient ever been vaccinated against rabies prior to this exposure? ■ Yes: Year of vaccination: – – / – – / – – – – ■ No ■ Unknown 5. Signs and symptoms 5.1 Time to symptom onset and death Interviewer: I am going to ask you some questions about [deceased’s name’s] activities during the 3 months before the illness began and during the illness. 5.1.1 When did the illness that led to death begin? Day – – Month – – Year – – – – Unknown 5.1.2 If you donít remember the exact date, approximately how long ago did the illness begin? Day – – Month – – Year – – – – Unknown WHO_TRS_inside_final_2018_after_Corr_round5.indd 165 24/04/2018 20:50 166 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 5.1.3 How many days after illness did [deceased’s name] die? Number (estimate if needed): ___________ 5.2 During the illness did [deceased’s name] seek medical assistance? ■ Yes: (Date): – – / – – / – – – – ■ No ■ Unknown 5.3 During the illness was [deceased’s name] admitted to a hospital? ■ Yes: (Date): – – / – – / – – – – ■ No ■ Unknown 5.4 Characteristics of illness that led to death --- 5.5 Was any relevant diagnostic testing performed? Disease Test performed Date Result Comment Encephalitis Lumbar puncture Blood count WBC count: Rabies DFA or DRIT Mosquito-borne encephalitis Herpes simplex virus Zoster encephalitis Enterovirus Measles virus Bacterial meningitis Malaria Toxoplasmosis 5.6 Date of death WHO_TRS_inside_final_2018_after_Corr_round5.indd 166 24/04/2018 20:50 Annexes 167 5.6.1 What was the date of [deceased’s name] death? Day – – /Month – – /Year – – – – 5.6.2 Where did [deceased’s name] die? ■ Home ■ Hospital (specify)_____________ ■ Other health facility (specify) ________________ ■ Other (specify)________________ 5.6.3 Did anyone else in the community develop an illness similar to [deceased’s name] within the past 12 months? (If “Yes”, collect contact information for other suspected cases to initiate verbal autopsy of additional cases.) ■ Yes ■ No ■ Unknown If yes, please describe: 6. Postmortem information 6.1 Postmortem report available (if any): ■ Yes ■ No ■ Unknown 6.2 Death certificate available? ■ Yes ■ No ■ Unknown 6.3 Did [deceased’s name] have any evidence of recent wounds? ■ Yes ■ No ■ Unknown 6.4 Did [deceased’s name] have any evidence of healed wounds? ■ Yes WHO_TRS_inside_final_2018_after_Corr_round5.indd 167 24/04/2018 20:50 168 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report ■ No ■ Unknown Contact investigation Collect the names and contact information for any family, community members or hospital workers who had contact with the suspected rabies case in the 14 days before symptom onset until death. Collect the names and contact information for any people who had contact with the animal suspected of transmitting rabies to the case. Risk assessments should be conducted with these people to rule out potential exposure. Information to guide enumerators in deciding on the likelihood of human rabies Human exposure to rabies Possible exposure: A person who had close contact (usually a bite or scratch) with a rabies-susceptible animal in (or originating from) a rabies-infected area (question 3.2). Probable exposure: A person who had close contact (usually a bite or scratch) with an animal displaying clinical signs consistent with rabies at time of the exposure or within 10 days following exposure in a rabies-infected area (questions 3.3.4, 3.3.5, 3.3.6). Confirmed exposure: A person who has had close contact (usually a bite or scratch) with a laboratory-confirmed rabid animal (question 3.3.7). WHO_TRS_inside_final_2018_after_Corr_round5.indd 168 24/04/2018 20:50 Annexes 169 Human clinical case definition: A person with fever (question 5.4.3); AND two or more clinical signs compatible with rabies (questions 5.4.5, 5.4.6, 5.4.7, 5.4.8, 5.4.9, 5.4.10, 5.4.11, 5.4.12, 5.4.14, 5.4.15, 5.4.16, 5.4.17); AND no previous vaccination for rabies (questions 4.4 and 4.5); AND death within 21 days of symptom onset (question 5.1.3); AND no other laboratory findings consistent with an alternative diagnosis (question 5.5). OR A person whose health care record contains a diagnosis of rabies (question 5.5). OR A person whose death certificate lists rabies as a cause of death or a significant condition contributing to death (questions 6.1 and 6.2). Classification of human rabies Not a case: Does not meet the clinical definition Suspected: A case that is compatible with the human clinical case definition Probable: A suspected case with probable or confirmed exposure to rabies Confirmed: A suspected or probable case that is confirmed in a laboratory Determination of case category Names of Investigator(s), signatures of local informants and designation 1. _________________________ _____________________________ 2. _________________________ _____________________________ 3. _________________________ _____________________________ 4. _________________________ _____________________________ Additional enclosures (description) as evidence of rabies 1. ________________________________________ (Pages____________) WHO_TRS_inside_final_2018_after_Corr_round5.indd 169 24/04/2018 20:50 170 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report 2. ________________________________________ (Pages____________) 3. ________________________________________ (Pages____________) 4. ________________________________________ (Pages____________) WHO_TRS_inside_final_2018_after_Corr_round5.indd 170 24/04/2018 20:50 Annexes 171 Annex 12. Animal bite investigation form Date of notification: _ _/ _ _ / _ _ _ _ Name: _______________________ Animal ID: |__|__| |__|__| |__||__| NOTIFICATION 1. Reported from: � Surveillance unit__________________ � Health department: ________________________ � Hospital: _________________________________ � Veterinary agent: _______________________________ � Veterinarian � Public 2. Reason for report: � Human exposure (bite or scratch) � Sick animal � Hit by car � Other ____________ 3. Type of animal: � Dog � Cat � Goat � Pig � Mongoose � Other ____________________________ 4. Was this animal: � Owned � Stray � Unknown 5. Location of animal exposure: District__________________ Commune ______________________ Street_____________________ Notes: Medical contact’s name: ___________________ Telephone number: _________________ Patient’s name: _________________________ Age: ___________ Telephone number: _________________ WHO_TRS_inside_final_2018_after_Corr_round5.indd 171 24/04/2018 20:50 172 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report INVESTIGATION 6. Date of investigation: _ _/ _ _ / _ _ _ _ 7. Type of investigation? � Owner telephone consultation � In-person investigation 8. How many people were bitten by the animal? ______________ How many people were scratched by the animal? ______________ 9. How many people started rabies vaccine? _________How many people did you refer for medical treatment? __________ 10. What other animals were bitten by this animal? How many? � Dog _____ � Cat _____ � Goat _____ � Other _____ 11. Was the animal located? � Yes � Alive � Escaped capture � Dead, killed by owner � Dead, killed by public � Dead, killed by car � Dead, natural causes � Dead, unknown causes No � Not found � Dead, killed by owner � Dead, killed by public � Dead, killed by car � Dead, natural causes � Dead, unknown causes 12. Where was animal located? Department/Commune__________________ GPS coordinate: ____________ / ___________ 13. What is the animal’s age? � Puppy � Junior � Adult � Senior � Unknown 14. What is the animal’s sex? � Male � Female 15. Has the animal been vaccinated for rabies? � Yes, year: _________ � Not vaccinated � Unknown Notes: WHO_TRS_inside_final_2018_after_Corr_round5.indd 172 24/04/2018 20:50 Annexes 173 ASSESSMENT 16. Signs of disease: � Aggression � Biting � Hypersalivation � Paralysed � Lethargy � Unknown � Other (specify) _____________________________ 17. Rabies assessment: � Healthy � Sick, signs of rabies � Sick, not rabies � Dead � Other (specify) _________________________________________________ 18. Assessment decision: � Quarantine � Euthanize � Dead � Other _______________________ 19. Quarantine results: � Healthy after 14 days 20. Was the animal submitted for testing? � Yes, date: _________ � No Notes: Day 5 follow-up: Day 10 follow-up: LAB 21. Date specimen received at laboratory: ______________ 22. Lab ID Number: ______________ 23. Date tested: ______________ 24. Test results: � Positive � Negative � Inconclusive � Hospital notified, date: _ _/ _ _ / _ _ _ _ � Health department notified, date: _ _/ _ _ / _ _ _ _ � Euthanised � Natural causes � Other ________ � Killed by owner � Killed by community WHO_TRS_inside_final_2018_after_Corr_round5.indd 173 24/04/2018 20:50 174 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 13. WHO data collection template Co un tr y C ou nt ry su bd iv isi on (i f a pp lic ab le ): Fo ca l p oi nt (m in ist ry o f h ea lth , o th er ; p le as e i nd ic at e) : Ye ar H um an ra bi es A ni m al ra bi es H um an ra bi es Bi te c as es Po st -e xp os ur e pr op hy la xi s Ra bi es c as es D og po pu la tio n Re m ar ks N o. o f ca se sa N o. o f d og b ite s N o. o f bi te s by ot he r an im al sb N o. o f pe op le re ce iv ed PE P N o. o f pe op le re - ce iv ed R IG ad di tio na l to P EP N o. o f ca se s in do gs N o. o f ca se s in ot he r an im al sb N o. o f do gs in co un tr y N o. o f do gs va cc i- na te d Ca te go ry II Ca te go ry II I Ca te go ry un kn ow n 20 16 20 15 20 14 20 13 20 12 So ur ce c PE P, po st- ex po su re p ro ph yl ax is; R IG , r ab ie s i m m un og lo bu lin a S ho ul d in clu de b ot h co nfi rm ed b y la bo ra to ry an d di ag no se d on cl in ic al g ro un ds b O th er m am m al s o nl y; p le as e i nd ic at e s pe ci es in re m ar ks co lu m n. c P le as e i nd ic at e d at a s ou rc e f or ev er y in di ca to r ( e.g . m in ist ry o f h ea lth , n at io na l s ta tis tic s o ffi ce , n at io na l h ea lth re po rt o r e sti m at e) WHO_TRS_inside_final_2018_after_Corr_round5.indd 174 24/04/2018 20:50 Annexes 175 Annex 14. Template dossier for validation and verification This template dossier was designed to help managers of national rabies programmes prepare a dossier with supporting evidence for presentation to WHO, requesting validation that rabies has been eliminated as a public health problem and/or requesting verification that dog-mediated rabies has been eliminated. The information presented in the dossier will help reviewers to understand the achievements of the programme by providing both epidemiological evidence and the broader context. (Country) Date of submission: Date of review: 1. Background A country previously endemic for rabies may apply for accreditation as having eliminated rabies as a public health problem (validation) if it has not had a human death from dog- mediated rabies for at least 2 years (24 months), is operating and continues to maintain an adequate surveillance and reporting system for rabies and demonstrates effective implementation of a rabies control programme in human and animal populations. A country may apply for accreditation as having eliminated dog-mediated rabies (verification) if it, in addition to meeting the criteria for validation described above, is operating and continues to maintain an enhanced surveillance and reporting system for rabies and demonstrates an effective strategy for maintaining freedom from dog- mediated rabies. 1.1 General documentation (optional) Adequate documentation is necessary to provide the essential data for validation and verification. It is preferable that these data and subsequent documentation be standardized among countries within a region. For both validation and verification, provide an overview of: a. Demographic and economic features of the country b. Overview of the health care system in the country c. Overview of the animal health system in the country d. Information about past rabies epidemiology in the country, including interventions before enforcement of the current national rabies programme WHO_TRS_inside_final_2018_after_Corr_round5.indd 175 24/04/2018 20:50 176 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report For verification, also provide an overview of: a. Procedures for provision of post-exposure prophylaxis b. Procedures for clinical and laboratory diagnosis of human and animal cases c. If completed, evidence of zero human rabies deaths (e.g. documentation submitted for validation) 2. Rabies programme overview (required) For validation, describe in narrative form: a. Evidence of a national rabies control programme, including: i. Regulatory framework relevant to rabies, including rabies notification ii. National rabies control strategy, including implementation, responsibilities by sector, structure and year established iii. Data collection and management system b. Evidence that control activities are in place, including: i. Availability and provision of PEP in the country ii. Campaigns on rabies awareness and dog-bite prevention iii. Overview of dog vaccination campaigns iv. Information on dog population management measures in place, including movement regulations v. OIE endorsement1 of an official control programme for dog-mediated rabies, if successfully sought For verification, describe in narrative form: a. For formerly endemic countries, evidence that mass dog vaccination programmes controlled rabies i.e.: i. Overview of dog vaccination campaigns over at least 5 years, including ongoing mass dog vaccination programmes in at-risk areas or other evidence of successful control of canine rabies ii. Estimated dog population size, methods for coverage and population estimates b. Information on dog population management measures in place Evidence that the national control programme has controlled rabies iii. A decrease in the occurrence of rabies over at least 5 years for countries with a recent history of endemic rabies 1 OIE endorsement processes for dog-mediated rabies control programmes are being prepared and are expected to come into effect in 2019. WHO_TRS_inside_final_2018_after_Corr_round5.indd 176 24/04/2018 20:50 Annexes 177 iv. OIE self-declaration of freedom from rabies if successfully sought (http://www. oie.int/index.php?id=169&L=0&htmfile=chapitre_selfdeclaration.htm) (optional) 3. Implementation of national rabies control and prevention strategy 3.1 Evidence of control activities (required) For both validation and verification, describe in narrative form: ■ Availability and provision of PEP in the country, including: – type of vaccine and RIG available and their distribution mechanisms sub-na- tionally – number and proportion of animal bite treatment or primary health care cen- tres with capacity for PEP (provision of vaccine only versus vaccine and RIG) – standard operating procedures for PEP administration – number of vaccine and RIG doses administered per year – proportion of PEP courses administered by intramuscular or intradermal regi- mens – PEP payment systems ■ Number and geographical coverage of campaigns on rabies awareness and dog- bite prevention ■ Dog vaccination campaigns during the past 5 years, including: – number of dogs vaccinated per year and by appropriate administrative sub- division – vaccination coverage by year and by appropriate administrative subdivision – estimated dog population in the country – target animal populations for vaccination – type of vaccine used – source of vaccine – current vaccine stocks ■ Dog population management, including regulations on dog movement. WHO_TRS_inside_final_2018_after_Corr_round5.indd 177 24/04/2018 20:50 178 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report For verification, also describe: ■ The method by which dog vaccination coverage and population sizes were esti- mated over a minimum of 5 years. ■ Emergency preparedness and response plan to be implemented in case of intro- duction or re-emergence of dog-mediated rabies. 3.2 Rabies surveillance (required) For both validation and verification, describe: a. Evidence that adequate rabies surveillance is in place to detect rabies deaths if they were to occur, including: i. National notification of both human and animal rabies cases ii. Capability to diagnose rabies cases with WHO-/OIE-recommended standard diagnostic tests iii. Evidence of sample submissions from all parts of endemic and adjacent (rabies-free) areas of the country, including maps showing positive and negative test results to assess coverage and possible gaps in surveillance iv. The number of suspected or probable human rabies cases or probable rabies exposures that have been investigated each year and the nature of the investigation (including clinical and laboratory diagnosis, verbal autopsy, community surveys, trace-back investigations) v. Incidence of cases of acute encephalitis syndrome (AES)2 per 100 000 people per year and description of the surveillance system for detection, reporting and investigation of cases of human AES from all areas of the country; OR vi. If AES data are not available, or are not exhaustive, demonstration of a surveillance system able to detect, report and investigate suspect cases of human rabies from all areas of the country vii. Rabies surveillance for animals in line with the OIE Terrestrial animal health code (Chapter 1.4: http://www.oie.int/index.php?id=169&L=0&htmfile= chapitre_surveillance_general.htm), including: – Number of rabies cases in dogs and other animals (clinical and laboratory- confirmed) – Number of dog and other suspected rabid animal bite incidents in humans and animals per year 2 AES is clinically defined as a syndrome in a person of any age, at any time of year involving acute onset of fever and at least one of: (a) change in mental status (including symptoms such as confusion, disorientation, coma or inability to talk); (b) new onset of seizures (excluding simple febrile seizures). Other early clinical findings may include increased irritability, somnolence or abnormal behaviour greater than that seen with usual febrile illness. The incidence of AES will be evaluated with reference to expected levels. WHO_TRS_inside_final_2018_after_Corr_round5.indd 178 24/04/2018 20:50 Annexes 179 – Number of routine epidemiological investigations on suspected or prob- able rabies cases in dogs, including procedures for rapid collection and transport of samples from suspected cases to a laboratory for diagnosis – Sampling strategy used – Methods for monitoring dog vaccination coverage For verification, also describe: b. Evidence that enhanced dog rabies surveillance has been in place for at least 24 months after the last detected rabies case, including: i. Risk assessment of probable exposures presenting to health facilities – Numbers of probable exposures reported (and PEP courses initiated) – Number of alerts on and early detections of any imported cases ii. Epidemiological investigations of probable exposures undertaken rapidly (< 14 days from clinical presentation) and the outcome of the investigation, including: – Numbers of probably rabid animals reported – Sample collection and testing of all dead or killed suspected rabid animals. It is expected that samples can be recovered from ~50% of suspected ani- mals. All animals that did not survive the 10-day observation period should be tested. – In the event of a confirmed human or animal rabies case, molecular char- acterization of the virus isolate to identify whether the case was due to in- fection with a wildlife variant, a bat lyssavirus or a non-indigenous infection (if available). 3.3 Procedures to maintain validation and/or verification (required) For both validation and verification, describe in narrative form: a. Plans for post-validation and/or post-verification rabies surveillance, including: i. Procedures and evidence of continued surveillance to ensure early detection of any imported case and the appropriate treatment of people exposed to non-canine rabies variants or lyssaviruses or bitten while travelling b. Plans for continued provision of human post-exposure prophylaxis c. Cross-border plan to prevent reintroduction of rabies from neighbouring countries WHO_TRS_inside_final_2018_after_Corr_round5.indd 179 24/04/2018 20:50 180 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report For verification, also describe: a. OIE self-declaration of country free from infection with dog-mediated RABV (see Chapter 1.6 of the OIE Terrestrial animal health code: http://www.oie.int/ index.php?id=169&L=0&htmfile=chapitre_selfdeclaration.htm). b. Evidence that a contingency plan is in place to effectively respond to an introduction i. Animal movement regulations ii. Regular risk assessments – Of incursions from other countries/regions – Of other circulating wildlife rabies variants/ lyssaviruses iii. Outbreak response strategy, including evidence of continued access to dog vaccines and PEP in the event of an outbreak 4. Resources and partnerships (optional) For both validation and verification, provide: a. Briefly describe the human resources employed to implement the programme b. Estimate internal and external financial resources used for the programme over time c. Sustainable resource mobilization strategy for the post-validation/verification phase 5. Special issues (optional) For both validation and verification, provide the following: a. Descriptions of any special circumstances that have affected the programme. These could include, but are not limited to: i. Stability or security issues in the country; and/or ii. Re-introduction from other rabies-endemic countries. b. Descriptions of any specific efforts to investigate rabies cases and/or intervention coverage in difficult-to-reach populations (e.g., nomadic peoples, internally displaced persons, or refugees). WHO_TRS_inside_final_2018_after_Corr_round5.indd 180 24/04/2018 20:50 Annexes 181 6. Bibliography (required) Insert a bibliography of all data sources used to develop this dossier, including: ■ Ministry of health records ■ Records from veterinary services ■ Published papers (scientific, policy, etc.) ■ Academic theses and dissertations Copies of unpublished documents may be requested by WHO. 7. Abbreviations (required) Insert a list of all abbreviations used in the dossier, with their definitions. WHO_TRS_inside_final_2018_after_Corr_round5.indd 181 24/04/2018 20:50 182 W H O T ec hn ic al R ep or t S er ie s N o. 1 01 2, 2 01 8 WHO Expert Consultation on Rabies Third report Annex 15. WHO collaborating centres on rabies, neurovirology, viral zoonoses and zoonoses control WHO Collaborating Centre for Reference and Research on Rabies, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris, France Head, Dr Hervé Bourhy; e-mail: herve.bourhy@pasteur.fr WHO Collaborating Centre on Research and Management on Zoonoses Control, Laboratory of Rabies and Wild Animals of Nancy, Agricultural and Veterinary Technopole, PO 40009, 54220 Malzéville, France Head, Dr Florence Cliquet; e-mail: florence.cliquet@anses.fr WHO Collaborating Centre for the Characterization of Rabies and Rabies-related Viruses, Animal Health and Veterinary Laboratories Agency, Weybridge, Surrey KT15 3NB, United Kingdom Head, Dr Anthony Fooks; e-mail: tony.fooks@apha.gsi.gov.uk WHO Collaborating Centre for Rabies Surveillance and Research, Friedrich-Loeffler Institut, Federal Research Institute for Animal Health, Sudufer 10, 17493 Greifswald- Insel Reims, Germany Head, Dr Thomas Müller; e-mail: thomas.mueller@fli.bund.de WHO Collaborating Centre for Traveller’s Health, University of Zurich, Hirschengraben 84, 8001 Zurich, Switzerland Head, Dr Christoph Hatz, e-mail: christoph.hatz@unibas.ch WHO Collaborating Centre for Control and Epidemiology of Rabies in Carnivores, Canadian Food Inspection Agency, 3851 Fallowfield Road, ON, Canada Head, Dr Christine Fehlner-Gardiner; e-mail: Christine.Fehlner-Gardiner@inspection. gc.ca WHO Collaborating Centre for Neurovirology, Thomas Jefferson University, 233 South 10th Street, Philadelphia, PA 19107, USA Head, Dr Matthias Schnell; e-mail: matthias.schnell@jefferson.edu WHO Collaborating Centre for Reference and Research on Rabies, Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104, USA Head, Dr Hildegund Ertl; e-mail: ertl@wistar.upenn.edu WHO_TRS_inside_final_2018_after_Corr_round5.indd 182 24/04/2018 20:50 Annexes 183 WHO Collaborating Centre for Reference and Research on Rabies, Centers for Disease Control and Prevention, 1600 Clifton Road, Atlanta, GA 30333, USA Head, Dr Jesse Blanton; e-mail: asi5@cdc.gov WHO Collaborating Centre in Rabies, Institut Pasteur of São Paulo, Av. Paulista, 393, São Paulo, Brazil Head, Dr Lucianna Gomes / Dr Juliana Galera Castilho; e-mail pasteur@pasteur.saude. sp.gov.br / jgcastilho@pasteur.saude.sp.gov.br WHO Collaborating Centre for Rabies Epidemiology, Division of Zoonosis, National Centre for Disease Control, 22-Sham Nath, Delhi 110054, India Head, Dr Mala Chabra; e-mail: malachhabra@yahoo.co.in WHO Collaborating Centre for Reference and Research in Rabies, Department of Neurovirology, National Institute of Mental Health and Neurosciences, PO Box 2900, 560029 Bangalore, India Head, Professor V. Ravi / Dr Reeta Mani; e-mail: virusravi@gmail.com/ drreeta@gmail. com WHO Collaborating Centre for Research on Rabies Pathogenesis and Prevention, Queen Saovabha Memorial Institute, Thai Red Cross Society, 1871 Rama IV Road, 10330 Bangkok, Thailand Head, Professor Visith Sitprija; e-mail: sitprija@yahoo.com; and Dr Pakmanee Narumol; e-mail: npakmanee@yahoo.com WHO Collaborating Centre for Reference and Research on Rabies, Pasteur Institute of Iran, Pasteur No. 69, 1316943551, Tehran, Islamic Republic of Iran Head, Dr Alireza Gholami; e-mail: a.gholami@pasteur.ac.ir   WHO_TRS_inside_final_2018_after_Corr_round5.indd 183 24/04/2018 20:50 The World Health Organization was established in 1948 as a specialized agency of the United Nations serving as the directing and coordinating authority for international health matters and public health. One of WHO’s constitutional functions is to provide objective and reliable information and advice in the field of human health, a responsibility that it fulfils in part through its extensive programme of publications. The Organization seeks through its publications to support national health strategies and address the most pressing public health concerns of populations around the world. To respond to the needs of Member States at all levels of development, WHO publishes practical manuals, handbooks and training material for specific categories of health workers; internationally applicable guidelines and standards; reviews and analyses of health policies, programmes and research; and state-of-the-art consensus reports that offer technical advice and recommendations for decision-makers. These books are closely tied to the Organization’s priority activities, encompassing disease prevention and control, the development of equitable health systems based on primary health care, and health promotion for individuals and communities. Progress towards better health for all also demands the global dissemination and exchange of information that draws on the knowledge and experience of all WHO’s Member countries and the collaboration of world leaders in public health and the biomedical sciences. To ensure the widest possible availability of authoritative information and guidance on health matters, WHO secures the broad international distribution of its publications and encourages their translation and adaptation. By helping to promote and protect health and prevent and control disease throughout the world, WHO’s books contribute to achieving the Organization’s principal objective – the attainment by all people of the highest possible level of health. The WHO Technical Report Series makes available the findings of various international groups of experts that provide WHO with the latest scientific and technical advice on a broad range of medical and public health subjects. Members of such expert groups serve without remuneration in their personal capacities rather than as representatives of governments or other bodies; their views do not necessarily reflect the decisions or the stated policy of WHO. For further information, please contact WHO Press, World Health Organization; 1211 Geneva 27, Switzerland; www.who.int/bookorders; tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: bookorders@who.int. SELECTED WHO PUBLICATIONS OF RELATED INTEREST WHO Position Paper on Rabies Vaccines Weekly Epidemiological Record, 2010, 85: 309-320 WHO Expert Consultation on Rabies. Second report. Geneva, World Health Organization, 2013 WHO Technical Report Series, No. 982 WHO Expert Consultation on Rabies. First report. Geneva, World Health Organization, 2005 WHO Technical Report Series, No. 931 WHO Expert Committee on Rabies. Eighth report. Geneva, World Health Organization, 1992 WHO Technical Report Series, No. 824 Laboratory Techniques in Rabies. Fourth edition. Geneva, World Health Organization, 1996 Further information on these and other WHO publications can be obtained from WHO Press, World Health Organization ■ 1211 Geneva 27, Switzerland ■ www.who.int/bookorders tel.: +41 22 791 3264; fax: +41 22 791 4857; e-mail: bookorders@who.int WHO_TRS_Cover_final_2018_124C.indd 2 17/04/2018 20:11 W H O Expert Consultation on R abies Since the launch of the Global framework to eliminate human rabies transmitted by dogs by 2030 in 2015, WHO has worked with the Food and Agriculture Organization of the United Nations, the World Organisation for Animal Health, the Global Alliance for Rabies Control and other stakeholders and partners to prepare a global strategic plan. This includes a country-centric approach to support, empower and catalyse national entities to control and eliminate rabies. In this context, WHO convened its network of collaborating centres on rabies, specialized institutions, members of the WHO Expert Advisory Panel on Rabies, rabies experts and partners to review strategic and technical guidance on rabies to support implementation of country and regional programmes. This report provides updated guidance based on evidence and programmatic experience on the multiple facets of rabies prevention, control and elimination. Key updates include: (i) surveillance strategies, including cross-sectoral linking of systems and suitable diagnostics; (ii) the latest recommendations on human and animal immunization; (iii) palliative care in low- resource settings; (iv) risk assessment to guide management of bite victims; and (v) a proposed process for validation and verification of countries reaching zero human deaths from rabies. The meeting supported the recommendations endorsed by the WHO Strategic Advisory Group of Experts on Immunization in October 2017 to improve access to affordable rabies biologicals, especially for underserved populations, and increase programmatic feasibility in line with the objectives of universal health coverage. The collaborative mechanisms required to prevent rabies are a model for collaboration on One Health at every level and among multiple stakeholders and are a recipe for success. Rabies is a vaccine-preventable disease. The provision of support to countries will end the pain and suffering due to rabies that burdens people, especially children. Investing in rabies control and elimination strengthens health systems, improves equity and access to health care and contributes to sustainable development. Investment in rabies elimination is not only for elimination of this fatal but preventable disease but also for building capacity in the world’s most neglected regions. This report, requested by countries, provides hands-on guidance to drive progress towards rabies elimination. 1012 W H O Technical Report Series W H O T e c h n i c a l R e p o r t S e r i e s 1012 WHO Expert Consultation on Rabies Third report WHO_TRS_Cover_final_2018_124C.indd 1 17/04/2018 20:11 ISBN 978-92-4-121021-8

Edited by Charles E. Rupprecht LYSSA LLC Atlanta, Georgia, USA Anthony R. Fooks Animal and Plant Health Agency Addlestone, Surrey, United Kingdom Bernadette Abela-Ridder Department of Control of Neglected Tropical Diseases World Health Organization Geneva, Switzerland Laboratory techniques in rabies Fifth edition Volume 2 Laboratory techniques in rabies Fifth edition Volume 2 Edited by Charles E. Rupprecht LYSSA LLC Atlanta, Georgia, USA Anthony R. Fooks Animal and Plant Health Agency Addlestone, Surrey, United Kingdom Bernadette Abela-Ridder Department of Control of Neglected Tropical Diseases World Health Organization Geneva, Switzerland Laboratory techniques in rabies, fifth edition. Volume 2/Charles E Rupprecht, Anthony R Fooks, Bernadette Abela-Rid- der, editors. ISBN 978-92-4-151530-6 © World Health Organization 2019 Some rights reserved. This work is available under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 IGO licence (CC BY-NC-SA 3.0 IGO; https://creativecommons.org/licenses/by-nc-sa/3.0/igo). Under the terms of this licence, you may copy, redistribute and adapt the work for non-commercial purposes, provided the work is appropriately cited, as indicated below. In any use of this work, there should be no suggestion that WHO endorses any specific organization, products or services. The use of the WHO logo is not permitted. If you adapt the work, then you must license your work under the same or equivalent Creative Commons licence. If you create a trans- lation of this work, you should add the following disclaimer along with the suggested citation: “This translation was not created by the World Health Organization (WHO). WHO is not responsible for the content or accuracy of this translation. The original English edition shall be the binding and authentic edition”. Any mediation relating to disputes arising under the licence shall be conducted in accordance with the mediation rules of the World Intellectual Property Organization. Suggested citation. Rupprecht CE, Fooks AR, Abela-Ridder B, editors. Laboratory techniques in rabies, fifth edition. Volume 2. Geneva: World Health Organization; 2018. Licence: CC BY-NC-SA 3.0 IGO. Cataloguing-in-Publication (CIP) data. CIP data are available at http://apps.who.int/iris. Sales, rights and licensing. To purchase WHO publications, see http://apps.who.int/bookorders. To submit requests for commercial use and queries on rights and licensing, see http://www.who.int/about/licensing. Third-party materials. If you wish to reuse material from this work that is attributed to a third party, such as tables, fig- ures or images, it is your responsibility to determine whether permission is needed for that reuse and to obtain permis- sion from the copyright holder. The risk of claims resulting from infringement of any third-party-owned component in the work rests solely with the user. General disclaimers. The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of WHO concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted and dashed lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or rec- ommended by WHO in preference to others of a similar nature that are not mentioned. Errors and omissions excepted, the names of proprietary products are distinguished by initial capital letters. All reasonable precautions have been taken by WHO to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either expressed or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall WHO be liable for damages arising from its use. The named editors alone are responsible for the views expressed in this publication. Contents Foreword .............................................................................................................................................................. iv Preface .............................................................................................................................................................. v List of abbreviations and acronyms used in this manual .............................................................................................. vi Part 5. Demonstration of viral nucleic acids and sequences Chapter 27. Conventional pan-lyssavirus reverse transcriptase polymerase chain reaction ................................... 1 Chapter 28. Rabies real-time reverse transcriptase polymerase chain reaction ...................................................... 17 Chapter 29. Sanger sequencing of lyssaviruses ...................................................................................................... 35 Chapter 30. The FTA sampling method for collecting, storing brain material and identification of lyssaviruses ..... 44 Chapter 31. Application of next generation sequencing to rabies virus and other lyssaviruses .............................. 49 Chapter 32. Reverse transcriptase loop-mediated isothermal amplification system for the detection of rabies virus ....................................................................................................................................... 62 Chapter 33. Detection of lyssavirus nucleic acids by in situ hybridization .............................................................. 71 Chapter 34. Rapid diagnosis and genetic typing of rabies virus and other lyssaviruses using SYBR Green RT-PCR and pyrosequencing assays .............................................................................. 80 Part 6. Production of biologicals Chapter 35. Regulatory perspectives on the design of human rabies biologicals ................................................... 94 Chapter 36. Regulatory issues in the development of animal biologicals for rabies................................................ 107 Chapter 37. Preparation of fluorescent antibody conjugate for the direct fluorescent antibody test ...................... 112 Chapter 38. Anti-rabies monoclonal antibody production using mammalian expression systems ......................... 128 Chapter 39. Generation of anti-rabies single domain antibodies by display technologies ...................................... 137 Chapter 40. Production of monospecific polyclonal rabies virus antibodies in birds .............................................. 150 Chapter 41. Plant production of monoclonal antibodies for rabies ......................................................................... 160 Part 7. Potency determinations Chapter 42. The NIH test for potency testing of vaccines ....................................................................................... 180 Chapter 43. The serological potency assay for batch potency testing of inactivated rabies .................................. 189 Chapter 44. In vitro tests for rabies vaccine potency testing ................................................................................... 192 Laboratory techniques in rabies Fifth edition iv Laboratory techniques in rabies Foreword For more than 5000 years, humans have lived in fear of a bite from a rabid animal, so much so that the first written account of rabies, in the 23rd century BC, set the penalty for an owner’s dog biting another individual at “two-thirds of a mine of silver”, or about a half-day’s work. Today, our focus is more on preventing rabies and advocating for its elimination, rather than imposing penalties, and our understanding of the virus has greatly improved since the 23rd century BC. The Food and Agriculture Organization of the United Nations (FAO), the World Organisation for Animal Health (OIE) and the World Health Organization (WHO) have prioritized action against rabies and, together with Member countries, have set a goal of zero rabies deaths by 2030. Diagnostics are crucial in attaining this goal. New laboratory techniques and advancements in science have yielded better diagnostic techniques and control strategies to aid the more than 3 billion people, mainly children, in Asia and Africa who are threatened by the virus every day. Rabies is a preventable disease, yet despite the availability of efficacious and affordable vaccines, more than 60 000 people worldwide die agonizing deaths every year from the disease. No diagnostic tests are available to detect the rabies virus before the onset of clinical disease, and further research on diagnostic techniques in the field of rabies is therefore paramount. The impact of suitable laboratory capacity on surveillance and elimination of the disease worldwide is evident. The OIE’s Manual of diagnostic tests and vaccines for terrestrial animals provides internationally agreed standards for the production and control of vali- dated veterinary diagnostic methods and vaccines for use in animals. The fourth edition of WHO’s Laboratory techniques in rabies has been a guiding reference for many rabies laboratories. The first edition (1954) stated that “rabies research is far from static” and, since its publication more than 60 years ago, OIE and WHO have worked to evaluate subsequent advancements in laboratory techniques in rabies. This fifth edition provides insight into validated methods recommended for use in diagnostic laboratories, but it also includes research. While not currently applicable to all settings, these research methods may stimulate the development of improved techniques for diagnosis of rabies in the future. Improved diagnostics will strengthen surveillance of the disease, leading to enhanced control of rabies where it is most needed. Laboratory techniques in rabies Fifth edition v Laboratory techniques in rabies Preface Rabies has an enormous impact on both agriculture and conservation biology, but its greatest burden is undeniably on public health. As such, routine methods for rapid risk assessment after human exposures to rabies as well as applications for labora- tory-based surveillance, production of biologicals and management of this infectious disease are critical. Given its mandate to improve human health and control disease among its Member States, WHO has led the production of this fifth edition of Laboratory techniques in rabies. During the more than 60 years that have elapsed since the first edition was published, methods of viral diagnosis, characterization of pathogens and production of biologicals have advanced. At that time, only a single etiological agent was recognized as causing rabies. Detection of Negri bodies was the standard for diagnosis. Nerve tissue-based vaccines were the norm. Combination use of vaccines and rabies immunoglobulins in human prophylaxis was not standard. Global elimination of canine rabies was merely a dream. Rabies in wildlife was managed via population reduction. All of that has changed for the better. In the ensuing decades, further advancements in detection, prevention and control of lyssaviruses have been monitored by regular meetings of WHO experts, international research groups and countries in which rabies is endemic. The second edition of the manual was published in 1966, the third in 1973 and the fourth in 1996. The late Martin Kaplan and Hilary Koprowski were instrumental in editing the previous editions, as was input on the fourth edition by François-Xavier Meslin, now retired from WHO. Initial plans for preparation of this edition were made in 2016 and its contents were discussed at the WHO Expert meeting on rabies (Bangkok, Thailand) and modified in response. This fifth edition of Laboratory techniques in rabies contains 44 detailed chapters written by more than 85 authors from Africa, the Americas and Eurasia. The text was peer reviewed by Dr Matthias Schnell, Head of the WHO Collaborating Centre for Neurovirology; Professor Thiravat Hemachudha, Head of the WHO Collaborating Center for Research and Training on Viral Zoonoses; and Dr Asefa Deressa, Team Leader of Zoonoses Research at the Ethiopian Public Health Institute. The manual focuses on the basic methods for detection of lyssavirus antigens, antibodies and nucleic acids and the relevance of their use under different operating conditions, from the basic to the advanced. The chapters on older, less sensitive techniques used to detect Negri bodies have been removed, as have those chapters on methods of vaccine production given the progress made in the commercial use of tissue culture products in human and veterinary medicine. Recommendations for the preparations of antibodies by homolo- gous or heterologous production have been replaced by newer methods in an effort to promote a next generation of less expensive and more readily available immunoglobu- lins in the future. Other basic chapters have been retained and updated and more than a dozen added. Each of the protocols described are prescriptive and should be followed point by point in the laboratory. We gratefully acknowledge the collaboration of the many eminent scholars who contributed to the current volume, and look forward to the publication of the next edition as continued advances in the field are made. Laboratory techniques in rabies Fifth edition vi Abbreviations 3Rs “Replacement, Reduction and Refinement” of laboratory animal testing AALAS American Association for Laboratory Animal Science Ab antibody ABLV Australian bat lyssavirus ACD acid citrate dextrose ACIP Advisory Committee on Immunization Practices ACS American Chemical Society AEC 3-Amino-9-ethylcarbazole Ag antigen ANSM Agence Nationale de Sécurité du Médicament et des produits de santé AMA African Medicines Agency AP alkaline phosphatase APS ammonium persulphate ARAV Aravan virus ATCC American Type Culture Collection AVMA American Veterinary Medical Association BBLV Bokeloh bat lyssavirus BCIP 5-bromo-4-chloro-3-indolyl-phosphate BEEM better equipment for electron microscopy BHK baby hamster kidney bnAbs broadly neutralizing antibodies bp base pair BP British Pharmacopeia BPL β-propiolactone BRP Biological Reference Preparation BSA bovine serum albumin BSC biosafety cabinet BSL biosafety level CCID cell culture infectious dose CDC United States Centers for Disease Control and Prevention cDNA complementary deoxyribonucleic acid CER chicken embryo-related CFIA Canadian Food Inspection Agency List of abbreviations and acronyms used in this manual Laboratory techniques in rabies Fifth edition vii Abbreviations CHAPS 3-(3-cholamidopropyl) dimethylammonium 1-propanesulfonate CHO Chinese Hamster Ovary cells CIE counter immunoelectrophoresis CLRW clinical laboratory reagent water CNS central nervous system CPE cytopathic effect CSF cerebrospinal fluid Ct Cycle threshold CVS challenge virus standard strain ddNTP dideoxynucleotide DDSA dodecenyl succinic anhydride dNTP deoxynucleosidetriphosphate DEAE diethylaminoethyl Defra Department for Environment, Food and Rural Affairs DEPC diethylpyrocarbonate DFAT direct fluorescent antibody test DH20 distilled water DIG digoxigenin DMEM10 Dulbecco’s minimum essential medium with 10% fetal calf serum DMP30 tris dimethylaminomethyl phenol DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTP deoxy-nucleotide-tri phosphate DPX mixture of distyrene (a polystyrene), a plasticizer (tricresyl phos- phate) and xylene DRIT direct rapid immunohistochemistry test dsDNA double stranded DNA DSMZ German Collection of Microorganisms and Cell Cultures DTT dithiothreitol DUVV Duvenhage virus EBLV-1 European bat lyssavirus, type 1 EBLV-2 European bat lyssavirus, type 2 ED50 50% end-point EDQM European Directorate for the Quality of Medicines EDTA ethylenediaminetetraacetic acid EIU equivalent international units ELISA enzyme-linked immunosorbent assay EM electron microscopy EMEM Eagle’s minimum essential medium EPAA European Partnership for Alternatives to Animal Testing ERA Evelyn Rokitniki Abelseth strain ERIG equine rabies immunoglobulin Laboratory techniques in rabies Fifth edition viii Abbreviations ESI electrospray ionization EtBr ethidium bromide EVAg European Virus Archive Global Fabs antigen-binding fragments FACS fluorescence-activated cell sorting FAVN fluorescent antibody virus neutralization test FBS fetal bovine serum FCA Freund’s Complete Adjuvant FCS fetal calf serum FFID fluorescent focus infectious dose FFPE formalin-fixed, paraffin-embedded FIA Freund’s Incomplete Adjuvant FIMT fluorescence inhibition microtest FISH fluorescent in situ hybridization FITC fluorescein isothiocyanate FPLC fast protein liquid chromatography FRET Fluorescence Resonance Energy Transfer FTA Flinders Technology Associates G glycoprotein GBLV Gannoruwa bat lyssavirus GFP green fluorescent protein GM genetically modified GMEM Glasgow Minimum Essential Medium GMP Good Manufacturing Practices gRNA genomic RNA HBO mercury luminance unforced cooling lamp HDCV human diploid cell vaccine H&E hematoxylin and eosin HEK human embryonic kidney HEP high egg passage strain HEPES hydroxyethyl piperazine ethane sulfonic acid HIV human immunodeficiency virus hn hemi-nested HPLC high-performance liquid chromatography HRIG human rabies immunoglobulin HRP horse radish peroxidase IAA iodoacetamide IACUC Institutional Animal Care and Use Program IBCMP integrated bite case management program IC (i.c.) intracerebral ICCVAM Interagency Coordinating Committee on the Validation of Alternative Methods Laboratory techniques in rabies Fifth edition ix Abbreviations ICH International Council for Harmonisation of Technical Require- ments for Pharmaceuticals for Human Use ICTV Inter national Committee on Taxonomy of Viruses IEF isoelectric focusing IFA indirect fluorescent antibody test IgG immunoglobulin G IgY immunoglobulin Y IMAC immobilized metal affinity chromatography IPTG Isopropyl-ß-D-1-thiogalactopyranoside ISH in situ hybridization IIA immunoperoxidase inhibition assay ICTV International Committee on the Taxonomy of Viruses IHC immunohistochemistry IFA indirect fluorescent antibody IIF indirect immunofluorescence IKOV Ikoma lyssavirus i.m. intramuscular i.p. intraperitoneal IPC in-process control IRIT indirect rapid immunohistochemistry test IRKV Irkut virus IS indicator serum ISH in situ hybridization IU international unit KHUV Khujand virus L " large " protein (i.e. the viral RNA-dependent polymerase) lacZ structural gene for ß-galactosidase LAMP loop-mediated isothermal amplification LB Luria-Bertani broth LBV Lagos bat virus LC liquid chromatography LD50 50% lethal dose LED light-emitting diode LEP low egg passage strain LFA lateral flow assay LFD lateral flow devices LIMC low and middle-income countries LLEBV Lleida bat lyssavirus M matrix protein MAb monoclonal antibody MALDI matrix-assisted laser desorption/ionization MCIE modified CIE Laboratory techniques in rabies Fifth edition x Abbreviations MEM modified Eagle’s medium MES 2-(N-morpholino) ethanesulfonic acid buffer MIT mouse inoculation test MLV murine leukaemia virus MNA murine neuroblastoma cell MNT mouse neutralization test MOI multiplicity of infection MOKV Mokola virus mRNA messenger RNA MS mass spectrometry MW molecular weight M/Z mass to charge ratio N nucleoprotein NA numerical aperture NAA nucleic acid amplification nAb neutralizing antibody nAChR nicotinic acetylcholine receptor NASBA nucleic acid sequence based amplification NBT nitro blue tetrazolium NC negative control NC nucleocapsid NCBI National Center for Biotechnology Information NDDR National Donor Referral Registry NGS next generation sequencing NIBSC National Institute for Biological Standards and Control NIH National Institutes of Health (USA) NMDA N-Methyl-D-aspartic acid NMRI Naval Medical Research Institute NS negative serum NSS non-specific staining NTC no template control OCT optimal cutting temperature OD optical density OMCL Official Medicine Control Laboratories OIE World Organisation for Animal Health ORF open reading frame P phosphoprotein PAHO Pan American Health Organization PAGE polyacrylamide gel electrophoresis PBL peripheral blood lymphocytes PBS phosphate buffered saline PC positive control Laboratory techniques in rabies Fifth edition xi Abbreviations PCEC purified chick embryo cell vaccine PCR polymerase chain reaction PEG polyethylene glycol PEI polyethyleneimine PEP post-exposure prophylaxis Ph Eur European Pharmacopeia pI isoelectric point PNA pseudotype neutralization assay PPE personal protective equipment PPHS passive public health surveillance PMF peptide mass fingerprinting PT proficiency test or testing PTFE polytetrafluoroethylene PTV pseudotyped viruses PV Pasteur virus PVRV purified vero cell rabies vaccine QA quality assurance QC quality control RABV rabies virus RER rough endoplasmic reticulum RF rheumatoid factors RFFIT rapid fluorescent focus inhibition test rG-F recombinant G truncated protein RIDT rapid immunochromatographic diagnostic test RITM Research Institute of Tropical Medicine RLU relative light unit RIG rabies immunoglobulin rN recombinant nucleoprotein RNA ribonucleic acid RNP ribonucleoprotein rP recombinant P protein RP relative potency RPMI Roswell Park Memorial Institute medium rRNA ribosomal RNA RS reference serum RTCIT rabies tissue culture infection test RT-LAMP reverse transcriptase loop-mediated isothermal amplification RT-PCR reverse transcriptase polymerase chain reaction RVNA rabies virus neutralizing antibodies SAD Street Alabama Dufferin strain scFv single-chain antibody fragment SD standard deviation Laboratory techniques in rabies Fifth edition xii Abbreviations SDS sodium dodecyl sulfate SE-HPLC size exclusion high-pressure liquid chromatography SFIMT simplified fluorescence inhibition microtest SHIBV Shimoni bat virus SMB suckling mouse brain SNP single nucleotide polymorphism SPA serological potency assay SPRI solid phase reversible immobilization [beads] SRIG standard rabies immunoglobulin SSC saline-sodium citrate ssRNA single stranded RNA SYBR Synergy Brand Taq thermostable DNA polymerase via bacterium (Thermus aquaticus) TBS tris-buffered saline T-DNA transfer DNA TC tissue culture TCID tissue culture infectious dose Thyb probe hybridization temperature TPBS Tween phosphate buffered saline TBE tris borate EDTA buffer TE tris EDTA buffer TEA triethanolamine TEM transmission electron microscopy TEMED N,N,N’,N’-tetramethylenediamine TLR3 Toll-like receptor-3 TOF time-of-flight TRIS tris(Hydroxymethyl)aminomethane TS samples such as sera or plasma to be tested TST Tris-buffered saline and Tween 20 USP United States Pharmacopeia UTR untranslated region UV ultraviolet VEP viral envelope protein VH heavy-chain variable regions VHH variable llama-derived heavy-chain antibody fragments VL light chain variable regions VNA virus-neutralizing antibody WCBV West Caucasian bat virus WHO World Health Organization WRS street rabies virus WTA whole-transcription amplification YM yeast minimal Laboratory techniques in rabies Fifth edition Part 5. Demonstration of viral nucleic acids and sequences Part 5. Demonstration of viral nucleic acids and sequences Laboratory techniques in rabies Fifth edition 1 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Introduction Next to techniques aimed at the detection of lyssavirus antigens, such as the direct fluorescent antibody test (DFAT; see Chapter 11), the direct rapid immuno- histochemistry test (DRIT; see Chapter 12), the rapid immunochromatographic test (RIDT; see Chapter 17), the rabies tissue culture infection test (RTCIT; see Chapter 9) and the mouse inoculation test (MIT; see Chapter 8) (1–5), methods based on the detection of lyssavirus nucleic acids are becoming more widely accepted for the diagnosis of rabies in quality-assured laboratories (6–8). Among such molecular techniques the polymerase chain reaction (PCR), developed in the 1980s (9) and first used for rabies diagnosis and typing in 1991 (10–11), has revolutionized diagnosis not only of rabies but also of many viral, bacterial, para- sitological and fungal pathogens. PCR is an in vitro laboratory technique used to detect, among others, target DNA sequences of infectious agents in tissues, as well as in secretions or excre- tions of infected animals and humans. It involves exponential amplification of the target using a thermostable DNA polymerase (Taq polymerase) using short oligo- nucleotide sequences called “primers” to select the portion of the genome to be amplified. Specific alternating temperature profiles of the sample are applied to help a DNA replication enzyme rapidly copy the target DNA sequence. Depen- ding on the interval between selected forward and reverse primers, PCR products (amplicons) of different sizes can afterwards be made visible by agarose gel electrophoresis. The use of PCR in lyssavirus diagnostics benefits also from the downstream application of Sanger sequencing to type the lyssavirus amplified in confirmed cases. Lyssaviruses are negative stranded RNA viruses (12). Therefore, before PCR amplification, the RNA is first reverse transcribed into complementary DNA (cDNA) using reverse transcription (RT), resulting in a variant of PCR referred to as reverse transcriptase polymerase chain reaction (RT-PCR). The amplification of lyssavirus RNA using RT-PCR can be achieved as either a one-step or a two-step reaction. While in the first approach, the entire reaction from cDNA synthesis to PCR ampli- fication takes place in a single tube, in the latter the reverse transcription reaction and PCR amplification are performed in separate tubes. There are advantages to both approaches. The one-step approach reduces the number of manipulations required, thereby reducing costs and risk of cross-contamination, whereas the two-step approach generates cDNA in the first step, which can then be available for parallel testing. The latter is particularly useful if only limited quantities of RNA are available and screening for multiple pathogens is required. Chapter 27 Conventional pan-lyssavirus reverse transcriptase polymerase chain reaction Laboratory techniques in rabies Fifth edition 2 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Various conventional gel-based RT-PCR protocols for the diagnostic detec- tion of rabies virus (RABV) and the generic detection of lyssaviruses have been published targeting the lyssavirus genes or intergenic regions resulting in ampli- cons of various sizes (6, 7). The sensitivity of gel-based RT-PCR amplification can be increased by second-round RT-PCR using internal annealing sites of either one (hemi-nested-PCR) or two (nested-PCR) primers or by using specific hybrid- izing probes in PCR-ELISA (8, 13–14). Since primers were selected from conserved regions of the genome, most assays amplify parts of the nucleoprotein (N) and polymerase (L) genes of lyssaviruses as earlier proposed (15, 16). Conventional lyssavirus species-specific or generic RT-PCRs can be used both for diagnostic purposes and for characterization of lyssaviruses (15). Preparatory work and procedures Samples and controls Diagnostic specimens subjected to testing by RT-PCR may include brain tissue (for diagnosis of human and animal rabies) and additionally skin biopsies, saliva and cerebrospinal fluid (CSF) for human rabies diagnosis. Particular care must be taken for the optimum selection, collection, shipment and storage of such biolog- ical specimens since they can impact the test results. The use of validated positive (PC) and negative (NC) controls or in-process controls is required and should be subjected to the same procedures as test samples. PCR NC (sometimes referred to as “no template control” or “NTC”) could either be water or uninfected brain material and confirms the absence of contamination during the PCR process. PCR PC from a known lyssavirus-positive brain tissue confirms that the PCR has worked in the event of the diagnostic samples being negative. Anomalous control results indicate a test failure possibly due to incorrect formulation of the reagents or a failure of equipment. Preferably, laboratory strains or non-autochthonous PCs (that do not occur in the region) should be used, so that sequence analysis can be used to rule out cross-contamination of the PC into the test samples. The PC must be used at a concentration 1 log higher than the known limit of detection of the PCR assay. Using very high levels of PC would prevent laboratories from detecting fluctuations/trends within the assay that could prevent lower viral loads from being detected, and will increase the risk of cross-contamination. Every new batch of PC must be tested and confirmed as fit for purpose. For example, labo- ratories could test a 10-fold serial dilution series of each new stock of PC RNA (ranging from 100 ng/µL to 1 fg/µL, 10–1–10–7) and calibrate the working concen- tration of RNA accordingly. RNA extraction Obtaining high-quality nucleic acid from the sample is the first and most impor- tant step for any molecular assay. Proper handling (e.g. on ice and using gloves) and use of RNase-free materials will prevent the introduction of RNase and eliminate degradation of RNA. Viral RNA from diagnostic specimens such as brain tissue, skin biopsies, saliva and CSF can be extracted by using commercial column- based extraction kits (e.g. RNeasy Mini Kit) or guanidinium isothiocyanate-phe- nol-chloroform-based extraction methods (e.g. TRIzol), following the manufac- Laboratory techniques in rabies Fifth edition 3 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences turer’s recommendations. An alternative approach employs paramagnetic beads with a nucleic acid binding surface that are used to bind RNA following lysis. Beads with bound RNA are captured on magnets and the supernatant containing cell debris and other contaminants is removed with washes. When using in-house or commercial nucleic acid extraction reagents, safety and sensitivity should be assessed locally. For skin biopsies, a preliminary step of lysis using proteinase-K is required before extraction (for example incubation, after dissociation with sterile scissors, at 37 °C for 3 h under gentle agitation in 180 µL of ALT tissue lysis buffer and 20 µL of proteinase K) (17). It is recommended to include a validation of the extraction step for each sample, based on the parallel detection of endogenous control, such as RNA from housekeeping gene (e.g. 18S ribosomal RNA or ß-actin), in one-step (running in parallel a specific RT-PCR assay) or two-step approach (see following point). The housekeeping PCR can be used to confirm the presence of RNA in samples derived from tissue with low cellular content. This validation provides confidence that a lyssavirus negative result by RT-PCR is a true negative and not the result of a failure of RNA extraction or a failure in the extraction process (18). In addition, host material can be analysed for species confirmation or co-evolutionary studies (e.g. mitochondrial cytochrome B analysis). An NC (water or non-infected tissue) must be included during the extraction step. However, the use of PC is not recommended during extraction, especially when endogenous controls are used, and to avoid any cross-contamination during this initial step. After extraction, store RNA samples at below −70 ºC until use. Because of the high sensitivity of any RT-PCR, great care must be taken to ensure that any contamination is excluded. Record all test details onto a worksheet to ensure traceability. Obtained RNA may be quantified if required. Dilution of RNA can be performed, if necessary and according to the assay which will be used. For the highly sensitive pan-lyssavirus N gene RT-PCR detailed below, the extracted RNA is diluted 1:10 before being quantified (e.g. by NanoDrop). The original RNA is then diluted to 1μg/μL. For the L gene protocol described below, dilution of RNA is not required, although a final quantity of 1.5 μg per reaction is preferable. Reverse transcription of viral RNA If a two-step RT-PCR is applied, synthesis of cDNA from the extracted viral RNA is required. In contrast to targeted RT using specific lyssavirus-derived primers, the cDNA generated using random hexamers can be used in various virus or host related downstream applications (Table 27.1). The cDNA can be stored at −20 ºC until required. This facilitates greater flexibility to detect a range of viral path- ogens and also enables detection of host housekeeping genes (18S ribosomal RNA or ß-actin, etc) to be employed to check the efficiency of the RNA extraction. A combination of specific lyssavirus RT primer (e.g. JW12) and random hexamers may also be used to reverse transcribe the RNA. Laboratory techniques in rabies Fifth edition 4 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Thermal cycler Commercial companies offer a complete range of thermal cyclers (also called PCR machines or DNA amplifiers) that meet the requirements of all applications. Some thermal cyclers provide multiple blocks in one housing unit (dual or three- block thermal cyclers), allowing several different PCR reactions to be carried out simultaneously. Heated lids prevent condensation of water from the reaction mixtures. Although the difference in performance of contemporary well-main- tained thermal cyclers is generally limited, a validation is recommended when changing the type of thermal cycler. In a rabies diagnostic laboratory, thermal cyclers should be calibrated and regularly serviced similar to other critical equip- ment such as pipettes for which accuracy/precision should also be qualified and routinely checked. In addition, storage equipment (refrigerators and freezers) must be monitored to detect out of range temperature levels and lapses in temperature that may affect sample or reagent quality. Calibration, servicing and temperature monitoring are mandatory if the test is accredited to ISO17025 standard. RT-PCR methodology This procedure describes the generic amplification of lyssavirus RNA or cDNA for both diagnostic and research purposes, using two examples of hemi-nested RT-PCR (hnRT-PCR). The first assay targets the N gene and is modified from a published protocol (13). The universal primers JW12 (forward) and JW6UNI (reverse) of the pan-lyssavirus RT-PCR detect a 606 base pair (bp) region of the N gene from all ICTV (Inter- national Committee on Taxonomy of Virusus) recognized and novel lyssavirus species in the first round PCR. The reverse primers JW10UNI, which lie within the sequence of the first round PCR product, are used in conjunction with the first- round primer JW12 in the second round of the hnRT-PCR (Fig. 27.1, Table 27.1). Molecular grade water needs to be added to a final volume of 50 µL. Primer Direction Sequence (5’- 3’) Positiona Details JW12 F ATGTAACACCYCTACAATG 55–73 7.5 pmol/µL (first round) 3.5 pmol/µL (second round) JW6 UNI R ARTTVGCRCACATYTTRTG 660–641 7.5 pmol/µL (first round) JW 10 UNI R GTCATYARWGTRTGRTGYTC 636–617 3.5 pmol/µL (second round) a Position according to the reference Pasteur virus genome (M13125) F, forward; R, reverse; RT-PCR, reverse transcriptase polymerase chain reaction Table 27.1. Primers used in the N gene hemi-nested pan-lyssavirus RT-PCR Laboratory techniques in rabies Fifth edition 5 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences The second assay targets a conserved region among block III of the L gene (16) and has been previously validated for the postmortem and antemortem diag- nosis of human rabies on one of the largest cohorts of rabid patients (17). The first round is performed using the primers PVO5m (forward) and PVO9 (reverse), which amplify a 319 bp amplicon, whereas the second round uses the same forward primer (PVO5m) and the reverse primer PVO8, leading to a final amplification of a 249 pb region (Table 27.2). As previously indicated, it is strongly recommended to perform a parallel assay for the detection of the partial ß-actin mRNA in each sample (amplicon of 488 bp), to assess the quality of the RNA template and to validate the extraction process, using primers b-Taq1 and b-Taq2 (Table 27.2 (19)). Fig. 27.1. Schematic diagram of the lyssavirus genome and the region targeted by the N gene pan-lyssavirus hemi-nested RT-PCR primers (see Table 27.1) Target Primer Direction Sequence (5’- 3’) Position Quantity per reaction L gene PVO5m F ATGACAGACAAYYTGAACAA 7170a 10 pmol (first and second round) L gene PVO9 R TGACCATTCCARCARGTNG 7489a 10 pmol (first round) L gene PVO8 R GGTCTGATCTRTCWGARYAATA 7419a 10 pmol (second round) ß-actin b-Taq1 F TCACCCACACTGTGCCCATCTACGA 2206b 10 pmol ß-actin b-Taq2 R CAGCGGAACCGCTCATTGCCAATGG 2500b 10 pmol a Position according to the reference Pasteur virus genome (M13125) b Position according to the human ß-actin gene (E00829) F, forward; R, reverse; RT-PCR, reverse transcriptase polymerase chain reaction Table 27.2. Primers used in the hemi-nested pan-lyssavirus RT-PCR targeted L gene and the endogenous control ß-actin mRNA Laboratory techniques in rabies Fifth edition 6 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences For PCR, different “ready to use” commercial kits are available, although reagents can also be purchased separately. For this chapter the kits and methods detailed below have been validated, although in-house validation should be completed before using the assay on diagnostic samples. Alternative reagents and kits are available and can be used after appropriate validation to ensure optimal sensitivity and specificity. Sequence analysis should be used to further confirm the specificity of the PCR products. Preferably, a four-room system, e.g. clean room (master mix), template room (addition of RNA template), PCR room (thermal cycling) and amplicon room (gel electrophoresis), should be used to avoid cross-contamination. 1. N gene hnRT-PCR First round RT-PCR (JW6UNI/JW12) In the clean room 1. Wipe bench or surface of PCR cabinet/workstation with an appropriate disin- fectant prior to use. If available, switch on the ultraviolet (UV) light for 10 min. Obtain the required test reagents from the –20 °C freezer. Ensure the enzyme mix is kept on ice. The remaining reagents can be thawed at room temperature. 2. Put the required number of 0.2 mL tubes in a rack and label the tubes clearly with sample identification and denote this is the first-round reaction by labelling (e.g. with “6/12”). Label the PCR negative (e.g. as “NC”) or “NTC” (no template control) and the PCR positive control (e.g. as “PC”) or “CVS”, challenge virus strain (i.e. CVS RNA that is known to be positive). 3. Prepare a JW6UNI/JW12 reaction master mix using the One Step RT-PCR kit (Qiagen; Catalogue number 210212) (Table 27.2). Keep all reagents on ice, thaw and vortex before using. An NC (without template RNA) and a PC must be included in every test run. Allow for pipetting variation by preparing a sufficient volume of master mix at least one reaction greater than required. 4. Vortex the prepared master mix thoroughly, centrifuge and dispense 49 µL into each of the 0.2 ml tubes. Close the lids. 5. Transfer the sealed tubes to the ice/cool block in the template room on a dispos- able tray. Once a tray has been removed it must not be returned to the clean room without decontamination using an appropriate disinfectant. In the template room – addition of template 1. Wipe bench top with an appropriate disinfectant prior to use. 2. Thaw samples and control RNA (PC and NC) on ice. 3. Add 1 µL of test RNA (e.g. at concentration of 1 µg/µL for TRIzol extracted samples) below the surface of its allocated master mix tube and mix gently. Discard the tip directly into a pot containing cleaning agent (e.g. Decon90) after use to minimize cross-contamination. Repeat this process until all samples and controls have been added to their allocated tubes. 4. Press the lids down by hand and seal firmly. Laboratory techniques in rabies Fifth edition 7 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 5. Transfer the sealed tubes to the PCR machine and cycle as detailed (Table  27.3). In-house validation of cycling parameters is essential to ensure optimisation for local PCR machines. Reagent Volume per reaction (µL) Molecular grade water 29.0 5× buffer 10.0 dNTPs (10 mmol) 2.0 JW12 (7.5 pmol/µL) 3.0 JW6UNI (7.5 pmol/µL) 3.0 One-step RT-PCR enzyme mix 2.0 Total 49 RT-PCR, reverse transcriptase polymerase chain reaction Table 27.3. First-round JW6UNI/JW12 reagent master mix (using [Qiagen] One Step RT-PCR kit) Second-round RT-PCR (JW10UNI/JW12) Where no amplicon is generated on the first-round reaction, a second-round, hemi-nested reaction should be performed. This will provide further confidence in a negative result. The second-round assay may also be employed to increase the specificity of the assay. In the clean room 1. Wipe the bench with an appropriate disinfectant prior to use, then prepare the PCR workstation by opening the doors and wipin the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate cleaning agent), suitable pipette and tips within the station and close the doors. If available, switch on the UV light for 10 min. 2. Obtain the required reagents from the –20°C freezer and thaw at room temper- ature. 3. Put the required number of 0.2 mL tubes in a rack and label the tubes clearly with sample identification and denote that this is the second-round reaction by labelling (e.g. “10/12”). Label the PCR negative as “NC2” or “NTC2”. This addi- tional NC must be included in every second round PCR experiment to confirm the master mix is not contaminated. 4. Prepare a JW10UNI/JW12 reaction master mix using the HotStarTaq kit [Qiagen] as detailed [see catalogue number 203443] as detailed (Table 27.4). 5. Thaw and vortex all reagents before using. Allow for pipetting variation by preparing a volume of master mix at least one reaction greater than required. Laboratory techniques in rabies Fifth edition 8 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 6. Vortex the prepared master mix thoroughly, centrifuge and dispense 49 µL into each of the 0.2 mL tubes. Seal the tubes. 7. Transfer the sealed tubes to the template room on a disposable tray. Once a tray has been removed it must not be returned to the clean room without decontamination using an appropriate disinfectant. Temperature Time Cycles 50 °C 30 min 1 95 °C 15 min 1 94 °C 30 s 45 45 °C 45 s 50 °C 15 s 72 °C 1 min 72 °C 7 min 1 4 °C ∞ n/a RT-PCR, reverse transcriptase polymerase chain reaction Table 27.4. Hemi-nested RT-PCR first round cycling parameters In the template room – addition of template 1. To reduce cross-contamination, the template may be added within a PCR workstation. 2. To prepare, open the doors of the PCR workstation and wipe the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate cleaning agent, suitable pipette and tips within the station and close the doors. Switch on the UV light for 10 min. 3. Add 1 µL of first-round PCR product below the surface of the prepared second round master mix to minimize aerosols, then mix gently. Discard the tip directly into an appropriate cleaning agent after use. Ensure the lid of the PCR tube is sealed firmly. Repeat this step until all first-round PCR products and the second-round NTC have been added to its allocated second-round master mix tube. Change gloves regularly and at suitable points to avoid cross-contami- nation. 4. If using the PCR workstation, after removing the samples from the cabinet, empty the ice, remove the disinfectant pot, then switch on the UV light for 10 min. Record the required detail in the relevant PCR workstation workbook. Laboratory techniques in rabies Fifth edition 9 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 5. Cycle on the PCR machine using the following second round cycling param- eters (Table 27.5). In-house validation of cycling parameters is essential to ensure optimization for local PCR machines. Note: Batch master mixes can be prepared so that ready-made mixes are avai- lable for hnRT-PCR reactions. These batches can be quality controlled when prepared, allowing for better quality assurance and standardization. This is the routine way of preparing master mixes for diagnostic purposes. These master mixes are stable for at least 1 year when stored appropriately at −20 ˚C. Reagent Volume per reaction (µL) Molecular grade water 22.0 HotStarTaq master mix (2×) 25.0 JW12 (3.5 pmol/µL) 1.0 JW10UNI (3.5 pmol/µL) 1.0 Total 49 Table 27.5. Second-round JW10UNI/JW12 master mix (using [Qiagen] HotStarTaq kit) Analyses of RT-PCR products by electrophoresis on agarose gels Nucleic acids are negatively charged and can be separated on the basis of size in an agarose gel under the influence of an electric current. Historically, ethidium bromide (EtBr) has been used to stain nucleic acids in agarose gels and detection under UV light. More recently, the safer SYBR-based options have been preferred over the use of the carcinogen EtBr. • Prepare a 1% agarose gel. Add Et Br (final concentration 0.01%) or alterna- tively 5 µL of SYBR Safe solution [Life Technologies Ltd] per 100 mL of gel. • Pour gel into the cast, select a suitably-sized well former (comb), according to the volume of sample being loaded and the number of wells required, and place into the cast before the gel sets. Leave the gel to solidify for at least 30 min. • DNA size markers (1 kb or 100 bp ladder) are diluted in TE or TBE buffer and 50 μL aliquots are stored in a −20 °C freezer. These DNA size markers must be mixed with loading buffer prior to loading. Generally, 5 μL of ladder is used. • To enable loading of a PCR product (DNA sample) it must be mixed with a suit- able volume of gel loading buffer, e.g. blue/orange 6x. For diagnostic purposes, 5 µL of PCR product and 1 µL of loading dye is generally used per sample. • Load the samples and DNA marker into the wells and separate the samples for approximately 45 min–1 h (120 volts). • Remove the gel and allow excess buffer to drain off. Place the gel in a tray and carry over to the UV transilluminator. • A positive PCR result is observed in the form of a bright band of the expected size of 606 bp (first round) and 582 bp (second round). Laboratory techniques in rabies Fifth edition 10 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 2. L gene hnRT-PCR As the overall process for this technique remains mostly similar to the N gene-based hnRT-PCR previously described and to the general considerations requested when performing PCR (20), only specific parameters inherent to this technique will be described in this section, as well as major variations or modifi- cation steps, such as the reverse transcription of this two-step technique. In each series, positive (positive RNA) and negative controls (negative RNA and/or RNase- DNase free water) should be included. Reverse transcription step A total of 6 μL of extracted RNA is used for cDNA synthesis and add to the first mix reaction described in Table 27.6. A pre-incubation of RNA template with pd(N)6 random primers is performed for 10 min at 65 °C in a heat-block, following with an incubation for 90 min at 42 °C in a heat-block after addition of the second mix solution (Table 27.6). Temperature Time Cycles 95 °C 15 min 1 94 °C 30 s 35 45 °C 10 s 50 °C 15 s 72 °C 1 min 72 °C 7 min 1 4 °C ∞ n/a RT-PCR, reverse transcriptase polymerase chain reaction Table 27.6. Hemi-nested RT-PCR second-round cycling parameters Mix preparations and cycling parameters This technique is relatively simple because the mix preparation is similar for both rounds of PCR used for lyssaviruses detection as well as for the PCR dedi- cated to the detection of the endogenous control ß-actin mRNA (with the excep- tion of the primers used) (Table 27.7). In addition, cycling parameters are also identical for all these PCR (Tables 27.8–9). Similarly to each step of the process, positive (positive RNA) and negative (negative cDNA and/or RNase–DNase-free water) should be included in each series and each round of PCR. Revelation of the amplification products after PCR is done by electrophoresis on agarose gels as previously described. Laboratory techniques in rabies Fifth edition 11 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Step Reagent Volume per reaction (µL) Mix 1: pre-incubation (10 minutes at 65°C) pd(N)6 random primers (200 µg/mL) [Roche Diagnostics] 2 RNase-DNase free water 2 RNA template 6 Total 10 Mix 2: incubation (90 minutes at 42 °C) 5X first-strand buffer (Invitrogen, provided with the reverse transcriptase) 6 0.1 mol DTT (Invitrogen, provided with the reverse transcriptase) 2 dNTP mix (10 mmol) [Eurobio] 2 RNasin (40U/µL) [Promega] 2 Superscript II RT (200 U/μL) (Invitrogen) 1 RNase-DNase free water 7 Total 20 Final volume 30 Table 27.7. Reverse transcription mix for the L gene-based hnRT-PCR Reagent Volume per reaction (µL) 10X PCR buffer II (provided with the Taq polymerase) 5 MgCl2 (25 mmol) (provided with the Taq polymerase) 2.5 dNTP Mix (10 mmol) (provided with the Taq polymerase) 1 Forward primera (10 μmol) 1 Reverse primera (10 μmol) 1 AmpliTaq DNA Polymeraseb (5 U/μL) [Applied Biosystems] 0.4 RNase–DNase-free water 37.1 Total 48 Table 27.8. L gene-based hnRT-PCR mix preparations a The primers used are PVO5m (forward)/POV9 (reverse) and PVO5m (forward)/PVO8 (reverse) for the first and the second rounds of PCR for lyssavirus detection, respectively, and b-taq 1/b-taq2 for -actin mRNA detection. b The enzyme can also be replaced by BioTaq DNA Polymerase [Bioline], after adjusting the volume of enzyme to 0.2 µL and the volume of MgCl2 to 1.25 µL. Laboratory techniques in rabies Fifth edition 12 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Discussion Various lyssavirus species-specific and generic RT-PCRs have their merit for the specific purpose they were developed (6–8). This chapter describes two examples of conventional gel-based pan-lyssavirus hemi-nested RT-PCR assays with primers that target the N gene or L gene. The N gene Hn RT-PCR is one of the most widely used and has been validated to detect all recognized and putative lyssavirus species known to exist to-date at an annealing temperature of 45 ºC  (13, 21–23). Any alteration of annealing temperature may cause detection of the rare phylogroup 2 or 3 lyssaviruses to be impaired (24). Furthermore, this generic gel-based RT-PCR (13) gave the most accurate results in an international ring trial compared to other published conventional lyssavirus PCRs included in the study (25). Both assays have successfully detected all RABV isolates and other lyssavirus species tested in the framework of animal rabies diagnosis activity in a national and WHO collaborating centre for rabies, haven proven efficacy for ante-mortem and post mortem human rabies diagnosis and have performed well in successive international proficiency tests (6, 8, 26). Despite the highest level of sensitivity and their ever increasing important role in many countries, the use of molecular assays, including RT-PCR, for routine post- mortem diagnosis of lyssaviruses is currently not recommended if brain tissue is available, especially for animal rabies (27, 28). Without standardization, very strin- gent quality control and sufficient experience and expertise such tests run the risk of high levels of false positive or false negative results (29). Nevertheless, if strict quality control procedures are applied those techniques can be used for epidemiological surveys in wildlife. In such a case, however, a positive RT-PCR result preferably requires a positive result in one of the routine diagnostic tests (DFAT, RTCIT) if it is to be officially declared to the OIE, particu- larly in a previously “rabies-free” region or host. Cycling step Temperature Time Number of cycles Initial denaturation 94 °C 3 minutes 1 Amplification 94 °C 30 seconds 3556 °C 45 seconds 72 °C 40 seconds Final elongation 72 °C 3 minutes 1 Pending 16 °C ∞ n/a Table 27.9. L gene-based hnRT-PCR cycling parameters Laboratory techniques in rabies Fifth edition 13 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences However, RT-PCR is commonly applied for postmortem and in particular ante- mortem diagnosis of human rabies (6, 8, 28). However, negative results do not rule out infection, especially for excretions (virus intermittently shed) or for atypical or paralytic forms of rabies for which the sensitivity remains lower than for the clas- sical encephalitic form (28). In the event of routine diagnostic tests (DFAT, RTCIT) being inapplicable or inappropriate, RT-PCR may be used for diagnostic purposes. In particular, when the quality of the material submitted is suboptimal, RT-PCR has been shown to superior to the conventional assays (30). In confirmed cases, RT-PCR is useful as an additional diagnostic tool for virus characterization to determine the source of infection and molecular phylogeny (29). However, only sufficiently validated RT-PCR in terms of sensitivity (genome copies), specificity, repeatability and robustness should be applied. Considering ongoing and future developments, the quality of commercial column-based RNA extraction and RT-PCR kits should be frequently checked to allow for highest sensitivity of the gel-based RT-PCR, and verification of the ability of detection of any new lyssavirus species should be recommended, if possible. Quality control procedures should include strict precautions to avoid carryover contaminations as described (20) and to verify the intrinsic performance of the assay. In this way, participation to international proficiency tests is highly recom- mended. However, hemi- and nested RT-PCRs are especially prone to the risk of carryover or cross-contamination. To ensure confidence in positive diagnostic results, subsequent analysis by Sanger sequencing is recommended. There- fore, and whenever possible, it is also advisable to employ RT-qPCR for routine screening of samples, which considerably reduces the risks of cross contamina- tion. Laboratory techniques in rabies Fifth edition 14 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences References 1. Dean DJ, Abelseth MK, Athanasiu P. The fluorescence antibody test In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:88–93. 2. Koprowski H. The mouse inoculation test. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:80–6. 3. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emerg Infect Dis. 2006;12:310–3. 4. Kang B, Oh J, Lee C, Park BK, Park Y, Hong K, et al. Evaluation of a rapid immunodiagnostic test kit for rabies virus. J Virol Methods. 2007;145:30–6. 5. Webster WA, Casey GA. Virus isolation in neuroblastoma cell culture. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:93–104. 6. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. 7. Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, et al. Rabies – epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51. 8. Dacheux L, Wacharapluesadee S, Hemachudha T, Meslin FX, Buchy P, Reynes JM, et al. More accurate insight into the incidence of human rabies in developing countries through validated laboratory techniques. PLoS Negl Trop Dis. 2010;4:e765. 9. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol. 1986;51 Pt 1:263-–3. PMID:3472723. 10. Smith JS, Fishbein DB, Rupprecht CE, Clark K. Unexplained rabies in three immigrants in the United States. A virologic investigation. NEJM. 1991;324:205-11. 11. Sacramento D, Bourhy H, Tordo N. PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol Cell Probes. 1991;5:229–40. PMID:1714538. 12. Dietzgen RG, Calisher CH, Kurath G, Kuzmin IV, Rodriguez LL, Stone DM. Family Rhabdoviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, editors. Virus taxonomy : classification and nomenclature of viruses - Ninth Report of the International Committee on Taxonomy of Viruses. San Diego: Elsevier; 2012:686–713. 13. Heaton PR, Johnstone P, McElhinney LM, Cowley R, O’Sullivan E, Whitby JE. Heminested PCR assay for detection of six genotypes of rabies and rabies- related viruses. J Clin Microbiol. 1997;35:2762–6. PMID:9350729. Laboratory techniques in rabies Fifth edition 15 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 14. Heaton PR, McElhinney LM, Lowings JP. Detection and identification of rabies and rabies-related viruses using rapid-cycle PCR. J Virol Methods. 1999;81:63–9. 15. Tordo N, Sacramento D, Bourhy H. The polymerase chain reaction (PCR) technique for diagnosis, typing and epidemiological studies. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:157–70. 16. Bourhy H, Cowley JA, Larrous F, Holmes EC, Walker PJ. Phylogenetic relationships among rhabdoviruses inferred using the L polymerase gene. J Gen Virol. 2005;86(Pt 10):2849–58. 17. Dacheux L, Reynes JM, Buchy P, Sivuth O, Diop BM, Rousset D, et al. A reliable diagnosis of human rabies based on analysis of skin biopsy specimens. Clin Infect Dis. 2008;47:1410–7. 18. Smith J, McElhinney LM, Heaton PR, Black EM, Lowings JP. Assessment of template quality by the incorporation of an internal control into a RT-PCR for the detection of rabies and rabies-related viruses. J Virol Methods. 2000;84:107–15. PMID:10680960. 19. du Breuil RM, Patel JM, Mendelow BV. Quantitation of beta-actin-specific mRNA transcripts using xeno-competitive PCR. PCR Methods Appl. 1993;3:57– 9. 20. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature. 1989;339:237– 8. doi:10.1038/339237a0. 21. Johnson N, Selden D, Parsons G, Fooks AR. European bat lyssavirus type 2 in a bat found in Lancashire. Vet Rec. 2002;151:455–6. 22. Müller T, Johnson N, Freuling CM, Fooks AR, Selhorst T, Vos A. Epidemiology of bat rabies in Germany. Arch Virol. 2007;152:273–88. 23. Freuling CM, Beer M, Conraths FJ, Finke S, Hoffmann B, Keller B, et al. Novel lyssavirus in Natterer’s Bat, Germany. Emerg Infect Dis. 2011;17(8):1519–22. doi:10.3201/eid1708.110201. 24. Marston DA, Horton DL, Ngeleja C, Hampson K, McElhinney LM, Banyard AC, et al. Ikoma Lyssavirus, Highly Divergent Novel Lyssavirus in an African Civet. Emerg Infect Dis. 2012;18(4):664–7. doi:10.3201/eid1804.111553. 25. Fischer M, Wernike K, Freuling CM, Müller T, Aylan O, Brochier B, et al. A step forward in molecular diagnostics of lyssaviruses – results of a ring trial among European laboratories. PLoS ONE. 2013;8:e58372. doi:10.1371/journal. pone.0058372. 26. Robardet E, Picard-Meyer E, Andrieu S, Servat A, Cliquet F. International interlaboratory trials on rabies diagnosis: an overview of results and variation in reference diagnosis techniques (fluorescent antibody test, rabies tissue culture infection test, mouse inoculation test) and molecular biology techniques. J Virol Methods. 2011;177:15–25. doi:10.1016/j.jviromet.2011.06.004. Laboratory techniques in rabies Fifth edition 16 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 27. WHO Expert Consultation on Rabies, first report. Geneva: World Health Organization; 2005 (WHO Technical Report Series, No. 931 (https://www.who. int/rabies/trs931_%2006_05.pdf). 28. WHO Expert Consultation on Rabies, second report. Geneva: World Health Organization; 2013 (WHO Technical Report Series, No. 982 (https://apps.who. int/iris/bitstream/handle/10665/85346/9789240690943_eng.pdf). 29. Rabies. In: OIE Manual of diagnostic tests and vaccines for terrestrial animals, 6th edition. Paris: World Organisation for Animal Health (OIE); 2013:307–8. 30. McElhinney LM, Marston DA, Brookes SM, Fooks AR. Effects of carcase decomposition on rabies virus infectivity and detection. J Virol Methods. 2014;207:110–3. Laboratory techniques in rabies Fifth edition 17 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Chapter 28 Rabies real-time reverse transcriptase polymerase chain reaction Introduction Nucleic acid-based detection of rabies viruses (and other lyssaviruses) is now routinely employed in diagnostic laboratories. Validated assays including conven- tional (gel-based) reverse transcriptase polymerase chain reaction (RT-PCR; see Chapter 27) and real-time RT-PCR have long been established in quality-assured settings. In contrast to conventional RT-PCR, the real-time assay combines the amplification and detection within a closed tube system; thus, real-time PCR plat- forms offer a more rapid and reliable indication of the presence of lyssavirus RNA in suspect samples. The thermal cyclers detect the fluorescence emitted by the exponentially increasing amplicon (PCR product). Two approaches to detect the amplicons are commonly employed, the choice of which will depend upon the requirements of the diagnostic or surveillance system. One approach is to add a DNA intercalating dye (fluorochrome) to the reaction mix. Intercalating fluorochromes (such as SYBR Green or ResoLight) bind to double-stranded (ds) DNA during PCR. Bound fluorochromes emit fluores- cence which is detectable by the thermal cycler at each cycle, thus allowing DNA concentrations to be quantified. Because such dyes may also bind to nonspecific PCR products, a melting curve analysis must be undertaken at the end of the programme to confirm the specificity of the test result. The second approach utilizes hydrolysis probes (such as TaqMan probes). These probes make use of the Fluorescence Resonance Energy Transfer (FRET) whereby a quencher molecule at the 3’-end of the specifically designed oligo- nucleotide probe quenches the fluorescence emitted by the fluorophore cova- lently attached to the 5’-end. As long as the fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals which would otherwise be excited by the thermal cycler’s light source. When the probe binds to its target region during amplification, the exonuclease activity of the polymerase leads to the dissociation of fluorophore and quencher, allowing the resulting fluorescence to be emitted and measured. Several quenchers and fluorophores are available and should be selected based on the thermal cycler’s specifications. Although the probe system is inherently more specific than intercalating dyes, designing a probe which can detect all lyssaviruses within the small amplicon can be challen- ging. In comparison with conventional PCR assays, both approaches to real-time PCR are closed tube systems, thus reducing the possibility of cross-contamina- tion and false–positive results. The real-time PCR assays are usually more rapid due to the smaller amplicon sizes and eliminate the need for gel electrophoresis confirmation or subsequent rounds of amplification. When test samples are run alongside a serial dilution of positive control RNA, the amount of viral RNA present Laboratory techniques in rabies Fifth edition 18 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences in a sample can be quantitated. The probe-based assays also enable multiple target detection and virus typing, if using specific and appropriate probes coupled to different fluorophores. Many real-time RT-PCR assays have been reported for lyssavirus detection, some of which were selectively developed for the individual virus strain or virus lineage (1), while others were developed to detect a wider range of rabies strains and/or lyssavirus species (2–6). All published assays will have limitations as regards their diagnostic range due to the restricted field samples available when validating the assays. Therefore, it is essential to consider the lyssavirus lineages and strains in each region when establishing this methodology. Indeed, emerging or novel virus strains may render the highly specific probe-based assays ineffec- tive (7–9). The choice of the SYBR Green versus the probe RT-PCR will depend on the intended application. For a laboratory conducting surveillance on brain material and expecting high numbers of negative samples, the use of the cheaper SYBR Green real-time PCR would be recommended. The SYBR Green approach would also be optimal when conducting scanning surveillance where novel or divergent lyssaviruses may be present which would otherwise be undetected by restricted probe-based assays. Whereas the more specific and sensitive probe- based assays may be preferable in a laboratory, conducting lyssavirus diagnosis on suspect samples which are expected to have a restricted lyssavirus species range and contain low viral loads may require rapid typing. This chapter describes two pan-lyssavirus real-time RT-PCR assays. The first approach is the SYBR Green assay, a well-established and broadly applicable quantitative real-time PCR which employs SYBR Green and the pan-lyssavirus nucleoprotein (N) gene primers, JW12 and N165-146. These primers were first designed and validated for a differential TaqMan-based assay, then subsequently utilized in a SYBR Green assay (2, 10). The second real-time PCR assay is the multi- plex probe based LN34 assay, which uses a combination of degenerate primers and probes to achieve high sensitivity and specificity (4). Both assays have been shown to detect a wide range of RABV variants and other lyssaviruses (2, 4, 10, 11) and both have been successfully applied for both antemortem and postmortem diagnosis. Methods Viral RNA extraction Extract the RNA following the instructions given in Chapter 27 on conven- tional gel-based PCRs and store RNA samples at −80 °C until use. As previously covered for conventional PCR and due to the high sensitivity of the real-time PCR, great care must be taken to ensure that any cross-contamination is excluded. Validation of the extraction step may be performed by using exogenous controls (e.g. synthetic eGFP RNA) spiked directly into each sample during the early phase (i.e. after addition of TRIzol) or by detecting host nucleic acid via a housekeeping assay (Table 28.1). Laboratory techniques in rabies Fifth edition 19 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences   P C R a ss ay P rim er /P ro be S eq ue nc e (5 ’- 3’ ) P os iti on a R ef er en ce SYBR® Green pan- lyssavirus N -g en e P C R JW 12 AT G TA A C A C C Y C TA C A AT G 55 -7 3 Th is c ha pt er ; ( 10 ) N 16 5- 14 6 G C A G G G TA Y TT R TA C TC AT A 16 5- 14 6 L- ge ne P C R P an -L ys sa -7 53 1F TT C TT C G C TY TR AT G TC W TG G A A 70 74 -7 09 6 (1 5) P an -L ys sa -7 74 9R AT G R TT G TT C C A C TT Y TC AT A R TC 72 92 -7 26 9 N -g en e P C R R V- Q -R T- P A C G C TT A A C A A C M A R AY C 1- 18 (1 4) R V- N P -Q -F or w ar d C A A G AT G TG TG C YA AY TG G A G 64 4- 66 3 R V- N P -Q -R ev er se A G C C C TG G TT C G A A C AT TC T 88 1- 90 0 L- ge ne P C R Ta q5 lo ng fo rw ar d TA TG A G A A AT G G A A C A AY C AY C A 72 72 –7 29 4 (5 ) Ta q1 6r ev lo ng re ve rs e G AT TT TT G A A A G A A C TC AT G K G TY C 73 66 –7 39 0 Pan-lyssavirus probe-based assays LN 34 c P ro be L N 34 b FA M -A A +C +A C C Y +C +T +A C A +A +T G G A -B H Q 1 59 - 7 5 Th is c ha pt er ; ( 4) P ro be L N 34 la go b FA M -A A + C + A C TA + C + T +A C A + A + TG G A -B H Q 1 59 - 7 5 P rim er fo rw ar d1 A C G C TT A A C A A C C A G AT C A A A G A A 1 - 24 P rim er fo rw ar d2 A C G C TT A A C A A C A A A AT C A D A G A A G 1 - 25 P rim er re ve rs e C M G G G TA Y TT R TA Y TC AT AY TG R TC 14 0 - 16 4 R 13 M P JW 12 AT G TA A C A C C Y C TA C A AT G 55 -7 3 (2 ) m od ifi ed N 16 5- 14 6 G C A G G G TA Y TT R TA C TC AT A 16 5- 14 6 Ly sG T1 -F A M FA M -A C A A G AT TG TA TT C A A A G TC A AT A AT C A G -B H Q 1 81 -1 09 Ly sG T5 -H EX H EX -A A C A R G G TT G TT TT YA A G G TC C AT A A -B H Q 1 80 -1 05 Ly sG T6 -C y5 C y5 -A C A R A AT TG TC TT C A A R G TC C AT A AT C A G -B H Q 3 81 -1 09 B B LV -1 TE X TE X- C TC TG A C A A G AT TG TC TT C A A A G TC -B H Q 2 76 -1 01 Lyssavirus-specific probe-based assays R 14 M P R A B V R V- N -1 96 -F G AT C C TG AT G AY G TA TG TT C C TA 26 6- 28 8 (8 ) R V- N -2 83 -R R G AT TC C G TA G C TR G TC C A 35 3- 33 5 R ab G T1 -B -F A M FA M -C A G C A AT G C A G TT Y TT TG A G G G G A C -B H Q 1 29 7- 32 1 R 14 M P E B LV -1 EB LV 1- 35 3F G C TC A A A C R G G A G G TC A A G A 43 1- 45 0 (1 5) EB LV 1- 44 0R A G A C A R A G A A G A A G TC C W A C C A 51 0- 48 9 EB LV 1- 39 2H EX H EX -A C C C TA C R A C A C C TG A A C AT G C AT C T- B H Q 1 46 2- 48 7 R 14 M P E B LV -2 EB LV 2- 42 F R G TG TC TG TA A A R C C A G A A G 11 2- 13 1 (1 6) m od ifi ed EB LV 2- 17 3R G A C A G A AT R G A C TT AT A A G C TC T 24 3- 22 1 EB LV 2 N P ro be C y5 -T C G G A A A A A A C C C A G C AT A A C C C T- B H Q 2 17 5- 19 8 R 14 M P B B LV B B LV -2 F C C TT G G TR A A C AT TC A G A G A A C G 39 0- 41 2 (1 7) m od ifi ed B B LV -2 R G G C C A C A G TT G G AT C C C TT G 47 5- 45 6 B B LV -2 TE X_ as TE X- TC C TC C G G TC A A G G C C C A R TT G C C -B H Q 2 42 2- 44 5 Ta bl e 28 .1 . P C R a ss ay s an d th ei r r el at iv e pr im er a nd p ro be p os iti on s Laboratory techniques in rabies Fifth edition 20 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences P an -R A B V Ta q3 lo ng P rim er fo rw ar d AT G A G A A G TG G A AY A AY C AT C A 72 73 –7 29 4 (5 ) Ta q1 7r ev lo ng P rim er re ve rs e G AT C TG TC TG A AT A AT A G AY C C A R G 73 90 –7 41 4 R A B V4 P ro be FA M -A A C A C Y TG AT C B A G K A C A G A R A AY A C AT C -T A M R A 73 14 –7 34 2 R A B V5 P ro be FA M -A G R G TG TT TT C YA G R A C W C AY G A G TT TT TY C A -T A M R A 73 53 –7 38 4 Internal controls eG FP EG FP 1- F G A C C A C TA C C A G C A G A A C A C (5 , 1 8) EG FP 2- R G A A C TC C A G C A G G A C C AT G EG FP -P ro be 1 FA M -A G C A C C C A G TC C G C C C TG A G C A -B H Q 1 ß- ac tin S Y B R ® G re en pr im er s B at R at in tr on ic C G A -T G A -A G A -T C A -A G A -T C A -T TG Th is c ha pt er ; ( 2, 1 0) B at R at re ve rs e A A G -C AT -T TG -C G G -T G G -A C ß- ac tin A C T- 10 05 -F C A G C A C A AT G A A G AT C A A G AT C AT C (1 9) A C T- 11 35 -R C G G A C TC AT C G TA C TC C TG C TT A C T- 10 81 -H EX H EX -T C G C TG TC C A C C TT C C A G C A G AT G T- B H Q 1 ß- ac tin ß- ac tin p ro be (H EX )- TC C A C C TT C C A G C A G AT G TG G AT C A -( B H Q 1) Th is c ha pt er ; ( 4) ß- ac tin fo rw ar d C G AT G A A G AT C A A G AT C AT TG C ß- ac tin re ve rs e A A G C AT TT G C G G TG G A C a T he p rim er a nd p ro be p os iti on s ar e gi ve n re la tiv e to th e Ly ss av iru s fu ll ge no m e. b LN A -m od ifi ed b as es a re in di ca te d by a p lu s pr ec ed in g th e ba se in th e se qu en ce (e .g . + A , + G , + C , + T) . c T he p an -ly ss av iru s LN 34 a ss ay h as a m ix ed p ro be o f P ro be L N 34 a nd P ro be L N 34 la go in a ra tio o f 2 :1 re sp ec tiv el y; th e fo rw ar d pr im er is a 1 :1 m ix tu re o f P rim er fo rw ar d1 a nd P rim er fo rw ar d. Lyssavirus-specific probe-based assays (continued) Ta bl e 38 .1 . co nt in ue d Laboratory techniques in rabies Fifth edition 21 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Pan-lyssavirus real-time RT-PCRs Materials and equipment • Several thermal cyclers are available that allow real-time detection of fluores- cence. The difference in cycler performance when using established manufac- turers is generally limited; nevertheless, assays must be validated or optimized when moved to a new thermal cycler. Test reagents should be optimized for the individual thermal cyclers of different companies. For example, the CFX96 quantitative PCR system (Bio-Rad Laboratories Inc., Hercules, USA) should be used with the respective Bio-Rad 96-well PCR plates. For real-time RT-PCR, numerous test kits are commercially available. In the protocols below, two kits have been validated but others can also be used after appropriate validation. When developing and/or establishing real-time RT-PCR assays in the labora- tory, test parameters must be validated locally. For example, the limit of detec- tion must be identified by evaluating the sensitivity of the assay using a 10-fold serial dilution series of stock RNA (e.g. 1 µg/µL over a range of 1 µg–1 pg for viral RNA stocks extracted from positive brain). Additionally, the specificity of the assay must be confirmed using an appropriate and locally relevant panel of positive and negative samples. • MicroAmp reaction plate base (or equivalent plate/strip/tube holder) • 96-well PCR plates, non-skirted or strips of 8 or 12 PCR-tubes suitable for the chosen real-time machine • optically clear flat cap strips (strips of 8 or 12 lids) or optical adhesive covers, applicator and compression pad • range of pipettes and nuclease-free barrier tips, capable of dispensing 0.5–1000 μL • Eppendorf tubes or bijous of relevant size for preparation of the master mix • ice buckets and ice or equivalent method of keeping reagents cool during setup • vortex mixer • bench-top micro-centrifuge • molecular biology reagent grade water • appropriate cleansing agent to minimize cross-contamination • permanent marker pen • gloves and a laboratory coat must be worn at all times. Preparation of master mix The master mix contains all the components for the reverse transcription (if  required) and amplification. Sufficient master mix should be prepared to be able to analyse all the samples plus no template control(s) and positive control(s). Master mixes can be made up fresh for the test to be run or in batches; if locally validated, they can be frozen for up to one year in suitably sized aliquots. Laboratory techniques in rabies Fifth edition 22 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Test specimens RNA extracted from postmortem brain tissue (optimally brainstem and/or cere- bellum) of the animal or human being tested for the presence of lyssaviruses. RNA from human antemortem specimens (including serial saliva specimens, skin biopsies, hair follicles, cerebrospinal fluid, urine and serum) may also be tested. All test samples should be run at least in duplicate (ideally triplicate), and multiple internal controls (see below) for each of the primer/probe sets should be included in each run. All controls must be included alongside test samples in every test run to ensure the test is performing within expected parameters. Internal controls Positive controls. Each newly prepared batch of positive control RNA must be validated and calibrated to ensure it is consistently within the expected cycle threshold (Ct) range. The expected range will be defined by the laboratory accor- ding to the technique employed and will be used to confirm the validity of each test run. Working aliquots must be prepared to prevent multiple freeze–thaw cycles from stock batches, stored at −80 °C and should not be used if the Ct value is out of range. Negative controls. Molecular-grade water and/or negative RNA sample are added to the master mix (no template control) to confirm that the reagents are free from contaminants. Additional controls. The efficacy of nucleic acid extraction and/or functiona- lity of amplification can be tested using heterologous internal control systems or endogenous housekeeping genes (Table 28.1). The use of endogenous housekee- ping genes or the direct spiking of internal controls into the suspect samples ensures that all steps (extraction, reverse transcription and amplification) are analysed under the same conditions and in the same matrix as the lyssavirus screening. Spiking of exogenous internal control could also overcome the lack of detection of endogenous housekeeping genes in some biological samples due to low level of cells, such as in CSF (in the context of antemortem rabies diagnosis in humans). Protocol 1. Wear clean gloves (not previously worn when handling extracted RNA or PCR products) when setting up assays. 2. Change or decontaminate gloves whenever you suspect they are contami- nated. 3. Keep reagent tubes and reactions capped as much as possible. 4. Before setting up assays and after handling extracted RNA or PCR products, clean equipment and laboratory benches with one of the acceptable surface decontaminants listed under reagents. Use aerosol barrier (filter) pipette tips. Laboratory techniques in rabies Fifth edition 23 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Summary of outcomes and overall result Test result Internal control Overall result Negative Negative Invalid: repeat extraction and/or testing Negative Positive Negative result reported Positive Positive Positive result reporteda Positive Negative Repeat and/or run on a gela a If confirmed positive, follow up may be advised with additional tests and/or sequencing (see Chapter 29 on Sanger sequencing and Chapter 31 on next generation sequencing). The SYBR Green assay The procedure detailed here is an example that uses the same primers as the differential TaqMan assay described previously (2). The use of a universal SYBR Green one-step RT-PCR kit for the detection of lyssavirus species from clinical specimens has been demonstrated to be both highly sensitive and specific for lyssavirus RNA. Furthermore, by using SYBR Green as the detection system it is able to detect all lyssaviruses (including highly divergent WCBV, IKOV and LLEBV) based on the pan-lyssavirus primer specificity. This method includes a separate RT-PCR assay containing SYBR Green for amplification of the internal housekee- ping control, ß-actin, used as a template control for RNA extraction. Using a universal SYBR Green one-step RT-PCR kit, cDNA synthesis and PCR amplification are carried out in a single tube. SYBR Green, a cyanine dye, binds to dsDNA during the amplification and the resulting DNA-dye complex absorbs blue light and emits green light. As the target amplicon accumulates with increasing PCR cycles, increasing dye is bound and gives greater levels of fluorescence. SYBR Green assays have two major phases: amplification and dissociation. The amplification phase corresponds to the PCR portion of the assay, and results in the generation of dsDNA. In the dissociation phase, the dsDNA product is melted into single-stranded DNA by a stepwise increase in temperature, with fluorescence data being collected at each temperature step. This dissociation phase gives an indication of the amplicon size. The likelihood of false–positive reactions in quality-assured laboratories is negligible. Specific reagents and biologicals • Lyssavirus-specific primers (HPLC purified) diluted to 20 µmol: – JW12 RT/PCR primer 5’-ATG-TAA-CAC-CYC-TAC-AAT-G-3’ – N165-146 PCR primer 5’-GCA-GGG-TAY-TTR-TAC-TCA-TA-3’ • Multispecies ß-actin primers (HPLC purified) diluted to 20 µmol: – BatRat ß-actin intronic primer 5’-CGA-TGA-AGA-TCA-AGA-TCA-TTG-3’ – BatRat ß-actin reverse primer 5’-AAG-CAT-TTG-CGG-TGG-AC-3’ • Bio-Rad iTaq™ Universal SYBR® Green One-Step RT-PCR Kit (catalogue number 172-5150/1) Laboratory techniques in rabies Fifth edition 24 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Test procedure In the clean room or UV cabinet 1. Wipe the bench with an appropriate disinfectant before use, then prepare the PCR workstation by opening the doors and wiping the cabinet surface with an appropriate disinfectant (to remove residual nucleic acids). Place an ice bucket (small), discard pot (containing an appropriate disinfectant), suitable pipette and tips within the station and close the doors. Switch on UV light for 10 min. 2. Obtain the required reagents from the –20 °C freezer. Ensure the enzyme mix is kept on ice; the remaining reagents can be thawed at room temperature. 3. Put the required number of 0.2 mL strips into an appropriate holder (or a 96-well plate if there are multiple samples). 4. Prepare a reaction master mix as below and keep all reagents on ice. Allow for pipetting variation by preparing at least an extra two reaction mixes (e.g. if you are running five reactions in total, prepare master mix for seven reactions). Reagent μL/reaction Molecular-grade water 7.55 2× universal SYBR Green reaction mix 10 JW12 (Forward) [20 μmol] 0.6 N165-146 (Reverse) [20 μmol] 0.6 iTaq RT enzyme mix 0.25 Total per reaction 19 5. Prepare a reaction master mix for the ß-actin mRNA which assesses the quality of the extracted RNA. The SYBR Green assay for ß-actin must be positive to have confidence that RNA was isolated from the starting material. Reagent μL/reaction Molecular-grade water 7.55 2× Universal SYBR Green reaction mix 10 BatRatAct intronic (Forward) [20 μmol] 0.6 BatRatAct reverse (Reverse) [20 μmol] 0.6 iTaq RT enzyme mix 0.25 Total per reaction 19 Vortex the prepared master mixes and aliquot 19 μL into each of the relevant wells of a 96-well plate, 8-well or 12-well strips (according to the plate set up sheet). In the template room or UV cabinet – addition of template 1. Wipe the bench with an appropriate cleanser prior to use, then prepare the PCR workstation by opening the doors and wiping the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate disinfectant), suitable pipette and tips within the station and close the doors. Switch on UV light for 10 min. 2. Thaw samples and control RNA on ice. Laboratory techniques in rabies Fifth edition 25 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences 3. Add 1µL of test RNA (where possible, at a concentration of 1 µg/µL for TRIzol extracted tissue samples) below the surface of its allocated master mix tube and mix gently. Discard the tip directly into disinfectant after use. Repeat this process until all samples and controls have been added to their allocated tubes. 4. Press the lids down by hand and seal firmly. Number the strip lids according to your plate layout for orientation. 5. Transfer the PCR plate or strips to the real-time machine for thermal cycling. Setting up the real-time thermal cycler (this may vary depending on the machine used) 1. Load the plate or strips into the machine ensuring that they are orientated correctly. Check that all the lids are firmly sealed, and then close the machine’s plate cover and door. 2. Ensure that “SYBR” is selected as mode of the detection. 3. Label the wells with sample information (e.g. specimen number). 4. Label the positive and negative controls. 5. Set up the thermal profile as follows: Stage Cycles Temperature Time Data collection Reverse transcription 1 50 oC 10 min RT inactivation/initial denaturation 1 95 oC 5 min Amplification 40 95 oC 60 oC 10 s 30 s End-point Dissociation curve analysis 1 95 oC 55 oC 55–95 oC 1 min 1 min 10 s All points 6. Start the reaction. Save the appropriately labelled run in the relevant folder as necessary. Analysis of results 1. Once the run has finished, highlight the wells for which you want to collect data for analysis. 2. The amplification plot screen shows a plot of cycles versus fluorescence for an individual collection point on which data have been gathered. Positive samples will have exponential ramps followed by plateau and a Ct value, which should be interpreted alongside the positive and negative controls. Negative samples will have a flat amplification plot and no Ct values. The Ct value is calculated automatically by the software on completion of the run. 3. The lower the Ct value, the more amplicon produced (i.e. the level of fluores- Laboratory techniques in rabies Fifth edition 26 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences cence crossed the threshold earlier in the run) and therefore the more viral RNA (i.e. the assay is semi-quantitative). 4. As SYBR Green binds to any dsDNA, a thorough analysis of the dissociation curve must be performed to determine the specificity of the PCR products and monitor the presence of primer-dimers or contaminants that might be contribu- ting to the fluorescent signal. 5. Generally, populations with a temperature of ≥ 80 °C correspond to the larger PCR products and can usually be assigned as specific DNA products. These dissociation curves usually produce a narrow well-defined peak which can be compared to the positive control. DNA products displaying melting tempera- tures of < 75 °C corresponding to non-specific DNA products. 6. The melting temperature will peak for RABV amplicons around 79 °C. The melting temperature for ß-actin is around 86 °C. Any positive sample will have a melting temperature peak the same temperature as the positive control. Any samples with different melting temperatures are not considered positive. 7. In case of an inconclusive assay, an agarose gel can be run to confirm the presence or absence of an amplicon the same size as the positive control (approximate size 100 bp). The LN34 assay The multiplex probe-based LN34 assay is a real-time RT-PCR assay which uses a combination of degenerate primers and probes to achieve superior coverage of the lyssavirus genus while maintaining sensitivity and specificity (4). The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the N gene coding sequence of the lyssavirus genome to main- tain assay robustness. The probe sequences overlap with the highly conserved JW12 sequences and are further modified by locked nucleotides to increase their melting temperature and meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay is able to eliminate the nonspecific amplifications from the nonspecific binding of the degenerated primers and/or primer dimers and allow a standardized diagnostic interpretation based on the Ct values. The diagnostic algorithm of the LN34 assay reduces the uncertainties in rabies testing and makes the adaptation of LN34 assay easier once a laboratory has the capacity for real- time PCR. The LN34 assay has the built-in artificial positive control which can be used to monitor the quality of the assay in a laboratory and to compare diagnostic results directly among different laboratories and different regions. It produces a 165 bp amplicon which can be sequenced for a rapid genetic typing of a posi- tive result. In the near future, the LN34 assay and the host RNA ß-actin assay could be combined into a single tube, two-colour test to further reduce costs and diagnostic errors. Specific reagents and biologicals • Reagents (light sensitive: store in the dark at −20 °C) – LN34 assay primer and probe set (Table 28.1) – ß-actin assay primer and probe set (Table 28.1) Laboratory techniques in rabies Fifth edition 27 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences • Reagents (non-light sensitive) – Ag-Path ID One-Step RT-PCR Kit [Life Technologies, Catalogue no. 4387391] – Store at −20 °C; refer to manufacturer’s instructions for expiration infor- mation. Test procedure Each RNA sample must be run in triplicate and be tested using the LN34 assay and a ß-actin control assay. Three no template control wells and three known posi- tives for each of the primer or probe sets should be included in each run. Reac- tion assay mixtures (master mixes) containing all components except templates should be made as cocktails and dispensed into the 96-well reaction plate, 8-well strips or 12-well strips. Extracted RNA or water should then be added to test and control reactions, respectively. 1. Prepare separate master mixes for LN34 and ß-actin assays using the table below. Reagent μL/reaction Water 6.5 2× RT buffer 12.5 25×RT-PCR enzyme mix 1 Forward primer [10 μmol] 1 Reverse primer [10 μmol] 1 Probe [5 μmol] 1 RNA 2 Total per reaction 23 2. Load 23 μL of master mix into the assigned wells in an appropriate plate or tubes for your real-time PCR instrument. 3. Set up the NTC reactions by pipetting 2 μL of PCR-grade water into all the NTC wells. 4. Briefly vortex and centrifuge the tubes containing the RNA samples. 5. Set up the extracted RNA sample reactions. a. Pipette 2 μL of the first sample into all the wells labelled for that sample. b. If sample volume is < 2 μL, add PCR-grade water to the reaction tube to bring the total reaction volume up to 25 μL. 6. Repeat step 2 for the remaining samples and the positive controls. 7. After the addition of the last sample or control, peel off the protective covering of the optical adhesive cover and place it over the wells, being sure to cover all the wells. 8. Ensure bubbles are removed by tapping the plate or by centrifuging the plate at 500 × g for 1 min at room temperature. Place sealed tubes or plate into a real-time PCR instrument that can detect FAM and VIC. Set to the conditions below or optimize to local real-time PCR machine as follows: Laboratory techniques in rabies Fifth edition 28 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences ViiA7 – Standard mode Cycles Temperature Time Data collection Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 1 s 20 s End-point ABI7500 – Standard mode Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 15 s 30 s End-point ABI7500 Fast/FastDX – Fast mode Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 3 s 30 s End-point Laboratory techniques in rabies Fifth edition 29 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Interpretation of results 1. Allow the instrument to analyse the results automatically; any manual threshold or baseline adjustments need to be recorded and explained. 2. Record DFAT results (antigen intensity and distribution) as well as Ct values for the ß-actin and LN34 assays for each sample and control, as follows: Brain sample result guidance Assay Ct value Result Action required ß-actin Earlier than 33 Positive No action required; 99.2% of 2248 samples tested in a preliminary cohort exhibited an average ß-actin Ct value < 33. 33–45 Inconclusive Possible inhibition or insufficient sample. Repeat or additional testing required. Not detected Fail Insufficient sample or failed extraction. Re- peat or additional testing required. LN34 Earlier than 35 Positive No action required; 99.6% of 678 FAT-pos- itive samples tested in a preliminary cohort exhibited LN34 Ct value < 35. 35–45 Inconclusive Repeat or additional testing required. Share the tissue with National Reference Laborato- ry for confirmatory testing. Not detected Negative or Inconclusive Negative if ß-actin ≤ 33 and > 0. Inconclu- sive if ß-actin is > 33 or 0. 3. A RABV-positive sample extracted from properly collected and stored brain tissue is expected to have a Ct value less than 35 cycles for the LN34 assay. Samples that amplify after 35 cycles with the LN34 assay with ß-actin Ct values < 20 may indicate potential problems with the assay, sample, or extraction, particularly sample contamination if positive rabies samples were processed on the same day. 4. A synthetic LN34 positive control RNA template (107 bases) can be generated using an in vitro T7 transcription kit for normalization purposes (oLPC-ra- bies3-4: GCA CAG GGT ACT TGT ACT CAT ACT GAT CTG AAT CCA TTG TAG AGG TGT TAG AGC ACG ACA GGT TTC CCG ACT GGA TCT TTC TTT GAT CTG GTT AAG CGT TCG CCC TAT AGT GAG TCG TAT TAC A) (4). 5. The LN34 Ct value of the positive control should be between 25 and 28. A tripli- cate set up is recommended. If the positive control sample does not produce growth curves that cross the threshold line, invalidate the run and repeat the assay with stricter adherence to the guidelines outlined above. 6. For test samples, if only one of the three triplicates amplifies, the result is consi- dered invalid. Two of the three replicates should amplify with a Ct value earlier than 35 for LN34 or 33 for ß-actin for a valid positive result for RNA extracted from brain tissue. Repeat extraction or testing may be indicated. 7. LN34 sample Ct values should not be considered independent of their ß-actin results. All clinical specimens should exhibit ß-actin curves that cross the Laboratory techniques in rabies Fifth edition 30 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences threshold line, thus indicating the presence of host RNA. ß-actin Ct values determine the quality, suitability and potential inhibition of the sample being tested. Some samples may fail to exhibit ß-actin growth curves due to low concentration in the original clinical specimen. Failure to detect ß-actin in any clinical sample may indicate: – improper extraction of RNA from clinical materials resulting in loss of RNA or carryover of PCR inhibitors from clinical specimens; – improper assay set up and execution; – inadequate clinical sample; and/or – reagent or equipment malfunction. 8. A Ct value of 33–45 in the ß-actin assay may indicate PCR inhibition. Where LN34 is negative and ß-actin Ct is between 33 and 45, dilute samples 10-fold and repeat. 9. Samples where less than one half of replicates exhibited Ct values > 39 and the reminder of the replicates showed no amplification can be considered negative for LN34. 10. The NTC reactions for LN34 and ß-actin probe or primer sets should not exhibit amplification curves that cross the threshold line. If either of these NTC reactions exhibit amplification curves that cross the threshold line, specimen contamination may be indicated. Invalidate the run and repeat the assay with stricter adherence to the guidelines outlined above. 11. This assay does not differentiate between lyssaviruses. Discussion Real-time RT-PCR has become a standard confirmatory technique for the post- mortem diagnosis of rabies in humans and animals in many quality-assured rabies reference laboratories. This technique, and other validated molecular methods, are increasingly relied upon as the first line approach for the antemortem diagnosis of human rabies, as DFAT and RTCIT are often inappropriate. Initial concerns regar- ding molecular assays, including cross-contamination and false–positive results, seem to have been largely resolved by following various preventive measures and quality control systems. Indeed, in a ring-trial in Europe, the performance of real-time PCR gave more concordant results than virus isolation in cell culture (12). A recent pilot programme involving 15 laboratories from the USA, Canada, Europe, Philippines, Chile, Haiti, Georgia and India tested approximately 3000 suspected animal samples using both LN34 assay and DFAT testing and detected more than 1000 positive samples successfully. Compared with the DFAT testing, the LN34 assay produced no false–negative results, one possible false–positive result with a Ct value near the cut-off value and reduced more than 80% of inde- terminate results from DFAT testing. Based on the adapted diagnostic algorithm, the LN34 assay achieved 99.31% diagnostic specificity and 99.87% diagnostic sensitivity. Similarly, the JW12/N165 based SYBR Green RT-PCR assay has been validated using hundreds of clinical specimens (human and animal) and was successfully used by 56% of laboratories participating in the real-time RT-PCR Laboratory techniques in rabies Fifth edition 31 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences annual (EURL) coordinated proficiency ring-trials (2013–2015), demonstrating 100% concordance with the DFAT and hnRT-PCR results including non-RABV lyssavirus samples. The two methods described in this chapter are examples of pan-lyssavirus diagnostic real-time RT-PCRs validated for diagnosis of both human and animal rabies. Other established and well-validated assays, both SYBR and probe-based, have been reported, mainly targeting the relatively conserved nucleoprotein or polymerase genes (some examples are shown in Table 28.1) and offer possibilities for laboratories to select, optimize and introduce this technique depending on their specific needs. In settings where the diversity of lyssaviruses is either variable or unknown and for surveillance schemes (such as preliminary bat surveillance) when novel virus variants or even novel lyssavirus species may be discovered, pan lyssavirus assays are highly recommended as RABV-specific based assays may yield false–negative results. In large-scale surveillance schemes which are likely to yield significant numbers of negative samples, the probe-based assays may be prohibitively expensive relative to the less expensive SYBR® Green assays at this time, but an expan- sion of production may reduce the costs of probe-based assays considerably. To increase specificity, the melting curve analysis represents an essential parameter to avoid a false–positive result due to the formation of primer dimers. In addition, sequencing of the amplicon can give further confirmation. The highly specific probe-based assays offer advantages over the SYBR Green assay when circulating virus variants are known or where rapid lyssavirus typing is desired (2). However, a combination of the two approaches is often employed in reference laboratories. For example, a dual combined approach employing two L-gene based real time assays (a pan-RABV probe-based assay and a pan-lys- savirus SYBR Green assay) has recently been established and validated using a large cohort of animal and human rabies infected material (5); see Table 28.1 for primer/probe details. For the samples with a low level of RABV RNA, such as antemortem samples or samples stored or transported under suboptimal conditions and that cannot be diagnosed by other methods, the real-time RT-PCR assay is especially useful due to its superior sensitivity (4). However, as for other molecular techniques, addi- tional care is required when applying the real-time RT-PCR for the antemortem diagnosis of human rabies compared with postmortem diagnosis on brain tissue. Indeed, the viral load is often much lower in antemortem specimens, potentially below the threshold of detection of the technique, especially when the viral strain is genetically distant from the designed probes or primers. Testing multiple or serial samples and combining different molecular techniques can be useful for such antemortem diagnosis (see Overview of antemortem and postmortem tests for diagnosis of human rabies in Chapter 5). The real-time RT-PCR assay is able to test samples stored in the RNA stabilization buffers, or spotted on FTA cards and nitrocellulose membrane of lateral flow devices (see relevant chapter on the rapid immunochromatographic diagnostic test in this manual) (13), which reduce the burden of sample collection, transportation and storage for rabies diagnostics and surveillance. This is particularly important in rural areas or developing coun- tries which often have limited resources and lack experienced laboratorians. Laboratory techniques in rabies Fifth edition 32 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Relative quantitation is possible using either SYBR Green or probe-based assays to estimate comparative viral loads in clinical specimens (2, 4, 14). Many primer (and probe) sets have been published (some of which are outlined in Table 28.1) which can be modified and validated locally, to establish an optimal technique for their own particular needs. When established, laboratories should regularly check the performance of their assays by using internal controls and by taking part in national and/or international ring-trials. Because all assays should be fit-for-pur- pose in the individual laboratory, it is not advisable to recommend one specific assay. Rather, if laboratories want to use real time RT-PCR as a confirmatory test, additional to DFAT, they need to show congruent results when testing a panel of RABVs adapted to their epidemiological setting or other lyssaviruses that repre- sents the global diversity. While positive real-time RT-PCR results may result in prompt action concerning the provision of post-exposure prophylaxis (PEP), where possible they should be followed up using classical virological techniques, i.e. DFAT or virus isolation, to allow for future characterization and support case notification to OIE and WHO. Laboratory techniques in rabies Fifth edition 33 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences References 1. Panning M, Baumgarte S, Pfefferle S, Maier T, Martens A, Drosten C. Compa- rative analysis of rabies virus reverse transcription-PCR and virus isolation using samples from a patient infected with rabies virus. J Clin Microbiol. 2010;48:2960–2. doi:10.1128/JCM.00728-10. 2. Wakeley PR, Johnson N, McElhinney LM, Marston D, Sawyer J, Fooks AR. Development of a real-time, TaqMan reverse transcription-PCR assay for detection and differentiation of lyssavirus genotypes 1, 5, and 6. J Clin Microbiol. 2005;43:2786–92. doi:10.1128/JCM.43.6.2786-2792.2005. 3. Faye M, Dacheux L, Weidmann M, Diop SA, Loucoubar C, Bourhy H, et al. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus. J Virol Methods. 2017;243:120–30. doi:10.1016/j. jviromet.2016.12.019. 4. Wadhwa A, Wilkins K, Gao J, Condori Condori RE, Gigante CM, Zhao H, et al. A pan-Lyssavirus Taqman real-time RT-PCR assay for the detection of highly variable rabies virus and other lyssaviruses. PLoS Negl Trop Dis. 2017;11:e0005258. doi:10.1371/journal.pntd.0005258. 5. Dacheux L, Larrous F, Lavenir R, Lepelletier A, Faouzi A, Troupin C, et al. Dual combined real-time reverse transcription polymerase chain reaction assay for the diagnosis of Lyssavirus infection. PLoS Negl Trop Dis. 2016;10:e0004812. doi:10.1371/journal.pntd.0004812. 6. Nadin-Davis SA, Sheen M, Wandeler AI. Development of real-time reverse transcriptase polymerase chain reaction methods for human rabies diagnosis. J Med Virol. 2009;81:1484–97. doi:10.1002/jmv.21547. 7. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 8. Hoffmann B, Freuling CM, Wakeley PR, Rasmussen TB, Leech S, Fooks AR, et al. Improved safety for molecular diagnosis of classical rabies viruses by use of a TaqMan real-time reverse transcription-PCR “double check” strategy. J Clin Microbiol. 2010;48:3970-8. doi:10.1128/JCM.00612-10. 9. Coertse J, Weyer J, Nel LH, Markotter W. Improved PCR methods for detec- tion of African rabies and rabies-related lyssaviruses. J Clin Microbiol. 2010;48:3949-55. doi:10.1128/JCM.01256-10. 10. Hayman DT, Banyard AC, Wakeley PR, Harkess G, Marston D, Wood JL, et al. A universal real-time assay for the detection of Lyssaviruses. J Virol Methods. 2011;177:87–93. doi:10.1016/j.jviromet.2011.07.002. 11. Marston DA, Horton DL, Ngeleja C, Hampson K, McElhinney LM, Banyard AC, et al. Ikoma lyssavirus, highly divergent novel lyssavirus in an african civet1. Emerg Infect Dis. 2012;18:664–7. doi:10.3201/eid1804.111553. Laboratory techniques in rabies Fifth edition 34 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences 12. Robardet E, Picard-Meyer E, Andrieu S, Servat A, Cliquet F. International interlaboratory trials on rabies diagnosis: an overview of results and variation in reference diagnosis techniques (fluorescent antibody test, rabies tissue culture infection test, mouse inoculation test) and molecular biology tech- niques. J Virol Methods. 2011;177:15–25. doi:10.1016/j.jviromet.2011.06.004. 13. Lechenne M, Naissengar K, Lepelletier A, Alfaroukh IO, Bourhy H, Zinsstag J, et al. Validation of a rapid rabies diagnostic tool for field surveillance in developing countries. PLoS Negl Trop Dis. 2016;10:e0005010. 14. Wang L, Liu Y, Zhang S, Wang Y, Zhao J, Miao F, et al. A SYBR-Green I quantitative real-time reverse transcription-PCR assay for rabies viruses with different virulence. Virologica Sinica. 2014;29:131–2. doi:10.1007/s12250- 014-3378-1. 15. Fischer M, Freuling CM, Muller T, Wegelt A, Kooi EA, Rasmussen TB, et al. Molecular double-check strategy for the identification and characterization of European Lyssaviruses. J Virol Methods. 2014;203:23–32. doi:10.1016/j. jviromet.2014.03.014. 16. Schatz J, Ohlendorf B, Busse P, Pelz G, Dolch D, Teubner J, et al. Twenty years of active bat rabies surveillance in Germany: a detailed analysis and future perspectives. Epidemiol Infect. 2014;142:1155–66. doi:10.1017/ S0950268813002185. 17. Freuling CM, Abendroth B, Beer M, Fischer M, Hanke D, Hoffmann B, et al. Molecular diagnostics for the detection of Bokeloh bat lyssavirus in a bat from Bavaria, Germany. Virus Res. 2013;177:201–4. doi:10.1016/j. virusres.2013.07.021. 18. Hoffmann B, Depner K, Schirrmeier H, Beer M. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detec- tion system for pestiviruses. J Virol Methods. 2006;136:200–9. doi:10.1016/j. jviromet.2006.05.020. 19. Toussaint JF, Sailleau C, Breard E, Zientara S, De Clercq K. Blue- tongue virus detection by two real-time RT-qPCRs targeting two different genomic segments. J Virol Methods. 2007;140:115–23. doi:10.1016/j. jviromet.2006.11.007. Laboratory techniques in rabies Fifth edition 35 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences Chapter 29 Sanger sequencing of lyssaviruses Introduction Sanger dideoxy terminator sequencing was developed by Fred Sanger and colleagues in 1977 (1). The method is based on the selective incorporation of chain-terminating dideoxynucleotides (ddNTPs) by DNA polymerase during in vitro DNA replication. Sanger sequencing has become the most widely used sequencing method during the past three decades. For large-scale, automated genome analyses, it has more recently been replaced by next-generation sequen- cing methods. However, the Sanger method remains in widespread use, parti- cularly when partial genome characterization is sufficient for virus typing or for smaller-scale genome projects. The Sanger method is also the optimal approach for obtaining long contiguous DNA sequence reads (> 500 nucleotides). Since reverse transcriptase polymerase chain reaction (RT-PCR) was first used to amplify lyssavirus RNA in the early 1990s, a wide array of molecular-based diagnostic assays has been established (2,3). Sanger sequencing enables the rapid, reliable and relatively inexpensive virus typing of lyssavirus PCR products or amplicons compared with conventional monoclonal antibody typing (4). Within just a few years, the genetic typing of lyssaviruses became routine, quickly followed by an explosion of published molecular epidemiological and phyloge- netic studies. A specific genomic region has not been prescribed or standardized for lyssavirus molecular typing; however, a considerable amount of data has been published for partial and complete nucleoprotein gene sequences and this region has been shown to be sufficiently discriminatory for virus typing and evolutionary studies (5–8). Complete genome sequences have been obtained for a number of lyssa- viruses via Sanger sequencing of overlapping cloned PCR products or long-dis- tance PCR products, sometimes referred to as “walking the genome” (9–12). The multiple primer sets employed are often available from the authors on request or are supplied as supplementary data (12). Sanger sequencing, also referred to as dideoxy sequencing or chain termi- nation, is based on the use of fluorescently labelled ddNTPs in addition to the deoxynucleosidetriphosphates (dNTPs) found in DNA. Modern day automated sequencing employs an approach called “dye-terminator sequencing”. Each of the chain terminator ddNTPs is labelled with a different fluorescent dye, each of which emit light at different wavelengths. The four labelled ddNTPs (ddATP, ddGTP, ddCTP, or ddTTP) are added with the four normal dNTPs and the DNA polymerase. Before the DNA can be sequenced, it is heat denatured into single strands. Next, a primer is annealed to one of the template strands. The primer is specifically constructed so that its 3’ end is located next to the DNA sequence of interest. Following rounds of template DNA extension from the bound primer Laboratory techniques in rabies Fifth edition 36 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences (sequencing reaction), the resulting DNA fragments all start from the same primer site but are terminated by the incorporation of the ddNTP at different sites along the template sequence, thus generating fragments of different sizes that can be separated by gel electrophoresis. Unincorporated dye terminators must be completely removed before the samples can be analysed by electrophoresis. Excess dye terminators in sequencing reactions obscure data in the early part of the sequence and can interfere with the base calling software. Hence prior to loading the sequence reactions onto the automated sequencers, they are purified to remove excess ddNTPs. Automated DNA sequencers perform capillary elec- trophoresis for size separation and detection. They record the incorporation of the labelled ddNTPs as fluorescent peak trace chromatograms. Methods The following describes the protocols followed when using the ABI 3130xl, 16  capillary and ABI3730, 48 capillary Genetic Analyser instruments. Other machines and reagents are also available for Sanger sequencing. The ABI3730 and ABI3130 Genetic Analysers are fully automated capillary sequencers. They are capable of determining the nucleotide sequence of any given DNA sample and can also be used to estimate the sizes of DNA fragments that have been prepared with ABI dye-labelled reagents. The ABI 3130xl, 16 capil- lary Genetic Analyser can run 2 x 96 well plates; the ABI 3730, 48 capillary Genetic Analyser can run up to 16 96 well plates. Both machines can utilize capillary arrays of different lengths depending on what samples are being processed. Each set of samples, containing labelled DNA fragments, is automatically denatured and then separated by capillary electrophoresis. The replaceable medium (polymer) is automatically replaced in the capillaries after each separa- tion. Detection is facilitated by laser-induced fluorescence in four spectral chan- nels. The four-channel raw data sets generated by each of the capillaries are auto- matically processed to produce high-quality base sequences or fragment lists after separation. Preparing PCR amplicons for the ABI genetic analysers After a PCR product is generated from a lyssavirus-positive sample it needs to be purified then sequenced using florescence-based terminator cycle sequen- cing. The following describes the protocol to be followed when using the ABI Big Dye Terminator ready reaction kit. The kit works by providing a ready mix which contains the enzyme, dNTPs, magnesium chloride, buffer and dye terminators (ddNTPs) all at the appropriate quantities. Purified amplicon DNA and one primer are added to the mix and cycled to obtain dye terminated products which can be precipitated and analysed on the ABI genetic analysers. • Sequencing must be performed in both the reverse and forward direction (i.e. using 3’ and 5’ directed primers) so consensus (complementary) sequence can be obtained. Laboratory techniques in rabies Fifth edition 37 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences • Sequencing in each direction should be performed, at least, in duplicate prior to publication of the sequence to reduce the likelihood of errors. • If cloned PCR products are sequenced, ensure at least five independent clones are sequenced and use the consensus sequence for publication to ensure minor variants are not used as the representative sequence. Purifying the PCR product After visualizing the PCR product by agarose gel electrophoresis, the remaining PCR product should be purified prior to sequencing. A number of commercial kits are available for the purification of PCR products (e.g. QiaQuick PCR Purifi- cation kit [Qiagen]). If the PCR product band appears weak on the gel, it can be loaded and extracted directly from the gel using a commercially available kit (e.g. MinElute gel extraction kit [Qiagen]) which will enable the product to be eluted in as little as 10µL elution buffer and thereby increase the concentration. For large- scale purification (96-well plates), automated purification may be preferable (e.g. HTS PCR 96-well purification system [Millipore Multiscreen] or AMPure clean up system [Beckman Coulter Agencourt]). Ensure fresh tips are used between samples to avoid cross-contamination. 1. Elute purified PCR product from column in 10–50µL elution buffer depending on the amount of product and column used. 2. Quantify the DNA concentration using spectrometers (e.g. plate readers [Nano- Drop or POLARstar Galaxy]). BigDye terminator cycle sequencing reactions On ice, add the purified amplicon DNA (approximately 50–100 ng – usually 5μL) to the appropriate wells on a 96-well plate. If plasmid DNA is being used, pre-heat the DNA at 96 °C for 1 min and keep on ice. If many primers are being used for sequencing (forward, reverse, etc.), make a master mix without the primer and add primers to appropriate wells at this stage. See below as an example for calculating the amount of DNA to be added. PCR products: (PCR product length/100) x 2) / DNA conc (ng/μL) Plasmids: 100/DNA concentration (ng/μL) 1. Make a master mix using the volumes shown below. The amount of water can be amended to allow for variation in the amount of DNA product added, ensu- ring final volume is 20 μL. The primer employed will depend on the template sequence to be analysed (examples given below). Laboratory techniques in rabies Fifth edition 38 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences Sequencing mix volume added per reaction DNA 5.0 μL Molecular-grade water 6.0 μL BigDye sequencing mix 4.0 μL Buffer 4.0 μL Primer (3.2pmol/μL) 1.0 μL Total volume 20.0 μL Examples of primers (often the primers used for amplification) Gene Forward primer Reverse primer Nucleoprotein, 1st round JW12 JW6UNI Nucleoprotein, 2nd round JW12 JW10UNI Glycoprotein GP01 (GT1) GP02 (GT1) Plasmid PCR II M13–20 M13 2. Cover the plate with a foil-sealing lid and centrifuge briefly to collect liquid at the bottom of the wells if necessary. 3. Transfer the plate to a PCR machine and run on the suitable ABI sequencing programme; these can be modified to suit primers if necessary (see below). Cycling conditions Big Dye sequencing reactions 96 °C 10 s 50 °C 5 s x 25 60 °C 4 min 4 °C hold Ethanol precipitation of sequencing reactions The purification of the sequencing reactions facilitates the removal of unincor- porated labelled ddNTPs which would interfere with base calling. Once cycling is complete, remove the plate from the PCR machine and clean up the sequencing products. It is recommended that the ethanol/EDTA/NaOAc clean-up method is used. While ethanol/EDTA can be used, the smallest PCR fragments may not be precipitated. Note: Isopropanol precipitation is NOT recommended. 1. Add 2 μL 125 mmol EDTA to each well. 2. Add 2 μL 3 mol sodium acetate to each well. 3. Add 50 µL of 100% ethanol to each well. 4. Seal plate, vortex briefly and leave for 15 min at room temperature. 5. Centrifuge the plate at 3000 r/min for 45 min. 6. Invert plate over sink and shake three times to remove supernatant. 7. Rinse each well with 70 µL 70% ethanol. Laboratory techniques in rabies Fifth edition 39 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences 8. Centrifuge the plate at 3000 r/min for 15 min. 9. Invert plate over sink and shake three times to remove supernatant. 10. Keeping the plate inverted, place it on a piece of paper towel and centrifuge upside down for 15–30 s at 300 r/min. 11. Air dry for 15–10 min. 12. Seal and label the 96-well plate. Preparing 96-well sample plate(s) for the genetic analysers Spin samples down if necessary, remove sealing film. Loading 96-well sample plate(s) The Genetic Analysers have a safety feature which means that no movement will occur inside the machine when the door is open. The machines will not work and the buttons on the front of the machines will not function unless the door is properly closed. For the 3130xl. Press the button on the front of the machine labelled “TRAY”. Once the tray has stopped moving you can open the door. Inside, the machine has two positions for holding plates. Position A is on the left and position B is on the right. The plate assembly will only fit in one way with column 1 furthest away from the door due to a notch in the base plate of the plate assembly. Place the plate assembly into position. Close the door and wait to see the green light appear on the front of the machine, which indicates it is properly loaded. For the 3730. Open the stacker drawer of the Genetic Analyser, then open the In Stack door. Place the plate assemblies into the stacker with the plate(s) orientated so that the notched corner of the plate assembly is at the rear right corner of the stacker. Up to 16 plates can be placed in the “In Stack”. Close the In Stack door and then the stacker draw. Note: The In Stack is at the front of the stacker drawer with the “Out Stack” at the rear. Plates to be run are taken from the bottom of the stack and will then be at the top of the Out Stack once they have been run. Checking run reagents Check the polymer and buffers are within expiry dates. Check there is sufficient volume of polymer in the bottle for the run. Check for bubbles in the tubes (and small tank above) leading from the POP-7. If bubbles are present, an error could occur and your run will stop. To check for bubbles, switch on the light and look inside. Remember to turn off light once checked. Starting the run on the 3130xl In the Data collection program on the PC, select from the left-hand list 3130xl/ Run Scheduler in Plate View. Files which show “Processed” next to them are completed runs. Files which show “Pending” next to them are ready to be run. Laboratory techniques in rabies Fifth edition 40 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences When you locate your file, it should be Pending. You will see on the right of the screen two rectangles representing the two plate positions inside the machine. The colour of the rectangles means: Grey – no plate(s) in holder. Yellow – unlinked plate(s) in holder. Green – linked plate(s) in holder. Click once on the position that relates to your plate, position A (left) or position B (right). It should turn green. The Plate Record will now have A or B to the left of the name indicating the plate position that it is linked to. To start the run, click on the green arrow at the top left-hand corner of the window. A dialog box will appear telling you that you are about to start processing your plate. Click OK. Once the run is finished, check that the run has proceeded correctly and analysed sequence data are available. Starting the run on the 3730 In the Data collection program on the PC, select from the left-hand list 3730/ Run Scheduler in Plate View. Find the Plate Record file for the plate to be run first and highlight the file. Click on Add – this will add it to the list in the Input Stack dialog box with Status as Pending. Keep Adding plate records in the same order as the order they will be run, until all those to be run are in the In Stack dialog box. Plates can be added or removed during instrument operation. Click on Done to close the Add Plates to In Stack dialog box. Note: The Plate Record at the bottom of the list in the In Stack dialog box is marked “1” and will be run first, etc. If the sequencer is running, nothing further needs doing. If the sequencer is not running: to start your run, click on the green arrow at the top left hand corner of the window. A dialog box will appear telling you that you are about to start proces- sing your plate. Click OK. Once the run is finished, check that the run has proceeded correctly and analysed sequence data are available. Analysing output data The raw data will be generated in different formats depending on the sequencer used, but in general you would expect to obtain a chromatogram or trace from which you can derive the sequence (.seq or .fas file). From an ABI sequencer you would expect “.ab1” or “.abi” file formats (Fig. 29.1) whereas from a Beckman Laboratory techniques in rabies Fifth edition 41 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences sequencer you may expect a “.scf” file format. A number of software packages exist for analysing the data and generating consensus sequences from the replicate forward and reverse outputs (e.g. SeqMan in DNASTAR Lasergene). If the sequences are of good quality they will form a contiguous sequence (called a contig for short). The forward and reverse conti- guous sequences are aligned to generate consensus sequences (Fig. 29.1). If the consensus sequence saved is more than the required length it can be trimmed to the correct length by opening in a sequence editing programme (e.g. SeqMan or EditSeq in Lasergene 10 or MEGA www.megasoftware.net). Discussion Sanger sequencing is still beneficial to rabies diagnostic laboratories for confirming PCR-positive material, for determining the source of an outbreak or for understanding the molecular evolution of emerging viruses. Sequencing PCR products can now be achieved relatively inexpensively; the average sequencing run costs less than US $8. However, sequencing from PCR products may be error prone, particularly B y co ur te sy o f t he A ni m al a nd P la nt H ea lth A ge nc y, A dd le st on e, S ur re y, U ni te d K in dg om Fig. 29.1. Sanger sequencing of overlapping long-distance PCR amplicons (forward and reverse) facilitate genome sequencing via “Walking the genome”. The four ABI traces of four overlapping PCR products (RV2479, 1993 EBLV-2 M. daubentonii from Switzerland) yield contiguous sequences which are superimposed (aligned) to generate a consensus sequence (top frame) determined using the Seqman Programme (DNASTAR Lasergene 10) Laboratory techniques in rabies Fifth edition 42 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences when PCR products are first cloned to improve yield or study viral heterogeneity. Hence, the material from which the genome sequence is derived must be reported when publishing viral genomes. In addition to single nucleotide polymorphisms (SNPs) which may occur naturally following passage of the virus in vitro or in vivo, errors or biases can be introduced into the generated sequences during the PCR or cloning processes (13). Multiple sequence anomalies have already been demonstrated between institutes due to differences in sequencing approaches or sample handling (14). Next-generation sequencing will highlight similar sequen- cing anomalies in published data and has the potential to indicate the presence and prevalence of viral heterogeneity (quasispecies) in the original infected mate- rial. Viral sequences which represent only a minor proportion of the viral pool may be amplified during PCR, cloning or passage and therefore be misrepresented as the consensus sequence by Sanger sequencing. PCR sequence biases may be reduced by performing replicate sequencing reactions from replicate PCR reac- tions rather than relying on a single PCR test. Where possible, viral sequences should be derived from the original host rather than using multiple in vitro or in vivo passaged material. All viral sequences must be published, particularly if included in a peer reviewed journal (e.g. NCBI Nucleotide http://www.ncbi.nlm.nih.gov/nucleotide/). For future submissions, we strongly recommend using the most recent version of the standardized sequence submission software, Sequin, obtained from the NCBI website (www.ncbi.nlm.nih.gov/projects/Sequin/), which will harmonize sequence submissions and encourage submitting laboratories to include all essential data, including collection date, virus species, host species and country of isolation. References 1. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463–7. PMID:271968. 2. Sacramento D, Bourhy H, Tordo N. PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol Cell Probes. 1991;5:229–40. PMID:1714538. 3. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 4. Johnson N, Letshwenyo M, Baipoledi EK, Thobokwe G, Fooks AR. Mole- cular epidemiology of rabies in Botswana: a comparison between antibody typing and nucleotide sequence phylogeny. Vet Microbiol. 2004;101:31–8. doi:10.1016/j.vetmic.2004.03.007. 5. Smith JS, Orciari LA, Yager PA, Seidel HD, Warner CK. Epidemiologic and historical relationships among 87 rabies virus isolates as determined by limited sequence analysis. J Infect Dis. 1992;166:296–307. PMID:1634801. Laboratory techniques in rabies Fifth edition 43 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences 6. Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Viro- logy. 1993;194:70–81. doi:10.1006/viro.1993.1236. 7. McElhinney LM, Marston DA, Freuling CM, Cragg W, Stankov S, Lalosevic D, et al. Molecular diversity and evolutionary history of rabies virus strains circulating in the Balkans. J Gen Virol. 2011;92:2171–80. doi:10.1099/ vir.0.032748-0. 8. Johnson N, McElhinney LM, Smith J, Lowings P, Fooks AR. Phylogenetic comparison of the genus Lyssavirus using distal coding sequences of the glycoprotein and nucleoprotein genes. Arch Virol. 2002;147:2111–23. 9. Tordo N, Poch O, Ermine A, Keith G, Rougeon F. Walking along the rabies genome: is the large G-L intergenic region a remnant gene? Proc Natl Acad Sci U S A. 1986;83:3914–8. PMID:3459163. 10. Tordo N, Poch O, Ermine A, Keith G, Rougeon F. Completion of the rabies virus genome sequence determination: highly conserved domains among the L (polymerase) proteins of unsegmented negative-strand RNA viruses. Viro- logy. 1988;165:565–76. 11. Marston DA, McElhinney LM, Johnson N, Müller T, Conzelmann KK, Tordo N, et al. Comparative analysis of the full genome sequence of European bat lyssa- virus type 1 and type 2 with other lyssaviruses and evidence for a conserved transcription termination and polyadenylation motif in the G-L 3’ non-trans- lated region. J Gen Virol. 2007;88:1302–14. doi:10.1099/vir.0.82692-0. 12. Delmas O, Holmes EC, Talbi C, Larrous F, Dacheux L, Bouchier C, et al. Genomic diversity and evolution of the lyssaviruses. PloS One. 2008;3:e2057. doi:10.1371/journal.pone.0002057. 13. Marston DA, McElhinney LM, Ellis RJ, Horton DL, Wise EL, Leech SL, et al. Next generation sequencing of viral RNA genomes. BMC Genomics. 2013;14:444. doi:10.1186/1471-2164-14-444. 14. McElhinney LM, Marston DA, Leech S, Freuling CM, van der Poel WH, Eche- varria J, et al. Molecular epidemiology of bat lyssaviruses in Europe. Zoo Publ Health. 2013;60:35–45. doi:10.1111/zph.12003. Laboratory techniques in rabies Fifth edition 44 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Chapter 30 The FTA sampling method for collecting, storing brain material and identification of lyssaviruses Introduction The Flinders Technology Associates (FTA) cards or FTA® (e.g. FTA Gene Guard System) is a commercial paper-based system designed to fix and store nucleic acids – DNA and RNA – directly on contact from fresh tissues pressed into the pre-treated paper. The cards that are impregnated with a chaotropic agent under a patented chemical formula lyse cell membranes and denature proteins on contact. Infectious pathogens on contact with such cards are rendered inactive, allowing a shipment of samples at ambient temperature through normal mail routes (1–3). The ability of the FTA paper to inactivate the infectivity of lyssaviruses when stored on the paper for 2 h at room temperature has been demonstrated previously (4). Cell inoculation tests were undertaken to assess the inactivation of rabies virus (RABV) in the FTA Guard System by testing elutes from the filter paper on neuroblastoma cells. Negative results of the cell culture inoculation test performed on 50 µL of elutes from the paper confirmed the inactivation of five tested lyssavirus species, placed onto the paper and treated after drying for 2 h at room temperature. FTA cards have been demonstrated to preserve nucleic acids within the fibre matrix, allowing molecular characterization of RABV isolates (4, 5). The protocol for sampling, storage and shipment of rabies suspect brain samples impregnated on FTA cards is described. Methods Reagents • indicating FTA card [GE HealthCare Life Sciences] • dessicant pack (silica gel) • sterile PBS 1x, pH 7.3 • RNase-free water • 0.2 mL PCR tubes and sterile tubes (15 mL, 2 mL, 1.5 mL) • pipettes and sterile tips Laboratory techniques in rabies Fifth edition 45 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Protocol Precautions must be taken to avoid cross-contamination and false–positive results by strictly following the typical routine precautions in PCR protocols in this manual. Always wear laboratory clothing when handling biological samples and FTA cards and regularly change gloves to avoid contamination of samples. Preparation of FTA stabilized suspect samples 1. Homogenize 1 g of suspect brain tissue in 5 mL of PBS 1x in a 15 mL sterile conical centrifuge tube. 2. Centrifuge for 15 min at 2000 x g. 3. Remove 40 µL of clarified supernatant for its application on the FTA card. 4. Lift the cover of the card (Fig. 30.1) to expose the white sample areas. 5. Drop 40 µL of clarified supernatant evenly onto the spot, within the sample area, in a concentric circular motion. 6. Dry the card impregnated with the sample at room temperature for 2 h. 7. When the card is completely dry, put the impregnated FTA card within a sealable protective pouch with desiccant packs to adsorb moisture. 8. Store the impregnated cards in a cool dry environment at −20 °C until use. 9. As the cards inactivate infectious pathogens and as samples containing nucleic acids are not covered by the regulations on the transport of dangerous goods, the cards can be shipped at ambient temperature through normal mail routes. Preparation of an FTA disc for RNA extraction 1. Cut half of the dried spot with a scalpel, then cut it with sterile scissors into little pieces of 2 mm x 2 mm. 2. Place the little pieces in a 2 mL DNase or RNase-free tube. 3. Add 500 µL of PBS 1x. Vortex thoroughly for 10 s. 4. Incubate for 2 h at 4 °C. 5. Centrifuge for 3 min at 20 000 x g. 6. Remove the eluate by pipetting and transfer it to a new DNase or RNase-free tube; store the tube at 4 °C until RNA extraction, as described in the manual, depending upon the specific test. A representative agarose gel of the amplicons (1520-bp) produced by nested RT-PCR using two RABV isolates with, respectively, rabies primers JW12 and PVN8 followed by M13-JW12 and M13-PVN8bis, is shown in Fig. 30.2. Laboratory techniques in rabies Fifth edition 46 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences B y co ur te sy o f A N S ES , M al zé vi lle , F ra nc e Fig. 30.1. Sample Whatman FTA® cards FTA, Flinders Technology Associates B y co ur te sy o f A N S ES , M al zé vi lle , F ra nc e Fig. 30.2. Example of the amplification of the full nucleoprotein gene from two FTA® stabilized rabies virus samples; the RT-PCR was performed on 5 µL of viral RNA with primers JW12 and PVN8 followed by a second round of amplification with M13-JW12 and M13-PVN8bis, giving an amplicon of 1520-bp bp, base pair; RT-PCR, reverse transcriptase polymerase chain reaction Laboratory techniques in rabies Fifth edition 47 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Discussion The chemical reagents impregnated in the FTA cards inactivate most pathogens and nucleases. The ability of the cards to inactivate the infectivity of RABV when stored on the paper for 2 h at room temperature has been demonstrated, as described (4). These cards have been demonstrated to preserve RABV RNA within the fibre matrix by conventional RT-PCR (6–8). Specimens for rabies diagnosis should be shipped within the UN3373 classi- fication (category B) with triple packaging to avoid any exposure hazards; for the RABV culture, category A transport practices should be applied (UN2814 classifi- cation). To achieve reliable diagnostic results, the specimen should be preserved by freezing during transport to the laboratory for rabies diagnosis. The result of RABV inactivation is that the stabilized FTA sample is no longer infectious and, subsequently, it can be shipped through normal mail routes for research studies. The advantages of FTA sampling have been demonstrated for the mole- cular characterization of RABV-infected samples with the amplification of partial nucleoprotein gene by conventional RT-PCR (4, 6, 8) as well as for the detection of numerous other infectious viruses, including Newcastle disease virus (3), infec- tious bronchitis virus (9, 10) or avian influenza virus (11). Laboratory techniques in rabies Fifth edition 48 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences References 1. Whatman. FTATM Nucleic Acid Collection, Storage and Purification. http://www. whatman.com/FTANucleicAcidCollectionStorageandPurification.aspx 2013. 2. Abdelwhab EM, Luschow D, Harder TC, Hafez HM. The use of FTA® filter papers for diagnosis of avian influenza virus. J Virol Methods. 2011;174:120–2. doi:10.1016/j.jviromet.2011.03.017. 3. Perozo F, Villegas P, Estevez C, Alvarado I, Purvis LB. Use of FTA filter paper for the molecular detection of Newcastle disease virus. Avian Pathol. 2006;35:93–8. doi:10.1080/03079450600597410. 4. Picard-Meyer E, Barrat J, Cliquet F. Use of filter paper (FTA) technology for sampling, recovery and molecular characterisation of rabies viruses. J Virol Methods. 2007;140:174–82. PMID:17157394. 5. Goharriz H, Marston DA, Sharifzoda F, Ellis RJ, Horton DL, Khakimov T, et al. First complete genomic sequence of a rabies virus from the Republic of Tajikistan obtained directly from a Flinders Technology Associates Card. Genome announcements. 2017;5:e00515-17 . doi:10.1128/genomeA.00515- 17. 6. Zeynalova S, Shikhiyev M, Aliyeva T, Ismayilova R, Wise E, Abdullayev R, et al. Epidemiological characteristics of human and animal rabies in Azerbaijan. Zoonoses Public Health. 2015;62:111–8. doi:10.1111/zph.12119. 7. Traore A, Picard-Meyer E, Mauti S, Biarnais M, Balmer O, Samake K, et al. Molecular characterization of canine rabies virus, Mali, 2006–2013. Emerg Infect Dis. 2016;22(5):866–70. doi:10.3201/eid2205.150470. 8. Nadin-Davis SA, Sheen M, Wandeler AI. Recent emergence of the Arctic rabies virus lineage. Virus Res. 2012;163:352–62. doi:10.1016/j. virusres.2011.10.026. 9. Moscoso H, Alvarado I, Hofacre CL. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 2006;50:391–6. PMID:17039839. 10. Ganapathy K, Ball C, Forrester A. Genotypes of infectious bronchitis viruses circulating in the Middle East between 2009 and 2014. Virus Res. 2015;210:198–204. doi:10.1016/j.virusres.2015.07.019. 11. Keeler SP, Ferro PJ, Brown JD, Fang X, El-Attrache J, Poulson R, et al. Use of FTA sampling cards for molecular detection of avian influenza virus in wild birds. Avian Dis. 2012;56:200–7. doi: 10.1637/9862-072611-Reg.1. Laboratory techniques in rabies Fifth edition 49 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Chapter 31 Application of next generation sequencing to rabies virus and other lyssaviruses Introduction Next generation sequencing (NGS) has revolutionized the ability to determine nucleic acid sequence by offering the unprecedented capacity to parallelize the sequencing reaction, allowing the generation of thousands-to-many-millions of short sequence fragments 70–800 base pairs (bp) in length (so-called “reads”), each reflecting individual input molecules. In contrast to the Sanger-based method, NGS instruments conduct sequencing and detection simultaneously, without the need for cloning steps or electrophoresis, the base interrogation being performed cyclically and in parallel. Since the advent of NGS, different platform formats have been developed, based on various approaches which have been extensively described elsewhere (1–5). Briefly, two different main categories exist: short-read and long-read sequen- cing. Short-read sequencing includes two main strategies, namely sequen- cing by ligation (for example ABI SOLiD-Life Technologies) and sequencing by synthesis (for example Illumina, Ion Torrent [Life Technologies] and Roche 454 [Roche Diagnostics]) platforms; the latter is no longer commercially available. This short-read sequencing category requires a clonal amplification step of the library to be able to obtain sufficient signal intensity for detection. The long-read category, which does not require any amplification steps, mainly corresponds to single-molecule sequencing platforms (i.e. Helicos [Helicos Biosciences], which is no longer commercially available, PacBio [Pacific Biosciences] and MinION/ GridION systems [Oxford Nanopore]). Similar to Sanger sequencing in its time, NGS methods have revolutionized biological research in various fields, including virology, and their impact is evident in the areas of genome sequencing, evolution, ecology, discovery and transcripto- mics (6). Application of these approaches is emerging in the field of lyssaviruses, and appears promising. Indeed, NGS enables researchers to obtain full-length genome sequences of rabies virus (RABV) or other lyssaviruses with low time and high cost effectiveness. This represents a major improvement at the level of the molecular characterization of each individual viral strain previously detected by reference diagnosis methods, including new lyssavirus species, but also to reach the highest level of resolution and robustness for any (spatiotemporal) phyloge- netic analysis, compared with those traditionally performed on a limited region of the virus genome. The massive number of sequence reads obtained for an individual isolate also offers the opportunity to investigate the viral intrinsic diver- sity (viral heterogeneity) previously hidden behind the consensus sequence (7). As this is a rapidly developing field, it is important to keep in mind that multiple variations of protocols to obtain full-length genome sequences of RABV or other lyssaviruses exist and that NGS methodologies are continuously evolving. Laboratory techniques in rabies Fifth edition 50 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences This chapter describes the main steps required to obtain genome sequences by NGS from sample preparation to bioinformatics analysis, illustrated with examples of protocols or methodologies which have been demonstrated to be effective for lyssaviruses. The Illumina-based sequencing remains the most widely used NGS sequen- cing approach in the area of virology, including in the rabies field. Consequently, this chapter will mostly focus on this methodology, although most of the sections can be transposable to other sequencing platforms. Methodology Preparation of samples The preparation of samples is a key step influencing the quality of the genome sequence which will be generated after NGS analysis. This section proposes diffe- rent protocols that are independent of whether specific or unspecific amplification is subsequently performed. These protocols can be applied to clinical samples such as human and animal brain tissues, human saliva or skin biopsies, or from viruses propagated in cell lines. They can also be applied to inactivated viral RNA material such as FTA cards or LFD strips. Protocol based on specific amplicon amplification This protocol is based on the use of primers which overlap and cover nearly the full-length genome of RABV (or other lyssavirus) isolates (8). The choice and the design of the primers as well as the number of primer pairs necessary will vary according to the isolates to be sequenced. Generally, six primer pairs are suffi- cient to cover the nearly complete genome (except the extremities), with amplicon lengths ranging from approximately 1500 to 2500 bp (base pairs). The primers can be degenerated to cover as much as possible the genetic diversity within the respective lyssavirus species, or within the corresponding specific phylogenetic clades or lineages. This approach is most effective when highly related viruses are being analysed, for example analysis of a rabies virus incursion or of viruses from the same geographical area, as the need for primer optimization will be less likely (9). RNA extraction The RNA extraction step is based on the use of TRIzol, following the manufac- turer’s recommendations (also presented in Chapter 27 on conventional RT-PCR). For skin biopsies, a preliminary step of lysis using proteinase-K is required before extraction. Extracted RNA are resuspended in 50 µL of RNase–DNase-free water for all samples. Laboratory techniques in rabies Fifth edition 51 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Generation of cDNA Step Reagent Volume per reaction (µL) Mix 1: pre-incubation (10 min at 70 °C), then place on ice at least 5 min before adding mix 2 pd(N)6 random primers (200 µg/mL) [Roche Diagnostics] 2 RNase–DNase-free water 2 RNA template 6 Total 10 Mix 2: incubation (10 min at 25 °C then 90 min at 50–55 °C followed by 5 min at 95 °C) 5X first-strand buffer 6 0.1 M DTT 2 dNTP mix (10 mmol) [Eurobio] 2 RNasin (40 U/µL) [Promega] 2 Superscript III RT (200 U/μL) 1 RNase–DNase-free water 7 Total 20 Final volume 30 In this protocol, this step is performed with SuperScript® III First-Strand Synthesis System for RT-PCR kit [Invitrogen], although various other commercial kits are available. All reagents are provided with the kit unless otherwise specified. Prepare the master mix as follows: The cDNA samples can be used directly for PCR amplification or conserved at −20 °C for long-term storage. PCR amplification This step requires the use of a high-fidelity proofreading DNA polymerase (e.g. Phusion High-Fidelity DNA Polymerase [Finnzymes] in this protocol) to mini- mize the introduction of errors during the amplification process. Nested PCR should be avoided for the same reason. All reagents are provided with the kit unless otherwise specified. Prepare the following master mix Reagent Volume per reaction (µL) 5X Phusion® HF buffer 10 10 mmol dNTPs (Thermo Scientific) 1 Forward primer (10 mmol) 2.5 Reverse primer (10 mmol) 2.5 Phusion® DNA polymerase 0.5 RNase-DNase free water 31.5 Total 48 Laboratory techniques in rabies Fifth edition 52 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Add 2 µL of cDNA and run the amplification with the following cycling parameters: Cycling step Temperature Time Number of cycles Initial denaturation 98 °C 30 s 1 Amplification 98 °C 10 s Determined by prim- ers used Determined by primers used 30 s 72 °C To be adapted Final elongation 72 °C 7 min 1 Pending 16 °C ∞ n/a The temperature of the annealing step as well as the time of elongation and the number of cycles must be adjusted according to the primers selected. Purification and preparation of amplicons Visualization of the amplified products after PCR is performed by electro- phoresis on agarose gel (1% generally, according to the size of amplicons). Verify the size of the observed band compared with the expected size of the amplicon using appropriate DNA size markers. Individually purify each amplicon directly for the electrophoresis gel using an appropriate gel purification kit (such as NucleoSpin Gel and PCR clean-up kit [Macherey Nagel]) according to the manufacturer’s recommendations. Quantify the purified amplicon using a fluorescence-based approach (e.g. Quant-iT PicoGreen dsDNA Assay Kit [Invitrogen]), according to the manufactu- rer’s recommendations. Pool all amplicons from the sample with equimolar proportions to obtain at least 1 ng of dsDNA and either use to prepare the NGS library, or conserve for long term storage at −20 °C. Protocol based on unbiased non-specific amplification Different protocols are available for the nonspecific amplification of genetic material. The protocol described below is based on the use of the whole-transcrip- tion amplification (WTA) protocol (QuantiTect Whole Transcriptome kit [Qiagen]) as previously described (10–12). This kit uses phi29 polymerase to generate large quantity of dsDNA from a low quantity of RNA. This protocol was successfully applied for the generation of complete genome sequences of EBLV-1 lyssaviruses. Laboratory techniques in rabies Fifth edition 53 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences RNA extraction After resuspension of the RNA pellet in 50 µL of RNase–DNase-free water, a purification step is performed (using RNeasy® mini kit [Qiagen]) and the corres- ponding cleaned-up protocol. Purified RNA is eluted in a final volume of 30 µL of RNase–DNase-free water. cDNA synthesis The final volume of cDNA is 20 μL. Unbiased nonspecific amplification Prepare the following master mix 1 on ice, add 10 μL of cDNA and incubate 22 °C for 2 h: Reagent Volume per reaction (µL) Ligation buffer 6 Ligation reaction 2 Ligation enzyme 1 1 Ligation enzyme 2 1 Total 10 Final (with cDNA) 20 Then prepare the following master mix 1 on ice, add all the previous 20 μL of ligated cDNA from mix 1 and incubate at 30 °C for 8 h, then at 95 °C for 5 min: Reagent Volume per reaction (µL) REPLI-g midi reaction buffer 29 REPLI-g midi DNA polymerase 1 Total 30 Final (with cDNA) 50 Store at 4 °C for short-term storage or at −20 °C for long-term storage. Protocol based on host nucleic-acid depletion without amplification steps Different protocols are available for the preparation of RNA for next genera- tion sequencing without the use of specific or non-specific amplification steps. Instead, these protocols are based on the removal of host nucleic acid using enzymatic depletion of host DNA and ribosomal RNA (rRNA). These protocols have been validated to the full-length genome sequencing of lyssaviruses directly from clinical or murine propagated samples (brain), and on cell culture propagated viruses (13), or even from other matrices such as FTA cards (14). Laboratory techniques in rabies Fifth edition 54 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences RNA extraction and host DNA depletion As previously described above (and presented also in Chapter 27 on conven- tional RT-PCR), extraction of total RNA can be performed using guanidinium isothiocyanate-phenol-chloroform-based extraction methods (e.g. TRIzol) or commercial column-based extraction kits (e.g. RNeasy Mini Kit [Qiagen]) following manufacturer’s recommendations, depending on the initial biological material. However, it is essential when sequencing samples that have not been selectively amplified that carrier RNA is not used in any part of the process. In addition, both of these approaches can be combined, as described: 1. Start total RNA extraction using TRIzol and follow the manufacturer’s recom- mendations until the phase separation step (obtained after addition of chloro- form and centrifugation). 2. Collect the upper aqueous phase in a separated tube and add an equal volume of 100–70% ethanol. 3. Continue the extraction using columns from the RNeasy Mini Kit through the loading of the sample (aqueous phase supplemented with 70–100% ethanol) onto the membrane of the column, then follow the manufacturer’s recommen- dations (split the volume and proceed to successive loading and centrifugation steps to ensure to load all the sample). In this protocol, choose to perform an on-column DNase I treatment (using RNase-free DNase set [Qiagen]) to eliminate as much as possible host DNA (after an incubation of 15 min at room temperature). Eluate the RNA in a final volume of 30 μL nuclease (RNase– DNase)-free water. rRNA depletion Different protocols are available for the specific depletion of rRNA. This deple- tion can be performed with a 5’-phosphate-dependent exonuclease that specifi- cally targets single stranded RNA with a 5’ monophosphate, including large rRNA such as 18S and 28S (e.g. Terminator™ 5’-Phosphate-Dependent Exonuclease [Epicentre Biotechnologies] (13)). This approach is not limited to host species. Another strategy uses a selective RNase H-based digestion to deplete unwanted RNA (including poly(rA) carrier and ribosomal RNA) from the viral RNA sample, based on specific oligonucleotides targeting rRNA. This protocol can be performed using commercial kits (e.g. NEBNext® rRNA Depletion Kit [New England Biolabs]), although they had been initially designed for a limited number of specific mamma- lian species (generally human, rat or mouse); however, in-house implementation of this protocol can be done (15), and specifically adapted to other animal hosts. Other commercial kits (e.g. Ribo-Zero-Gold (Epidemiology) Kit [Illumina] for rRNA depletion) are based on specific oligonucleotides coated on magnetic beads, hence avoiding the use of enzymes. The latter kit covers a wide range of applica- tion beyond the three initially designed species (human, mouse and rat), at least in silico (including dog) or after being used in large studies (16). The main drawbacks of all these commercial kits are the high cost per reaction as well as the relative specificity of host species of such reagents. These latter approaches have been successfully used with RNA viruses (15) and are under investigation with lyssa- viruses. However, only the protocol based on the Terminator™ 5’-Phosphate-De- pendent Exonuclease already used for lyssaviruses will be described here. Laboratory techniques in rabies Fifth edition 55 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Prepare the following master mix and incubate at 30 °C for 60 min. All reagents are provided with the kit unless otherwise specified. Reagent Volume per reaction (µL) RNA template 30 Buffer A 3.5 Terminator (1 U/μL) 1 RNAsin® ribonuclease inhibitor (20–40 U/μL) [Promega] 0.5 Total 35 Clean up using RNA solid phase reversible immobilization (SPRI) beads (Agen- court RNAClean XP SPRI beads [Beckman Coulter Genomics]) following the manufacturer’s recommendations or using the RNeasy Mini Kit without DNase digestion. Elute with 11 μL or 30 μL of RNase–DNase-free water, respectively. cDNA synthesis Use a volume of 8 μL of DNA–rRNA depleted RNA, to obtain a final volume of cDNA of 20 μL. Second-strand synthesis (15) This step can be also directly included in the library step, depending on the protocol used. Prepare the following master mix on ice: Reagent Volume per reaction (µL) RNase–DNase-free water 43 10x second-strand reaction buffer [New England Biolabs] 8 10 mmol dNTP mix [Eurobio] 3 E. coli DNA Ligase (10 U/μL) [New England Biolabs] 1 E. coli DNA Polymerase I (10 U/μL) [New England Biolabs] 4 E. coli RNase H (2 U/μL) [New England Biolabs] 1 1st strand reaction 20 Total volume 80 1. Add all the volume of cDNA (20 μL), vortex gently and centrifuge at 280 x g at room temperature for 1 min. Incubate for 2 h at −16 °C (keep lid at 25 °C) without allowing the temperature to rise above 16 °C. 2. Place the tubes on ice and inactivate reaction by adding 5 μL of 0.5 mol EDTA, mix gently and centrifuge at 280 x g at RT for 1 min. Laboratory techniques in rabies Fifth edition 56 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences 3. Clean up using DNA SPRI beads (Agencourt AMPure XP SPRI beads [Beckman Coulter Genomics]) following the manufacturer’s recommendations. Elute in a small volume (e.g. 9 μL RNase–DNAse-free water). Preparation of libraries The choice of the library preparation depends on several parameters, inclu- ding the choice of NGS platform and the amount of input of nucleic acid avai- lable. These aspects have been extensively described elsewhere (17, 18) and can also be found from the respective manufacturers. However, the main general steps are mostly similar and correspond to: (i) fragmenting and/or sizing the target nucleic acid to a desired length (mechanically or enzymatically-based); (ii) converting the target to dsDNA (this step can also be performed upstream, as described previously); (iii) attaching oligonucleotide adapters (to the ends of target fragments) that contain the necessary elements for immobilization on a solid surface and sequencing; (iv) amplification of the library; and (v) quantifying the final library product for sequencing. The level of multiplexing (i.e. the number of different tagged samples sequencing simultaneously) is also dependant on the library preparation. Depending on the choice in library preparation and in NGS platform, the format of the data generated after sequencing will vary, in terms of read length (generally from 100 bp to 350 bp [for Illumina technology]) and number of sequence reads (from several thousand to millions) and therefore in terms of sequence depth and percentage of genome coverage (see below). From a practical point of view, this preparation is mainly based on commer- cial kits according to the manufacturer’s recommendations and adapted to the respective sequencing platform, bearing in mind the technologies are regularly being updated and improved. In the field of rabies, several different protocols have been described; the most recent is associated with the Illumina technology (8, 13, 19), but will not be detailed in this chapter. However, optimization of library preparation may be necessary for DNA fragmentation and minimization of puri- fication steps in order to reduce sample loss and prevent cross-contamination. Bioinformatics analysis The bioinformatics process to obtain RABV and other lyssavirus genome consensus sequences is general to those used for other viruses and is broadly similar whatever the NGS platform used. The first step of this process is the cleaning of raw sequence (reads) data using adapted and validated parame- ters of quality control. Then the construction of the viral consensus sequence is performed, based on the mapping of the high-quality reads against a selected reference sequence. This consensus sequence is finally controlled and validated after a second mapping or a de novo assembling step. Cleaning of raw sequence data Raw sequence reads need to be pre-processed before use for subsequent genome sequence reconstruction in order to select only high-quality reads after filtering. Various parameters must be taken into account and adjusted for this process, all of which are relatively common irrespective of the NGS platforms considered. The first step is to eliminate adapter sequences (used during library preparation) and (if using amplicon-based sequencing) primer sequences. The other parameters are primarily based on the quality (through the Phred quality Laboratory techniques in rabies Fifth edition 57 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences score) associated with each individual base, and on the length of individual reads. For example, bases at either end of each read with a Phred quality score below a selected value are trimmed, and reads with length of less than another selected value after these processing steps are discarded, as well as those containing more than a specific proportion of low Phred quality score bases. Various work- flows for this pre-processing step are available (free of access or combined with specific software) and can be found in the literature (8, 19). Consensus sequence reconstruction After high-quality filtering of sequence reads, the reconstruction of the viral consensus sequence is based on a mapping approach. The principle is to try to position each read, according to specific parameters, to a reference full-length genome sequence which is as similar as possible to the expected sequence. In the field of lyssaviruses, the choice of this reference sequence could rely on the source of the virus isolate, i.e. its principal animal reservoir and the availabi- lity of already published complete genomes, etc. After this mapping step, a first consensus sequence is obtained and will serve as the new reference sequence for a second mapping step, using all the filtered reads, to obtain a final refined consensus sequence (8). Alternatively, the mapped reads can be used to perform a de novo assembly to generate a consensus sequence which can then be used as the new reference sequence for a last mapping step using all the filtered reads to generate the final consensus sequence (19). The majority nucleotide (> 50%) at each position, provided there is sufficient coverage, is generally used to gene- rate the consensus sequence. Various mapper and de novo assembler programs exist and are described elsewhere; they must be tested and adapted before use. A minimum mean coverage is necessary to obtain a reliable consensus genome sequence (see discussion section below), and sequence assembly should be visually inspected using appropriate software to evaluate the coverage along the genome sequence, at the level of each individual base. Additional information can also be obtained from the data generated by NGS sequencing. In particular, and depending on the average coverage (the “depth” of the sequence or the number of reads covering each nucleotide position), these NGS technologies offer the possibility (i) to determine the minority single nucleo- tide polymorphism (SNP) at each nucleotide position, after a specific percen- tage cut-off has been defined, and (ii) to explore the intrinsic diversity for each isolate (9, 20). Such analysis requires a coverage rate of hundreds to thousands of reads per base, as the highest resolution and reliability in terms of intrinsic diver- sity is associated with the greatest coverage obtained. For viruses that are divergent from known viruses (or where a full reference genome is not available) a difference approach is required, as described (21, 22). In such cases, after high-quality filtering of raw data, host sequences should be removed by mapping to a suitable host genome. Subsequently, the remaining non-host reads can be used for de novo assembly, and BLAST is used to find assembled contigs that correspond to viral genomes. Mapping can then be used as described above to ensure the accuracy of the consensus sequence. Laboratory techniques in rabies Fifth edition 58 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Discussion This chapter presents several examples of different protocols already used and validated for the preparation of RABV and other lyssaviruses for NGS sequen- cing, and summarizes how to analyse the output data and generate a consensus genome sequence, mainly based on Illumina technology (which is currently the most widely used NGS platform). Special focus is given to the preparation of samples for NGS sequencing using three different strategies each with their own pros and cons. The first strategy, the amplicon-based protocol, provides homogeneous, deep coverage of the genome sequence of each sample, because the genetic mate- rial sequenced is exclusively viral. This approach is best adapted to obtain the consensus genome sequence relatively similar to a known sequence. The high depth of coverage permits the investigation of the intrinsic diversity at a low level. However, this must be interpreted with care as the amplification may have skewed the relative abundance of the minority variants, and errors may have been intro- duced by the amplification step, although they can be compensated for or mini- mized with the use of a high proof-reading DNA polymerase. The main disad- vantage of this method is the cost, both in the researcher’s time (in continued designing and optimizing of the primers) and in the reagents used. The second strategy is based on an unbiased nonspecific amplification of the extracted RNA, using for example a whole transcriptome amplification. The main advantage of this approach is to obtain a huge quantity of genetic material, espe- cially when working with precious and quantity-limited biological materials (e.g. with human CSF samples or saliva swabs), adapting to sequencing protocols requesting a large quantity of dsDNA or when additional tests are requested on starting material (e.g. RT-qPCR). In addition, because this protocol is nonspecific it can be used for any lyssaviruses or indeed any virus. Similar to the previous protocol, one of the main disadvantages, although unlikely, is the potential intro- duction of errors during the amplification steps. Furthermore, as the amplification is nonspecific, the amount of viral RNA remains proportionally low in relation to host RNA. The third strategy does not rely on any amplification but on the depletion of host RNA to increase the proportion of viral or host RNA in the samples to be submitted. This method addresses the disadvantages of the other approaches as there is no amplification, and it can be used to sequence any lyssavirus or virus. Depletion of host nucleic material is utilized to increase the proportion of viral RNA present, but will mean that there is generally limited input material. This can be mitigated by using a sequencing library kit that requires minimal input mate- rial (e.g. commercially available [Illumina NexteraXT]). However, in clinical tissue samples the percentage of reads that are viral is still low (usually < 5%), but a reliable consensus sequence can be obtained even with a relatively low cove- rage (see below). The low coverage occasionally results in an incomplete genome sequence, and can be less suitable for investigating the genetic intrinsic diversity, especially at a low level. Despite their differences, all protocols have been used to obtain the complete genome sequence of RABV and other lyssavirus isolates, or at least the complete coding regions (the genome extremities with the leader and the trailer regions Laboratory techniques in rabies Fifth edition 59 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences often absent or having low coverage for all of these approaches). However, the quality and the reliability of the consensus sequence obtained remain associated with the average depth of the coverage as well as with the number of reads per nucleotide position (this number varying along the genome sequence). In this context, it is essential at least to visualize and inspect the depth of coverage along the genome, particularly through adapted software and at least through a coverage graph, as well as to evaluate the proportion of each per nucleotide position (especially for positions or regions associated with very low coverage). For novel viruses, Sanger sequencing of PCR amplicons spanning low coverage regions, followed by remapping of NGS reads with the corrected consensus, may be required to confirm the sequence. However, it is very important to bear in mind that the methods used in NGS sequencing are constantly evolving, whether at the level of platforms, the prepa- ration of samples or the tools applied for data analysis. Before implementing this sequencing approach, it is necessary to ensure that the choice of the methodo- logy is cost effective and adapted to the needs and expected outcomes and to ensure that all steps have been validated, to be confident in the data generated. In parallel, remaining vigilant to the development of the methodology is recom- mended. The recent advent of NGS sequencing technologies has revolutionized various fields of biological sciences, including microbiology and virology in particular. One of the major impacts in the field of virology is observed with molecular epide- miological analysis. Indeed, NGS platforms offer the possibility to obtain rapidly and cost effectively the complete genome sequences of any virus compared with previous methods based on Sanger sequencing. In this context, NGS sequencing allows a complete molecular characterization of new isolates or lyssavirus species based on the complete genome sequence (21, 22) essential for the official valida- tion of new virus species, and represents now a useful tool for the quality control of viral vaccine strains found in live vaccines strains used for rabies vaccination in wildlife (7, 23). In parallel, the dramatic increase of genetic information available for each isolate enables more accurate and precise molecular epidemiological and phylogenetic analysis. Various recent examples illustrate this progress, especially with the 2014–2015 outbreak of Ebola virus infection in West Africa (24–26). In the rabies field, NGS has also been utilized to obtain full-length genome sequences which, combined with associated epidemiological data (such as animal host, location and date of collec- tion), already allows refined details to be obtained using phylogenomic analysis on the evolutionary history of lyssaviruses (27), as well as large-scale analysis of RABV (8) for a specific phylogenetic lineage (19) or for a specific geographical location. In addition, molecular analysis of complete genome sequences, at the level of the consensus sequence or at the level of the intra-host genetic diver- sity, provides important data to understand the cross-species transmission and mechanisms of new host adaptation frequently observed with RABV (8, 9). As the cost associated with NGS sequencing is reducing and protocols are becoming standardized, it is now evident that the widespread use of this sequen- cing approach will significantly improve our capacity to understand the drivers of transmission (28), providing important data for the prevention and control of rabies. Laboratory techniques in rabies Fifth edition 60 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences References 1. van Dijk EL, Auger H, Jaszczyszyn Y, Thermes C. Ten years of next-genera- tion sequencing technology. Trends Genet. 2014;30:418–26. doi:10.1016/j. tig.2014.07.001. 2. Mardis ER. Next-generation sequencing platforms. Annu Rev Anal Chem (Palo Alto Calif). 2013;6:287–303. doi:10.1146/annurev-anchem-062012-092628. 3. Mardis ER. DNA sequencing technologies: 2006–2016. Nat Protoc. 2017;12:213–8. doi:10.1038/nprot.2016.182. 4. Metzker ML. Sequencing technologies – the next generation. Nat Rev Genet. 2010;11:31–46. doi:10.1038/nrg2626. 5. Goodwin S, McPherson JD, McCombie WR. Coming of age: ten years of next-generation sequencing technologies. Nat Rev Genet. 2016;17:333–51. doi:10.1038/nrg.2016.49. 6. Radford AD, Chapman D, Dixon L, Chantrey J, Darby AC, Hall N. Applica- tion of next-generation sequencing technologies in virology. J Gen Virol. 2012;93:1853–68. doi:10.1099/vir.0.043182-0. 7. Hoper D, Freuling CM, Muller T, Hanke D, von Messling V, Duchow K, et al. High definition viral vaccine strain identity and stability testing using full-ge- nome population data – The next generation of vaccine quality control. Vaccine. 2015;33:5829–37. doi:10.1016/j.vaccine.2015.08.091. 8. Troupin C, Dacheux L, Tanguy M, Sabeta C, Blanc H, Bouchier C, et al. Large-scale phylogenomic analysis reveals the complex evolutionary history of rabies virus in multiple carnivore hosts. PLoS Pathog. 2016;12:e1006041. doi:10.1371/journal.ppat.1006041. 9. Borucki MK, Chen-Harris H, Lao V, Vanier G, Wadford DA, Messenger S, et al. Ultra-deep sequencing of intra-host rabies virus populations during cross-species transmission. PLoS Negl Trop Dis. 2013;7:e2555. doi:10.1371/ journal.pntd.0002555. 10. Dacheux L, Berthet N, Dissard G, Holmes EC, Delmas O, Larrous F, et al. Application of broad-spectrum resequencing microarray for genotyping rhabdoviruses. J Virol. 2010;84:9557–74. doi: 10.1128/JVI.00771-10. 11. Dacheux L, Cervantes-Gonzalez M, Guigon G, Thiberge JM, Vandenbogaert M, Maufrais C, et al. A preliminary study of viral metagenomics of French bat species in contact with humans: identification of new mammalian viruses. PLoS One. 2014;9:e87194. doi:10.1371/journal.pone.0087194. 12. Joffret ML, Bouchier C, Grandadam M, Zeller H, Maufrais C, Bourhy H, et al. Genomic characterization of Sebokele virus 1 (SEBV1) reveals a new candi- date species among the genus Parechovirus. J Gen Virol. 2013;94:1547–53. doi:10.1099/vir.0.053157-0. 13. Marston DA, McElhinney LM, Ellis RJ, Horton DL, Wise EL, Leech SL, et al. Next generation sequencing of viral RNA genomes. BMC Genomics. 2013;14:444. doi:10.1186/1471-2164-14-444. 14. Goharriz H, Marston DA, Sharifzoda F, Ellis RJ, Horton DL, Khakimov T, et al. First complete genomic sequence of a rabies virus from the Republic Laboratory techniques in rabies Fifth edition 61 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences of Tajikistan obtained directly from a Flinders Technology Associates card. Genome Announc. 2017;5 e00515-17. doi:10.1128/genomeA.00515-17. 15. Matranga CB, Gladden-Young A, Qu J, Winnicki S, Nosamiefan D, Levin JZ, et al. Unbiased deep sequencing of RNA viruses from clinical samples. J Vis Exp. 2016;113. doi:10.3791/54117. 16. Shi M, Lin XD, Tian JH, Chen LJ, Chen X, Li CX, et al. Redefining the inverte- brate RNA virosphere. Nature. 2016;540:539–43. doi:10.1038/nature20167. 17. Head SR, Komori HK, LaMere SA, Whisenant T, Van Nieuwerburgh F, Salomon DR, et al. Library construction for next-generation sequencing: overviews and challenges. Biotechniques. 2014;56:61–4, 6, 8, passim. doi:10.2144/000114133. 18. van Dijk EL, Jaszczyszyn Y, Thermes C. Library preparation methods for next-generation sequencing: tone down the bias. Exp Cell Res. 2014;322:12– 20. doi:10.1016/j.yexcr.2014.01.008. 19. Hanke D, Freuling CM, Fischer S, Hueffer K, Hundertmark K, Nadin-Davis S, et al. Spatio-temporal analysis of the genetic diversity of Arctic rabies viruses and their reservoir hosts in Greenland. PLoS Negl Trop Dis. 2016;10:e0004779. 20. Borderia AV, Stapleford KA, Vignuzzi M. RNA virus population diversity: implications for inter-species transmission. Curr Opin Virol. 2011;1:643–8. doi:10.1371/journal.pntd.0004779. 21. Marston DA, Ellis RJ, Horton DL, Kuzmin IV, Wise EL, McElhinney LM, et al. Complete genome sequence of Ikoma lyssavirus. J Virol. 2012;86:10242–3. doi:10.1128/JVI.01628-12. 22. Marston DA, Ellis RJ, Wise EL, Arechiga-Ceballos N, Freuling CM, Banyard AC, et al. Complete genome sequence of Lleida bat lyssavirus. Genome Announc. 2017;5:e01427-16. doi:10.1128/genomeA.01427-16. 23. Cliquet F, Picard-Meyer E, Mojzis M, Dirbakova Z, Muizniece Z, Jaceviciene I, et al. In-depth characterization of live vaccines used in Europe for oral rabies vaccination of wildlife. PLoS One. 2015;10:e0141537. doi:10.1371/journal. pone.0141537. 24. Carroll MW, Matthews DA, Hiscox JA, Elmore MJ, Pollakis G, Rambaut A, et al. Temporal and spatial analysis of the 2014–2015 Ebola virus outbreak in West Africa. Nature. 2015;524:97–101. doi:10.1038/nature14594. 25. Dudas G, Carvalho LM, Bedford T, Tatem AJ, Baele G, Faria NR, et al. Virus genomes reveal factors that spread and sustained the Ebola epidemic. Nature. 2017;544:309–15. doi:10.1038/nature22040. 26. Holmes EC, Dudas G, Rambaut A, Andersen KG. The evolution of Ebola virus: insights from the 2013–2016 epidemic. Nature. 2016;538:193–200. doi:10.1038/nature19790. 27. Hayman DT, Fooks AR, Marston DA, Garcia RJ. The global phylogeography of lyssaviruses – challenging the “Out of Africa“ Hypothesis. PLoS Negl Trop Dis. 2016;10:e0005266. doi:10.1371/journal.pntd.0005266. 28. Dellicour S, Rose R, Faria NR, Vieira LFP, Bourhy H, Gilbert M, et al. Using viral gene sequences to compare and explain the heterogeneous spatial dynamics of virus epidemics. Mol Biol Evol. 2017;34:2563–71. doi:10.1093/molbev/msx176. Laboratory techniques in rabies Fifth edition 62 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Chapter 32 Reverse transcriptase loop-mediated isothermal amplification system for the detection of rabies virus Introduction Innovative loop-mediated isothermal amplification (LAMP) (1,2) provides a rapid, simple, sensitive and inexpensive method for amplifying specific DNA sequences. The technique was first demonstrated in 2000 (3). LAMP depends on the autocy- cling of strand-displacement DNA synthesis conducted by Bst DNA polymerase. This reaction proceeds without denaturation of DNA templates (4) and thus can be performed at an isothermal temperature. It provides high amplification efficiency with DNA being amplified 109–1010 times in 15–60 min. The amplified products consist of a series of stem-looped DNA in various lengths (5). The results can be determined by visual inspection of the turbidity due to precipitation of white magnesium pyrophosphate, a byproduct of DNA synthesis (6), or by visual and ultraviolet (UV) inspection of DNA amplification with a fluorescent dye (7). For the amplification of target RNA, the RT (reverse transcriptase) LAMP method can synthesize cDNA from target RNA and the LAMP technology applied to amplify the resultant cDNA. After mixing and incubating at a constant tempe- rature between 60 °C and 65 °C, amplification and detection can be carried out in a single step. The RT-LAMP method has potential application for detection of pathogens and has been developed for the diagnosis of many RNA viral diseases. For rabies virus (RABV), several examples of the application of this method have been reported (8–13). Materials Reagents • AMV reverse transcriptase [New England Biolabs] • Bst DNA polymerase [New England Biolabs] • Betaine [Sigma] • 10×ThermoPol II (Mg-free) reaction buffer [New England Biolabs] • dNTPs (100 mmol) • MgSO4 • Purified primers (HPLC or Cartridge purification grade) These reagents, as a mixture that excludes the specific primers to be used, are commercially available [as Loopamp RNA Amplification Kit (RT-LAMP) from EikenChemical (5)]. Laboratory techniques in rabies Fifth edition 63 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Primer set for RT-LAMP To assess the applicability of RT-LAMP, a primer set can be designed by using PrimerExplorer V4 software (14) or LAMP designer software (15). The primer sets for RABV detection used in the previous studies are shown in Table 32.1. The concept of primer design for effective gene amplification and elongation reac- tions can be explored by an accessible animation on the Eiken GENOME SITE (5). The standard set of four primers (F3, B3, FIP, BIP) consisting of two outer primers and two inner primers is basically used for the gene amplification in RT-LAMP (Fig.  32.1). The outer primers are referred to as the forward outer primer (F3) and the backward outer primer (B3). The two inner primers are referred to as the forward inner primer (FIP: F1c+F2) and the backward inner primer (BIP: B1c+B2). The  use of the primers through OPC (oligonucleotide purification cartridge) or HPLC (high-performance liquid chromatography) purification is advisable. Two further loop-binding primers (FLoop and BLoop) have been optionally added to increase the rate of strand displacement and synthesis. RT-LAMP, reverse transcriptase loop-mediated isothermal amplification Fig. 32.1. Schematic diagram of RT-LAMP primers showing the position of the six primers spanning the target gene The inner primers FIP (BIP) are composed of F2 (B2) and F1c (B1c). The outer primers are at the region of F3 and B3. The loop primers Floop and Bloop are designed between F1c (B1c) and F2c (B2c). The U (Uracil) on target RNA sequence will be transcribed into T (thymine) for primer design. B y co ur te sy o f T ak uy a Ito u, W an da M ar ko tt er a nd L ou is N el ; p ar tia lly ad ap te d w ith p er m is si on fr om th e Ei ke n G EN O M E S IT E, E ik en C he m ic al Laboratory techniques in rabies Fifth edition 64 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Primer Sequence (5’–3’) Position Target strain Reference C-F3 ACATGTCCGGAAGACT 250–265 CVS-11 (8) C-B3 CAGACTCAGGAGAAGACC 424–441 C-BLP GGCATGGAATTGACAAGGGACC 373–394 C-FIP ACTAGAGAGTTTGGGGTGA-GGACCAGCTATGGAATCC 308–326+266–283 C-BIP ACGGGAATTGGGCTCTGAC-CTAAAGATGCATGTTCAG 350–368+403–421 P-F3 ACATGCCCTGAAGATT 250–265 Philippines dog (8) P-B3 AAGACTCAGGAGAAGACC 424–441 P-BLP GGTAGGAGCTGACAAGGGACC 373–394 P-FIP ACAAGGGAATCAGGGGTGA-GGACTAGCTATGGGATCT 308–326+266–283 P-BIP AAGGAAATTGGGCTCTGAC-CTAAAGACGCATGTTCTG 350–368+403–421 F3 GCCCCCGACTTAAACAAAGC 118–137 PV (Cosmopolitan lineage and vampire bat lineage) (9) B3 TTCCCCTCTACATCAGTACG 319–338 FIP ACTGCATTGCTGCTGCCAAGTA-GCATGAACGCCGCCAAAC 199–220+158–175 BIP TGTCCGGAAGACTGGACCAGCT-ACAAGAGAATCTGGGGTGAT 235–256+289–308 FLoop GGAGCATACATCATCAGGATCNA 176–198 BLoop ATGGAATCCTGATTGCACGAMA 257–278 Rab1F3 AGCCCCCGACTTAAACAAAG* –# Cosmopolitan lineage (10) Rab1B3 CTGTCAGAGCCCAATTTCCT* – Rab1FIP GCATTGCTGCTGCCAAGTAGGATTTTCAGGCATGAATGCAGCCA* – Rab1BIP CGTGTCCAGAAGACTGGACCAGTTTTATTTCCACCAGAGAATCC* – Rab1FLOOP ACATACATCATCAGGATCAAGT* – Rab1BLOOP CTATGGAATCTTGATCGCACG* – Rab4F3 GCCCCCGATTTGAACAA* – Arctic lineage (10) Rab4B3 GGGAATTGGGCTTTGACG* – Rab4FIP ACTGCATCGCAGCTGCTAAGTAGGATTTTCAGGCTTGAATGCTGCCAA* – Rab4BIP CATGTCCTGAAGACTGGACCAGTTTTATCTCCACAAGAGAATCTGGGGT* – Rab4FLOOP ACATACATCAGGATCAAGC* – Rab4BLOOP CTATGGGATCTTGATTGCAAG* – F3 GAAAAGGAGACAAGATCACC 363–382 PV (Africa 1b lineage) (11) B3 CCGGTGTTTTGTCCTGAT 528–545 FIP CCTTGTCAGCTCCATGCCTCCCGGACTCTCTAGTGGAAAT 383–460 BIP ACCCCACTGTCTCTGAGCATTGCTCAACCTATACAGACTCA 461–524 CVSF3 AGCCCCCGACTTGAACAAAG – CVS (12) CVSB3 CTGTCAGAGCCCAATTCCCG – CVSFIP GCATTGCTGCTGCCAAGTAGGATTTTCAGGCATGAATGCCGCCAA – CVSBIP CATGTCCGGAAGACTGGACCAGTTTTATCTCCACTAGAGAGTTTGG – CVSFLOOP GCATACATCCGGATCAAGT – CVSBLOOP CTATGGAATCCTGATTGCACG – Deg-F3 Deg-B3 Deg-FIP Deg-BIP Deg-LF Deg-LB YCCWGATGATGTRTGYTCCTA AGTTRCCRGTGTTYTGYC TATYTCYACMAGAGAATCYGGR+GAYTGGACCAGCTAYGGR GACNGGAGGAATGGARYTRAC+ACTCAARAGAAGACRACTAA RTCYCCTTTYCKTGCRATCAR CCACTGTYYCYGAGCATG 268–288 534–551 382–403+332–349 436–456+488–508 353–373 465–482 Indian RABV strains (13) *1 The combination of these 12 primers was examined and deemed feasible for use via RT-LAMP. See reference 10 for the optimal concentration of each primer. # No information Table 32.1. Details of oligonucleotide primers designed to detect rabies virus using RT-LAMP Laboratory techniques in rabies Fifth edition 65 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Equipment • For real-time turbidity detection – Loopamp Realtime Turbidimeter [Eiken Chemical] • For visual and real-time fluorescence detections – Incubator (temperature accuracy within ±  0.5 °C) and fluorescence scanner (e.g. ordinary real-time PCR detection system or ESEQuant Tube Scanner [Qiagen]) – Heat block (for termination of the LAMP reaction) – UV transilluminator (wavelength at 240–260 nm or 350–370 nm) Several additional methods for detection are reviewed by Zhang and collea- gues (16). Biologicals and sample preparation For detection, brain samples are used. Viral RNA extraction of RABV from brain tissue is undertaken as described in Chapter 27 on RT-PCR. Commercial extrac- tion kits (such as the QIAamp Viral RNA Kit [Qiagen] and TRIzol [Life Technologies or Invitrogen]) are available. Methods Preparation of master mix 1. After frozen reagents are thawed at room temperature, prepare the following master mix on ice. Once the reagents are thawed, keep them on ice. Composition of master mixa Reagents Amount/final concentration 10×ThermoPol II (Mg-free) reaction buffer 2.5 μL dNTPs 0.5–1.0 mmol each MgSO4 8 mmol Betaine (Sigma) 1 mol Bst DNA polymerase 8–16 units AMV reverse transcriptase (or equivalent enzyme) 0.2–1.0 U Primer: FIP 40 pmol BIP 40 pmol FLoopb 20 pmol BLoopb 20 pmol F3 5 pmol B3 5 pmol RNase–DNase-free sterile water X μL (ad q.s.) Total 20.0 μL/tube a Master mix reagents excluding primers are replaced by reaction mix and enzyme mix in Loopamp RNA Amplification Kit (RT-LAMP). b These loop primers are optional and their use is merely to accelerate the LAMP reaction. Laboratory techniques in rabies Fifth edition 66 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences 2. For real-time fluorescence detection, add a fluorescent dye such as 1 μL of fluorescent detection reagent [Eiken Chemical] or 0.4 μmol of SYTO-9 green fluorescent dye [Life Technologies] and maintain the total mixture amount of 20 μL. 3. After dispensing, gently tap the tubes for a few times, or mix the solution by repeatedly inversing the tube, or mix thrice by vortexing for 1 s. After mixing well, centrifuge the tubes for a few seconds. Avoid too much vortexing because of enzyme inactivation. The master mix should be prepared immediately before use. Mixing of master mix and sample (on ice) 1. Dispense 20 μL of the master mix into a micro tube. 2. Add 5 μL of extracted sample RNA to the master mix; the volume should be 25 μL in total. For the negative control reaction, use 5 μL of water instead of sample RNA. Thoroughly mix the solution by pipetting or tapping the tube with the cap closed and then spin down. Take care not to create air bubbles when mixing. Amplification reaction 1. Place the reaction tubes in a turbidimeter, fluorescence scanner or the incu- bator, and incubate at 60–65 °C for 30–60 min. (The reaction condition must be optimized for specific primers sets.) 2. Inactivate the enzyme and terminate the reaction by incubating the mixture for 2 min at 95 °C. Detection and interpretation of results Turbidity detection The turbidity of magnesium pyrophosphate, a byproduct of the LAMP reaction, is formed in proportion to the amount of amplified products. Since LAMP can yield extremely high amounts of amplified products, white turbidity can be visually observed. Real-time turbidity detection can be conducted with the turbidimeter (e.g. Loopamp Realtime Turbidimeter). An example is shown in Fig. 32.2. Fluorescence detection Visual fluorescence detection can be achieved by the addition of 2 μL of 10–100-fold diluted SYBR Green I [Lonza] to the reaction tube after the amplifica- tion reaction (Fig. 32.3). An ultraviolet transilluminator and protective goggles are required. The fluorescence of samples should be evaluated by comparison with the positive and negative controls. The incubation can be done in commercially available incubators or in the Loopamp Realtime Turbidimeter [Eiken Chemical]. Real-time fluorescence detection can be conducted with a fluorescence scanner (ordinary real-time PCR detection system or ESEQuant Tube Scanner [Qiagen]). Laboratory techniques in rabies Fifth edition 67 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences RT-LAMP, reverse transcriptase loop-mediated isothermal amplificationBy c ou rt es y of th e U ni ve rs ity o f P re to ria , S ou th A fr ic a Fig. 32.2. Real-time monitoring of the representative results of the RT-LAMP assay The solid line shows the RT-LAMP reaction of a RABV-positive sample. The dotted line shows the reaction of a negative sample. The inset shows representative tubes after the RT-LAMP reaction. A positive reaction is represented by the formation of magnesium pyrophosphate, a white precipitate by-product. RT-LAMP, reverse transcriptase loop-mediated isothermal amplification Fig. 32.3. Visual inspection with SYBR Green I after RT-LAMP The panels U and V indicate the results under ultraviolet and visible lights, respectively. P, RABV-positive sample; N, negative control B y co ur te sy o f t he U ni ve rs ity o f P re to ria , S ou th A fr ic a Laboratory techniques in rabies Fifth edition 68 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Electrophoresis To avoid contamination, extra care should be taken when handling the amplifi- cation products during the electrophoresis process. The reaction solution is analysed on a 2% agarose gel (1–2 μL.) A typical ladder pattern can be observed after electrophoresis (Fig. 32.4), as the amplified products consist of various sizes of inverted repeats of the target sequence on the same strands. Validation of the specificity of LAMP reaction To validate whether the amplified product is derived from the target region, sequencing or restriction, enzyme digestion of the amplicon can be undertaken. Discussion The RT-LAMP technology has remarkably high amplification efficiency, achie- ving highly sensitive detection of specific nucleotide sequences in about 1 h. Its sensitivity is 10–1000 times higher than that of conventional RT-PCR (8, 9) and equivalent to real-time RT-PCR (12). Thus, the RT-LAMP is a promising technology for simple and rapid genetic detection of RABV. The LAMP reactions also have high specificity and can discriminate slight differences in the sequences of the target genes because the length of binding sites complementary to LAMP primers are longer than that of PCR primers. Hence, the design of LAMP primers with high sensitivity and specificity is crucial to the success of LAMP analysis. The LAMP primer sets in previous studies using RT-LAMP for RABV detection all targeted the nucleoprotein gene, which is relatively conserved among RABV variants. Fig. 32.4. Agarose gel electrophoresis of RT-LAMP product M, 100 bp (base pair) ladder marker; P, RABV-positive sample; N, negative control B y co ur te sy o f t he U ni ve rs ity o f P re to ria , S ou th A fr ic a Laboratory techniques in rabies Fifth edition 69 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Saitou and colleagues reported a risk for false–negative results in RT-LAMP when applied to RABV isolates from different parts of the world, depending on the primers selected (9). In most geographical areas, multiple genetic lineages of RABV exist, and the development of primer sets based on DNA sequencing data is recommended. Ultimately, universal RT-LAMP primer sets which can detect all lyssavirus species worldwide will be ideal. Hayman and colleagues demonstrated that RT-LAMP successfully detects multiple lineages of African RABV by using a combination of two sets of LAMP primers, a total of 12 primers (10). Additional evaluations using these primer sets or improved primers are necessary for the development of universal sets. The RT-LAMP is prone to the same challenges as other molecular detection techniques, such as cross-contamination during the opening of the tubes due to the high amplification efficiency. To avoid false positive–results by contamina- tion, the samples and reagents should be prepared in dedicated areas; the use of multiple negative controls between samples is recommended. The RT-LAMP technique is inexpensive and can be performed without the need for a thermal cycler. Results can also be detected by a portable scanner (e.g. ESEQuant Tube Scanner [Qiagen]) and adapted to an easy-to-use lateral flow device format for visual detection of LAMP products (10). Therefore, the RT-LAMP can be useful in low resource settings where rabies incidence is usually the highest. References 1. Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J Infect Chemother. 2013:19:404–411. doi:10.1007/s10156-013-0590-0. 2. Notomi T, Mori Y, Tomita N, Kanda H. Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. J Microbiol. 2015;53:1–5. doi:10.1007/s12275-015-4656-9. 3. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63. PMID:10871386. 4. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T. Loop-mediated isothermal amplification reaction using a non-denatured template. Clin Chem. 2001;47:1742–43. PMID:11514425. 5. Eiken GENOME SITE In: Eiken Chemical Co. Ltd. [website] (http://loopamp. eiken.co.jp/e/, accessed 1 October 2018). 6. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyro- phosphate formation. Biochem Biophys Res Commun. 2001;289:150–54. doi:10.1006/bbrc.2001.5921. 7. Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplifica- tion (LAMP) of gene sequences and simple visual detection of products. Nat Protoc. 2008;3:877–82. doi:10.1038/nprot.2008.57. Laboratory techniques in rabies Fifth edition 70 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences 8. Boldbaatar B, Inoue S, Sugiura N, Noguchi A, Orbina JR, Demetria C, et al. Rapid detection of rabies virus by reverse transcription loop-mediated isothermal amplification. Jpn J Infect Dis. 2009;62:187–91. PMID:19468177. 9. Saitou Y, Kobayashi Y, Hirano S, Mochizuki N, Itou T, Ito FH, et al. A method for simultaneous detection and identification of Brazilian dog- and vampire bat-related rabies virus by reverse transcription loop-mediated isothermal amplification assay. J Virol Methods. 2010;168:13–7. doi:10.1016/j. jviromet.2010.04.008. 10. Hayman DT, Johnson N, Horton DL, Hedge J, Wakeley PR, Banyard AC, et al. Evolutionary history of rabies in Ghana. PLoS Negl Trop Dis. 2011;5:e1001. doi:10.1371/journal.pntd.0001001. 11. Muleya W, Namangala B, Mweene A, Zulu L, Fandamu P, Banda D, et al. Molecular epidemiology and a loop-mediated isothermal amplification method for diagnosis of infection with rabies virus in Zambia. Virus Res. 2012;163:160–68. doi:10.1016/j.virusres.2011.09.010. 12. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoSNegl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 13. Reddy RVC, Satya AK, Surendra KSNL, Rana SK, Subramanian BM, Sharma GK, et al. Reverse transcription loop-mediated iso-thermal amplifi- cation (RT-LAMP) assay for the detection of rabies virus. Adv Anim Vet Sci. 2016:4:584–92. doi:10.14737/journal.aavs/2016/4.11.584.592. 14. PrimerExplorer. In: LAMP primer designing software [website]. Kanagawa: Fujitsu Limited; 1999–2005 (http://primerexplorer.jp/e/, accessed 1 October 2018). 15. LAMP primer designer software [website]. Kanagawa: Fujitsu Limited; 1999– 2005 (http://primerexplorer.jp/e/, accessed 1 October 2018). 16. Zhang X, Lowe SB, Gooding JJ. Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP).  Biosen Bioelectron. 2014;61:491–9. doi:10.1016/j.bios.2014.05.039. Laboratory techniques in rabies Fifth edition 71 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Chapter 33 Detection of lyssavirus nucleic acids by in situ hybridization Introduction Gold standard methods for the detection of rabies virus (RABV) and other lyssa- viruses, such as the direct fluorescent antibody test (DFAT; see Chapter 11), or current molecular methods, such as reverse transcriptase polymerase chain reac- tion (RT-PCR; see Chapter 27), require the use of fresh or fresh frozen samples, and their sensitivity may be impaired by autolytic and putrefactive changes (1). Formalin fixation is widely and routinely used to preserve tissues for histopatho- logy. On occasions when maintaining a suitable cold chain or accessing diagnostic laboratories with specialized equipment is a challenge, formalin fixation provides an alternative method for maintaining sample integrity for downstream testing. However, the performance of DFAT and molecular methods for RABV detection is less optimal in formalin-fixed and in formalin-fixed, paraffin-embedded (FFPE) tissues due to formalin-induced cross linking, RNase activation and RNA frag- mentation, or both (2,3). Alternative histopathological methods for the detection of RABV in FFPE samples have been developed, including immunohistochemistry and in situ hybri- dization (ISH). ISH allows the detection of specific nucleic acid sequences in morphologically preserved cells and tissues, and the visualization of messenger RNA (mRNA) and genomic RNA (gRNA) of lyssaviruses at cellular and subcellular level for diagnosis, virus typing and viral pathogenesis studies. Originally, radioactive-labelled RNA probes were used for the detection of nucleocapsid protein mRNA and gRNA in the central nervous system of RABV-in- fected mice (3). Radioactive probes were also used for the detection of RNA enco- ding all five RABV proteins in mice and human brains (5) and to evaluate the effect of autolysis up to 72 h in the detection of virus RNA by ISH (6). Jackson and Rintoul showed that autolysis resulted in a noticeable progressive reduction of the ISH signal, less marked for the detection of RABV antigens. The detection of RABV mRNA in mouse brains using digoxigenin (DIG)-labelled RNA probes demonstrated the advantages of this method over the use radioactive probes (7). DIG-labelled probes were used subsequently to detect RABV RNA in experimen- tally infected mouse and human brains (8, 9). DIG-labelled probes have also been designed and used on FFPE tissues to discriminate and type RABV, based on P gene sequences and allowing for retrospective typing (10). Such use has also differentiated RABV, European bat lyssavirus type 1 (EBLV-1) and type 2 (EBLV-2), targeting the N gene (11). Fluorescent in situ hybridization (FISH) methods using biotinylated oligonucleotide probes on fixed RABV-infected cell cultures have shown that all viral RNAs (genome, antigenome and mRNA) are present in the inclusion bodies or Negri body-like structures developed in infected cells, indi- cating that viral transcription and replication occur in these structures (12). Using Laboratory techniques in rabies Fifth edition 72 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences a similar method, Nikolic et al. have shown that viral mRNAs, but not gRNA, are selectively transported from Negri bodies to the stress granules induced by RABV infection, demonstrating the direct application of ISH to the study of subcellular changes and viral pathogenesis (13). The ISH protocol described in this chapter utilizes commercially sourced oligo- nucleotide probes. The probes can be tailored to differentiate between specific lyssaviruses (e.g. RABV, EBLV-1 or EBLV-2) or can be designed for cross-spe- cies detection. Therefore, identification of genomic regions with the adequate genetic diversity is fundamental for probe design and consequently the success of the technique. Oligonucleotides are stable, not degraded by RNase, and their small size improves tissue and cell penetration as well as target detection in FFPE tissues, where the process of tissue fixation has a detrimental effect on the length of nucleic acid sequences. The probes used for the protocol described herein are labelled with digoxigenin (DIG) and will detect viral genomic RNA. They were designed to detect the nucleoprotein gene of selected virus isolates with species specificity; their sequences are shown in Table 33.1. CVS was used as a template for the RABV probe, while RV20, isolated from a serotine bat (Eptesicus serotinus) in Denmark during 1986, and RV1332, isolated from a Daubenton’s bat (Myotis daubentonii) in the UK during 2002, were used for the EBLV-1 and EBLV-2 probes, respectively (14). Protocol Generation of control material and test samples Positive control material is generated by inoculating mice intracerebrally with 10% suspensions of RABV-infected brain tissue. With presentation of clinical signs, the animal is euthanized, and the brain is removed and fixed in 10% neutral buffered formalin at room temperature for a minimum of 48 h. A proportion of the brain can be removed prior to fixation for confirmatory testing using another stan- dard method (e.g. DFAT or RT-PCR). Similar fixation protocols will be required for the test samples. When the histological processing of the tissues is conducted at a lower containment level, a validation of the inactivation of the fixed samples may be required. Virus present in samples up to 1 cm in thickness is inactivated after 24 h. The fixed tissue is then processed through graded alcohol and a clearing agent before being embedded in paraffin wax using standard histological proto- cols. Negative control material can be generated in the same way using mice that have not been inoculated with RABV suspensions. Table 33.1. Sequences of DIG-labelled probes used for lyssavirus ISH detection in FFPE tissues Species Nucleotide sequence RABV 5’-GGATGCCGACAAGATTGTGTTCAAAGTCAATAATCAGGTGGTCTCTTTGAAGCC-3’ EBLV-1 5’-CGTCTGCTCTTATTTAGCTGGAGCCATGGTCTTGTTTGAGGGCATCTGCCCGG-3’ EBLV-2 5’-CCCTTGGAAAAGCTCCGGACCTGAACAGAGCTTATAAGTCCATTCTGTCCGG-3’ DIG, digoxigenin; EBLV-1, European bat lyssavirus type 1, EBLV-2, European bat lyssavirus type 2; ISH, in situ hybridization; RABV, rabies virus Laboratory techniques in rabies Fifth edition 73 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Section preparation 1. Cut embedded brain tissue at a thickness < 5 µm using a microtome, float the section on a water bath containing water treated with diethylpyrocarbonate (DEPC) and mount onto a Superfrost charged slide. 2. Improved adherence of the tissue section to the charged slide can be achieved by incubating at 60 °C for 30 min. In situ hybridization The ISH protocol is subdivided into three sections: (i) slide preparation and permeabilization, (ii) probe hybridization and (iii) probe detection (Fig. 33.1). Each section includes temperature dependent steps. All steps of the process are to be undertaken at room temperature unless otherwise indicated. Slide preparation 1. Use two 6-min changes in Xylene to deparaffinize the tissue sections, clear with two 6-min changes of 100% ethanol and rehydrate with 6-min incubations in each of the following: 70% ethanol, 50% ethanol and DEPC-treated distilled water. 2. Following two, 5-min washes in DEPC and phosphate buffered saline (PBS), transfer the slides to 4% paraformaldehyde in 0.1 mol phosphate buffer for 10 min. 3. After a further two, 5-min washes in DEPC–PBS, immerse the slides in a 0.1 mol triethanolamine (TEA) buffer containing 0.25% acetic anhydride for 5 min. B y co ur te sy o f t he A ni m al a nd P la nt H ea lth A ge nc y, A dd le st on e, S ur re y, U K Original magnification 100x (left) and 400x (right) ISH, in situ hybridization; RABV, rabies virus Fig. 33.1. Specific ISH labelling of the neuronal cell body in the piriform cortex of mice intracerebrally inoculated with challenge virus standard RABV using the RABV probe labelled with digoxigenin (purple colouration) Laboratory techniques in rabies Fifth edition 74 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences 4. Add additional acetic anhydride to the 0.1 mol TEA buffer containing 0.25% acetic anhydride to make a final 0.1 mol TEA buffer containing 0.5% acetic anhydride and incubate the slides for a further 5 min. 5. Wash the slides in 2x saline-sodium citrate (SSC) buffer for 3 min before trans- ferring them to a DEPC–TEA buffer containing proteinase K (10 µg/mL) and incubate for 30 min at 37 °C. 6. To quench residual proteinase K activity, immerse the slides in DEPC–PBS containing 2% glycine for 60 s and then wash in PBS for 5 min. Probe hybridization 1. Pre-heat hybridization buffer to 37 °C before use. 2. Lay slides out on staining trays and rinse them twice with PBS, allowing the PBS to remain on the slides for 5 min between each rinse. 3. Drain excess buffer from the slides, apply hybridization buffer, cover the tissue section on the slide with plastic paraffin film (trimmed to size) and incubate for 2 h at 37 °C. 4. Rinse with 2x SSC to remove the plastic paraffin film and hybridization buffer and then wash slides in 2x SSC for 5 min. 5. To prepare the probe, vortex oligonucleotide probe stock for 60 s, add probe to the hybridization buffer to achieve a 200 ng/mL concentration, mix by inverting the probe and buffer several times and apply < 200 µL to each section. Cover the tissue section on the slide with plastic paraffin film (trimmed to size) and incubate for a minimum of 18 h at the calculated hybridization temperature. Optimal probe hybridization temperature (Thyb) can be calculated using the following formula: Thyb = 24.21+0.41(%GC)–500/length of probe, based on the assumption that hybridization buffer contains 4 x SSC and a formamide concentration of 50%. Probe detection 1. Pre-warm 0.5 and 1x SSC post-hybridization washes. These washes should be between 5 °C and 20 °C warmer than the hybridization temperature of the probe. 2. Rinse with 1x SSC to remove plastic paraffin film and hybridization buffer from the slide, immerse slides in 1x SSC wash buffer pre-heated to wash tempera- ture and incubate at the wash temperature for 15 min. 3. Discard 1x SSC and re-fill immersion trough with pre-heated 1x SSC wash buffer and incubate slides for a further 15 min at the wash temperature. 4. Following two, 15-min immersions in 0.5x SSC wash buffer (at wash tempera- ture), transfer the slides to 0.5x SSC wash buffer and incubate at room tempe- rature for 10 min. 5. Transfer slides to tris-buffered saline (TBS) and wash sections three times for 5 min each. Laboratory techniques in rabies Fifth edition 75 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences 6. Drain off TBS and apply blocking solution comprised of 0.1% Triton X-100 and 1% normal sheep serum diluted in TBS for 30 min. 7. Drain off blocking solution and apply (< 200 µL per slide) anti-DIG antibody conjugated to alkaline phosphatase diluted 1/100 in blocking solution for a minimum of 4 h. 8. Wash in three, 5-min changes of TBS and apply (200 µL per slide) NBT/BCIP (dissolved in distilled water supplemented with 10 µL of 1 mol levamisole solu- tion per 10 mL). Development time variable and the reaction should be moni- tored regularly under a microscope. Minimum development time is 20 min. 9. Rinse slides in tap water to stop the reaction and counterstain with nuclear fast red for 10 min. 10. Wash slides in running tap water for 10 min, transfer to distilled water and then mount the sections using an aqueous mountant. Interpretation of results To ensure the fidelity of the results, negative and positive control material must be included in the assay along with the test sample. Technique controls, which include the omission of the probe or the substitution of the lyssavirus probe with a nonsense or non-lyssavirus specific sequence of the same length, should also be included. RABV-positive control material must demonstrate purple-labelled intracytoplasmic inclusions, ranging in size from fine granular particles to large inclusion bodies, within the neuron perikarya. Labelling of a similar nature and location must not be present in the negative control material nor on tests on positive control material, where the lyssavirus-specific probe has been omitted or replaced with a nonsense probe. The amount of lyssavirus-specific labelling within the sample will vary depending upon the level of infection. Positive sections can be scored based on the intensity of labelling using well established scoring procedures (e.g. 1+ weak to 3+ strong). Laboratory optimization The success of this protocol is directly dependent upon the ability of the probe to access the target sequence. Proteinase K actively breaks down the extensive protein framework cross-linking proteins in the tissue, which is produced during fixation, and increases accessibility to the target sequence. Therefore, manipu- lation of the enzyme concentration (generally 5–20  µg/mL) and the length and temperature of incubation can help optimize probe access and ultimately influence the final ISH signal intensity. The conditions described in this protocol are optimal for our laboratory. However, optimization may be required when performing this assay in other laboratories due to differences in the length and type of fixation. Laboratory techniques in rabies Fifth edition 76 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Critical parameters, troubleshooting and precautions The impact of RNase is reduced through the use of oligonucleotide probes; however, care should still be taken in the preparation of reagents and equipment used for this assay. Laboratory glassware should be sterilized or treated for the potential contamination with RNase. Use sterile slides and plastic paraffin film where possible. Reagents must be prepared with either nuclease-free or DEPC- treated water. Good laboratory practice should be maintained at all times to minimize the introduction of contaminants (e.g. by the wearing of gloves). Oligo- nucleotide probes are robust and are suitable for long-term storage. For example, reconstituted probes from one of the commercial suppliers can be stored at 25 °C for 3 months and at −20 °C for up to 3 years. Preparation and aliquoting on receipt for long-term storage will also minimize the number of freeze–thaw cycles, which can degrade the probe, affecting ISH signal. Several parameters can be modified if labelling is not produced to expected levels. The concentration and duration of proteinase K treatment can be altered to counter the effects (i.e. diminished or lack of labelling) of an extended or shortened tissue fixation. The length of probe hybridization can be extended (<  40  h) if labelling is suboptimal. The intensity of the labelling colour product can also be increased or reduced by extending or shortening the NBT–BCIP development period. Increased nonspecific label- ling or background staining can be reduced by increasing the probe hybridization temperature or reducing the duration of NBT–BCIP development. Alternative materials and/or methods The use of commercial synthetic oligonucleotides in ISH enables a greater flexibility in the design and choice of visualization methods. A biotin or fluorescent tag can be incorporated into the probe in place of the DIG label allowing for the visualization of multiple target sequences by confocal microscopy. The use of oligonucleotide probes also means that even in situations where there is difficulty in producing a consensus probe for all lyssavirus species, the capacity exists to commercially order interspecies consensus probes and apply a probe cocktail. Rapid advances have been made with ISH methodology over recent years. The emergence of kit-based systems for both the bench and for automated staining systems and commercially available probe design and prepa- ration services have substantially reduced the labour requirements and turna- round times for testing using an ISH assay. These advances have also simplified the optimization process to a single parameter, reducing the lead-in time for tech- nique development and validation. Time considerations This ISH methodology as described is labour intensive and does not lend itself to a rapid diagnostic testing turnaround in this format. Lead-in time for tissue processing to wax, once tissue is fixed, is approximately 24 h. Slide prepara- tion requires 3–4 h, pre-hybridization steps require 2–3 h, probe hybridization Laboratory techniques in rabies Fifth edition 77 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences requires an overnight incubation (> 18 h), post-hybridization washes and detec- tion with anti-DIG antibody-AP conjugate requires a minimum of 6–7 h, although the anti-DIG AP conjugate is routinely left on overnight to enable the monitoring of development the next day. Finally, development of the ISH signal and slide mounting requires 2–3 h. To incorporate the overnight incubations, approximately 5 days are required to complete this assay. Limitations This technique has been validated on FFPE material, where the fixation period is variable (5 days up to several months). Application of this method to FFPE tissues and material prepared in other fixatives would require optimization. The size of the oligonucleotide probes used (approximately 50 base pairs) counteract the issue of extended fixation periods to some degree. However, the fixation time should be minimized, where possible, to reduce the impact on the ISH signal. Laboratory techniques in rabies Fifth edition 78 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences References 1. Arslan A, Saglam YS, Temur A. Detection of rabies viral antigens in non-au- tolysed and autolysed tissues by using an immunoperoxidase technique. Vet Rec. 2004;155:550–2. PMID:15559421. 2. Kashofer K, Viertler C, Pichler M, Zatloukal K. Quality control of RNA preser- vation and extraction from paraffin-embedded tissue: implications for RT-PCR and microarray analysis. PLoS One. 2013;8:e70714. doi:10.1371/journal. pone.0070714. 3. Beck S, Gunawardena P, Horton DL, Hicks DJ, Marston DA, Ortiz-Pelaez A, et al. Pathobiological investigation of naturally infected canine rabies cases from Sri Lanka. BMC Vet Res. 2017;13:99. doi:10.1186/s12917-017-1024-5. 4. Jackson AC, Reimer DL, Wunner WH. Detection of rabies virus RNA in the central nervous system of experimentally infected mice using in situ hybridiza- tion with RNA probes. J Virol Methods. 1989;25:1–11. PMID:2778026. 5. Jackson AC, Wunner WH. Detection of rabies virus genomic RNA and mRNA in mouse and human brains by using in situ hybridization. J Virol. 1991;65:2839– 44. PMID:2033657. 6. Jackson AC, Rintoul NE. Effects of post-mortem autolysis on the detection of rabies virus genomic RNA and mRNA in mouse brain by using in situ hybridiza- tion. Mol Cell Probes. 1992;6:231–5. PMID:1406731. 7. Jackson AC. Detection of rabies virus mRNA in mouse brain by using in situ hybridization with digoxigenin-labelled RNA probes. Mol Cell Probes. 1992;6:131–6. doi:10.1016/0890-8508(92)90057-5. 8. Warner CK, Whitfield SG, Fekadu M, Ho H. Procedures for reproducible detec- tion of rabies virus antigen mRNA and genome in situ in formalin-fixed tissues. J Virol Methods. 1997;67:5–12. 9. Warner CK, Zaki SR, Shieh WJ, Whitfield SG, Smith JS, Orciari LA, et al. Labo- ratory investigation of human deaths from vampire bat rabies in Peru. Am J Trop Med Hyg. 1999;60:502–7. PMID:10466985. 10. Nadin-Davis SA, Sheen M, Wandeler AI. Use of discriminatory probes for strain typing of formalin-fixed, rabies virus-infected tissues by in situ hybridization. J Clin Microbiol. 2003;41:4343–52. doi:10.1128/JCM.41.9.4343-4352.2003. 11. Finnegan CJ, Brookes SM, Johnson L, Fooks AR. Detection and strain differen- tiation of European bat lyssaviruses using in situ hybridisation. J Virol Methods. 2004;121:223–9. 12. Lahaye X, Vidy A, Pomier C, Obiang L, Harper F, Gaudin Y, et al. Functional characterization of Negri bodies (NBs) in rabies virus-infected cells: evidence that NBs are sites of viral transcription and replication. J Virol. 2009;83:7948– 58. doi:10.1128/JVI.00554-09. 13. Nikolic J, Civas A, Lama Z, Lagaudrière-Gesbert C, Blondel D. Rabies virus infection induces the formation of stress granules closely connected to the viral factories. PLoS Pathog. 2016;12:e1005942. doi:10.1371/journal.ppat.1005942. 14. Johnson N, Selden D, Parsons G, Healy D, Brookes SM, McElhinney LM, et al. Isolation of a European bat lyssavirus type 2 from a Daubenton’s bat in the United Kingdom. Vet Rec. 2003;152:383–7. PMID:12696703. Laboratory techniques in rabies Fifth edition 79 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Annex Equipment • items for an automated tissue processor for paraffin embedding of fixed samples • microtome for sectioning FFPE tissues • slide staining trays • vortex mixer, magnetic stirrer, water bath, micro centrifuge • incubator (room temperature up to approximately 80 °C) • observation light microscope (low power) to monitor colour change during development • light microscope (with camera) • reagents • Superfrost plus charged slides • Xylene • ethanol (molecular grade) • diethyl pyrocarbonate (DEPC) • paraformaldehyde and buffer (0.1 mol phosphate buffer) • proteinase K • glycine • phosphate buffered saline (PBS) • acetic anhydride • saline-sodium citrate (SSC) buffer in various concentrations • hybridization buffer (dextran sulfate, Formamide, PolyA, ssDNA, tRNA, DTT (1 M solution), 50x Denhardts) • anti-DIG fab fragment antibody • M triethanolamine buffer (0.1 mol TEA buffer in distilled water) • plastic paraffin film • NBT/BCIP substrate-chromogen • aqueous mountant • tris-buffered saline (TBS, 100 mmol Tris HCl, 150 mmol NaCl, pH 7.6) • 1x tris-EDTA buffer (TE buffer) Laboratory animals Mice would be required for the generation of known positive and negative control material. Field cases could be used for controls, once the technique is optimized. Laboratory techniques in rabies Fifth edition 80 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Chapter 34 Rapid diagnosis and genetic typing of rabies virus and other lyssaviruses using SYBR Green RT-PCR and pyrosequencing assays Introduction Rabies is a major public health problem in Asia and Africa, offering diagnostic challenges (1–3). Within North America, more than 100 000 suspected rabid animal samples are tested annually (4). Canine rabies viruses (RABV) are responsible for most human deaths in the developing world (5). Lyssaviruses include at least 15 different species with significant diversity in genome sequences, in which the sequence similarity among RABV can be as low as 80% of the nucleoprotein (N) gene sequences. Other lyssaviruses are more divergent. The sequence similarity of the N gene are in the range of 68–79% among different lyssavirus species (6). The sequence divergence among RABV and other lyssaviruses makes the diagnosis challenging. Highly sensitive and specific assays and sequencing of suspected samples are needed to confirm diagnostic results with confidence. WHO and OIE have defined the direct fluorescent antibody test (DFAT) as the gold standard for rabies diagnosis of postmortem samples (see Chapter 11). The DFAT is a rapid and sensitive method for rabies diagnosis, but its accu- racy depends on the quality of brain tissue, availability of high-quality anti-ra- bies diagnostic conjugates, accessibility to a fluorescence microscope and, most importantly, an experienced diagnostician (7). Real-time reverse transcriptase polymerase chain reaction (RT-PCR) assays have been used for rabies diagnosis for decades. A recently developed pan-lys- savirus real-time TaqMan RT-PCR assay, LN34, is able to detect RABV or other lyssaviruses (6). SYBR Green-based real-time RT-PCR assays have also demons- trated superior sensitivity and broad specificity in rabies diagnosis. However, the rabies SYBR RT-PCR assays may use degenerated primers or short primers for the PCR amplification and be inclined to produce nonspecific PCR products or primer dimers which can lead to false–positive results, as SYBR Green binds to double-stranded DNA nonspecifically (8). Despite rapid advances in next-generation sequencing technology, the Sanger sequencing method is still used widely for the routine analysis of suspect samples to confirm diagnostic RT-PCR results or to determine the source of infection based on the genetic typing results (see Chapter 29). Sequences from positive samples are critical for the investigation and control of outbreaks as well as the rapid iden- tification of lyssavirus infections. Normally, a Sanger protocol takes up to 12–24 h to generate sequences from a RT-PCR amplicon. Alternatively, a pyrosequencing method can be used for the diagnosis and genetic typing of suspected RABV samples by directly sequencing the RT-PCR amplicon. The pyrosequencing method generates short sequences, but the method is fast and very sensitive (9). Laboratory techniques in rabies Fifth edition 81 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences By combining these techniques, we take advantage of the superior sensitivity and broad specificity of the SYBR Green RT-PCR assay in rabies sample testing and the rapid sequencing ability of pyrosequencing technology. This protocol produces both real-time RT-PCR data followed by sequencing confirmation of the diagnostic results within 4 h. This protocol can be used for the diagnosis of rabies postmortem and antemortem samples, including saliva, nuchal skin samples and paraffin-embedded samples. This method is of particular use for a rabies refe- rence centre to perform additional diagnostic confirmations, rapid genetic typing of positive samples and monitoring the emergence of novel RABV variants or other lyssaviruses. Technique This protocol uses a one-step SYBR Green RT-PCR assay (LN12) to amplify a suspected RABV sample, followed by a pyrosequencing method (PyroLN12) to confirm the positive LN12 assay result. The forward and reverse primers of the LN12 assay target two of most conserved regions of RABV and other lyssavirus genomes. The forward primer overlaps with previously known LYS001 primer sequences, and the reverse primer overlaps with previously known JW12 primer sequences (10, 11). Those primer selections allow minimal primer degenerations and are able to amplify all known lyssaviruses as the primer sequences are highly conserved. The amplicon size is about 70 base pairs, which improve the assay’s sensitivity compared with previously published assays (12, 13). Our validation results show that the LN12 assay is more sensitive than those of the TaqMan- based pan-lyssavirus real-time RT-PCR assay LN34 (6). The advantage of pyrosequencing is that the sequencing reading starts at the first base after the sequencing primer and the sequencing results are generated in real time. Although the amplicon sequences of the assay LN12 are only 33 bases after the primer sequences, those 33 bases sequences are highly diverged and generate specific typing results among different lyssavirus species and major RABV variants. The PyroLN12 takes < 2 h to complete. Those pyrosequencing results may not be suitable for detailed phylogenetic analysis of the samples, especially among closely related RABV variants, but the sequences are specific for diagnostic confirmation and differentiation of RABV from other lyssaviruses and among major RABV variants, especially combined with clinical and animal contact information. The PyroLN12 is able to generate sequences for weak or difficult RABV samples. The optimization process of the protocol shows that the pyrosequencing method produces clear sequencing reads from the amplicons with cycle threshold (Ct) values ≥ 35 (< 100 copy of RABV RNA) from the LN12 assay. This protocol has been optimized in the nucleotide dispensation order and template quantities in the pyrosequencing process to improve the sequencing signal and sequencing length. Laboratory techniques in rabies Fifth edition 82 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Standard procedure Amplicon generation using the LN12 assay The LN12 assay is recommended to run on the real-time PCR instrument ABI ViiA7 and ABI 7500 [Applied Biosystems, Cat # 4453535 and 4406984]. Other real- time instruments may also be used following the recommended running condi- tions. Both forward (Fwd) and reverse primers (Rev) contain degenerate nucleo- tides (using the nomenclature of IUPAC). The Fwd sequences are: Fwd1, 5’-ACG CTT AAC RAC AAA ATC ARA GA-3’, Fwd2, 5’-ACG CTT AAC AAR ATC AGA GA-3’; and the Rev sequences are: Rev1, 5’-Biotin-GCA TCC ATT GTA GGR GTG TTA C-3’, and Rev2, 5’-Biotin-GCA TCC ATT GTA GGG GTG TTR C-3’. The Fwd1 and Fwd2 or Rev1 and Rev2 are mixed in an equal molar ratio. The Rev primers have biotin labels at the 5’ end and are used to generate a single-stranded DNA template for pyrosequencing (Fig. 34.1). Equipment and reagents • Invitrogen Superscript III Platinum SYBR Green One-Step qRT-PCR kit [cata- logue number 11736051] • high-purity nuclease-free water • Fwd and Rev primers with stock concentration of 10 µmol • RNase Away • RABV samples to be tested • positive control (historic RABV-positive RNA) • negative control, no template control (NTC), nuclease-free water • biosafety cabinets • ABI ViiA7 • QuantStudio Real-Time PCR Software V1.2 [ABI] • MicroAmp 96-well fast PCR plate [catalogue number 4346906] • MicroAmp optical adhesive film [ABI 4311971] • small benchtop centrifuge • pipettes Fwd, forward; Rev, reverse Fig 34.1. Primer design for the LN12 The logograph was constructed using 12 highly diverged RABV sequences (14). The small letters indicate the variable positions among RABV sequences. The Fwd primer is also used as the pyrosequencing primer and the biotinylated Rev primer is used for the purification of single-stranded template. Laboratory techniques in rabies Fifth edition 83 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Reaction setup for the LN12 1. Keep all reagents on ice after thawing. Reagents are returned to storage at −20 °C after use. 2. Use primer aliquots (40 µL) to minimize possible contamination. Discard the primers after 10 times of use. 3. Use separate biosafety cabinets for PCR setup and adding RNA samples. The bench surfaces of biosafety cabinets and pipettes are treated by spraying RNase Away before and after use to eliminate possible RNase contamination. 4. Prepare a reaction master mix as shown in Table 34.1. All samples are run in duplicate. 5. Gently mix the master mix. Spin briefly to collect all the liquid to the bottom of tube. 6. Dispense 18.0 µl of master mix to each reaction well of a MicroAmp 96-well fast PCR plate. 7. Transfer the PCR plate into the other biosafety cabinet designated exclusively for RNA work. 8. Thaw RNA samples and mix well. 9. Use 2.0 µL of extracted RNA per reaction. 10. Seal the plate. 11. Spin the 96-well PCR plate for 1.0 min and place it into an ABI ViiA7 thermo- cycler. Table 34.1. Preparation of master mix for the LN12 assay Components Volume per reaction (µL) Volume of master mixa = number of reactionsb x volume per reaction 2X SYBR Green reaction mix 10 Forward primer (10 µmol) 0.4 Reverse primer (10 µmol) 0.4 ROX reference dye (50 µmol)c 0.04 SuperScript III RT/Platinum Taq Mix 0.5 Nuclease-free water 6.66 a Prepare 10% extra volume. b All samples are run in duplicate, including positive and negative controls. c Different instruments require different ROX concentration as background reference dye, so adjust ROX volume accordingly. For exam- ple, ViiA 7 and ABI 7500 need 30–50 nmol ROX while ABI PCR StepOnePlus needs 300–500 nmol ROX. Laboratory techniques in rabies Fifth edition 84 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences PCR program setup using QuantStudio™ Real- Time PCR software V1.2 QuantStudio Real-Time PCR software V1.2 was used on the ViiA7 system. A similar software was used on the ABI 7500 system. Choice selections are highlighted in bold for easy illustration. Open the software and at the home screen: 1. In the Set UP panel, click Experiment Setup. 2. The Experiment Menu panel contains steps for program setup and result analysis. a. Fill the boxes of Experiment Name, User Name and Comments. b. Check the appropriate options for Experiment Property. 3. Click Define to access the next screen. a. Keep Target 1 in Targets Name; pick SYBR Green for Reporter, None for Quencher. b. In Samples panel, click New to add samples, and enter sample names. c. Choose ROX for Passive Reference. 4. Click Assign to access the next screen. 5. Assign reaction wells with sample names. 6. Select all reaction wells and assign them with Target 1. 7. Click Run Method to access the Rum Method screen 8. Set 20 µL for Reaction Volume per Well. 9. Set the thermal cycle profile under the Graphical View tab as in Table 34.2. 10. Click Run. Choose the ViiA7 instrument and save your run in a desired folder. 11. After the run is completed, the positive samples are sequenced or stored at −20 °C for future use. Table 34.2. The thermoprofile for the LN12 Temperature °C Time Comments 50 °C 5 min Reverse transcription 3 min 95 °C 3 s PCR amplification 60 °C 20 s 40 cycles 95 °C 15 s Melting curve (optional) 60 °C 1 min 95 °C 15 s 50 °C 5 min Laboratory techniques in rabies Fifth edition 85 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Run analysis When the run is completed, choose Automatic Threshold in the Analysis setting. Click the Analyse tab above the Plate Layout panel to analyse the run data. In the Analysis tab, check out each the following analysis. 1. Amplification Plot: pick ΔRn Vs Cycle plot and linear model. Expected results would be: a. The plots of positive samples should have the amplification curve in sigmoid with exponential phase. b. For a sample with a weak amplification and high Ct values, the Multi- component Plot may be used to check the increases of fluorescence for a true amplification. 2. Melt curve (optional): most RABV-positive samples have a single melting curve peak between 75 °C and 77.5 °C. 3. Samples that display Ct values will be processed for pyrosequencing. For more details of run analysis and troubleshooting, refer to the Getting started guides: Applied Biosystems ViiA™ 7 Real-Time PCR System (English), Booklet 2, Running standard curve experiments (https://www.thermofisher.com/). Exporting the run Run data and results can be exported by clicking Export in the navigation panel. 1. Check all the boxes including Sample Setup, Raw Data, Amplification, Multi- component, Results and Melt Curve Raw. 2. Chose a location and a file name for the exported file. 3. Saved file can be opened in Microsoft Excel for further analysis. Pyrosequencing of the LN12 assay amplicon Equipment and reagents • PyroMark Q24 Advance Instrument [catalogue number 9002270] • PyroMark Q24 Vacuum Workstation (110V) [catalogue number 9001516] • PyroMark Q24 Cartridge [catalogue number 97902] • Q24 Plate (100) [catalogue number 979201] • PyroMark Q24 Advanced Reagents kit [catalogue number 970902] • PyroMark Denaturation Solution (500 ml) [catalogue number 979007] • 10x PyroMark wash buffer concentrate (200 mL) [catalogue number 979008] • sequencing primer: Fwd1 for RABV sequencing, or Fwd1 and Fwd2mixture for other lyssaviruses; primers are prepared at a concentration of 10 µmol Laboratory techniques in rabies Fifth edition 86 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences • Streptavidin Sepharose High Performance beads (6% highly cross-liked Agarose) [GE Healthcare 17-5113-01] • 70% ethanol • 96-well PCR plate [Phenix research products, MPS-499] • 96-well PCR plate seal [Phenix research products, LMT-SEAL-EX] • highly purified water [Milli-Q 18.2 MΩ x cm or equivalent] • horizontal shaker • heat block • marker • timer • PyroMark Q24 Advanced 3.0.0 (software) Set up of the PyroLN12 assay Pyrosequencing requires a method that matches the method number on the cartridge. The method in this protocol is 13 and can be downloaded from the Qiagen website (https://www.qiagen.com/us/resources/technologies/pyrose- quencing-resource-center/managing-instrument-methods/pyromark-q24-ad- vanced/). The dispensation order and cycle of dNTP for the RABV SEQ assay were optimized; the dNTP is dispensed in the order of AACGT for 18 cycles and the method is saved as 18 (AACGT). 1. Save the method file on a computer that has the PyroMark Q24 Advanced 3.0.0 software installed on it. 2. Import the method file into the software by clicking Tools à Instrument Methods, click Import. 3. Find the saved Method 13, then click Open. 4. Close the Import window when the method file appears in it. 5. Click File in the toolbar and select New Assay à SEQ Assay. 6. In the SEQ Assay Setup screen, click Setup, enter 18(AACGT) in the Dispen- sation Order panel. 7. Leave other Settings and Analysis Parameters in default. 8. Save the assay file 18 (AACGT) on the computer. 9. Import the assay file 18 (AACGT) into the Shortcuts folder on the SEQ Assay Setup screen. Laboratory techniques in rabies Fifth edition 87 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Preparations at the beginning of the experiment 1. Bring the washing buffers and the denaturing buffer to room temperature from a 4 °C refrigerator. 2. Dilute 5.0 mL of 10x washing buffer with 45 mL of highly purified water to make a 1x working concentration. 3. Turn on the PyroMark Q24 Advanced Instrument. 4. Power on a heat block with a preset of 80 oC for later use in step 3.2.8. Immobilizing the PCR amplicon 1. Mix Streptavidin Sepharose beads by inversion. Do not vortex. 2. Prepare the master mix in a tube as in Table 34.3. 3. Distribute 70 µL master mix per well in a 96-well plate. 4. Transfer 10 µL PCR product (use one to third dilution if Ct < 20 to improve pyrosequencing read quality) into a reaction well containing the immobilizing buffer. Seal the PCR plate. 5. Shake the plate at 1400 r/min for 10 min. Run set up and loading reagents into the PyroMark Q24 cartridge 1. Click New Run à SEQ assay. 2. In the Run Setup screen, select Method 013 from the dropdown list of Instru- ment Method. 3. Enter run info into the Run Note panel. 4. In the Plate Setup panel, choose wells for your samples and enter sample names. 5. Highlight all reaction wells, apply the assay file 18 (AACGT). 6. Click Tools à Pre Run Information, write down the volumes of each reagent, Enzyme mix, Substrate mix and four nucleotides A, T, G, and C. Table 34.3. Preparation of master mix for DNA immobilization Components Volume per reaction (µL) Volume of master mixa = number of reactionsb x volume per reaction PyroMark binding buffer 40 Sepharose bead 1.0 Water 29 Total volume 70 a Prepare 10% extra volume. Laboratory techniques in rabies Fifth edition 88 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 7. Place the Cartridge on the bench with the label facing you. Note: Make sure the cartridge is dry at the time of use. 8. Load the volume of each reagent into its compartment. Caution: Make sure no air bubbles form inside the cartridge compartment during loading. 9. Tap the cartridge gently on the bench a few times to help settle reagents in the bottom of the cartridge. 10. Open the instrument lid and cartridge gate, insert the filled cartridge with the label facing out, and close the cartridge gate. 11. Save the run setup from the computer into a flash drive. 12. Insert the flash drive into the PyroMark Q24 advanced instrument and the setup file will be used during the sequencing run. Preparation of the sequencing primer of PyroLN12 The Fwd primer of the assay LN12 is used as the sequencing primer. 1. Prepare a sequencing primer stock at 10  µmol concentration. The working concentration of the sequencing primer is 0.375 µmol. 2. Dilute the sequencing primer using the PyroMark advanced annealing buffer to make a sufficient amount. 3. Mix and spin briefly to collect all the liquid to the bottom of tube. 4. Dispense 20 µL diluted sequencing primer to each well of a Q24 plate accor- ding to the run setup. Purification of template DNA 1. Switch on the PyroMark Q24 Vacuum pump. 2. Turn on the vacuum tool. 3. Prime the Filter Probes with 40 mL of highly pure water. 4. Place the PCR plate from Step 3.2.4 and the primer-filled Q24 plates on the vacuum station. 5. Slowly lower the filter probes of the vacuum tool into the PCR plate to capture the beads containing immobilized template. Hold the vacuum tool in the place for 15 s. Raise the vacuum tool and check for any PCR leftover in the wells of the 96-well PCR plate. Note: Beads sediment quickly, and capturing should take place immediately after the plate is set on the holder of the vacuum work station. If more than ONE min has elapsed, agitate the PCR plate again for one min. 6. Place the vacuum tool into the trough containing 40 mL 70% ethanol. Flush the filter probes for 5 s. 7. Transfer the vacuum tool into the trough containing 40 mL denaturation solu- tion. Flush the filter probes for 5 s. 8. Transfer the vacuum tool into the trough containing 40 mL wash buffer. Flush the filter probes for 10 s. 9. Raise the vacuum tool up and back beyond 90° vertical for 5 s to drain any liquid in the filter probes. Laboratory techniques in rabies Fifth edition 89 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 10. Switch off the vacuum tool, then turn off the vacuum. Detach the vacuum tool from the vacuum tubing. 11. Align the vacuum tool with the PyroMark Q24 plate and lower the filter probes into the diluted sequencing primer. Gently shake beads off the filter probes. 12. Reattach the vacuum tool to the vacuum, and power on the vacuum and switch on the vacuum tool. 13. Flush the filter probes in highly pure water for 10 s. Place the vacuum tool in the parking trough. 14. Turn off the vacuum pump. 15. Set up the pyrosequencing reactions following the steps in Table 34.4. Primer annealing 1. Transfer the Q24 plate containing the sequencing primer and DNA template to the heat block and heat it at 80 °C for 5 min. 2. Transfer the hot plate holder together with the Q24 plate from the heating block to the PyroMark Q24 advanced instrument. 3. Immediately place the Q24 plate into the PyroMark Q24 advance instrument. Ensure that the plate-holding frame is closed. Note: The time from removing the hot plate holder to placing the Q24 plate into the PyroMark Q24 advanced instrument should not exceed 30 s. Start the run 1. Select Run at the screen of PyroMark Q24 advance instrument. 2. Pick the run file from Step 3.2.5. 3. Click Run to start the reactions. Clean-up after the run 1. Open the PyroMark Q24 advanced instrument lid. 2. Take out and trash the Q24 plate. 3. Take out the cartridge. Discard the remaining solution. Table 34.4. Reaction setup for the PyroLN12 Reagents Volume per reaction Master mix a = reaction number x volume per reaction Sequencing primer Fwd1 (10 µmol)b 0.75 µL PyroMark advanced annealing buffer 19.25 µL Single-stranded DNA (the Sepharose beads from Step 3.2.7) Released in the wells with diluted primer Fwd1 Enzyme/substrate mix To be dispensed during sequencing Prepared in Step 3.2.5 Nucleotides To be dispensed during sequencing Prepared in Step 3.2.5 a Prepare 10% extra volume. b Sequence primer is diluted in the annealing buffer. Beads with captured DNA are released in the diluted primer solution. Laboratory techniques in rabies Fifth edition 90 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 4. Wash and “milk” it three times using high-purity water. 5. Watch the straight downright water jet during the “milking” process. Place the cartridge in a box for air drying and storage. 6. Turn off the instrument. Note: Discard the cartridge when usage reaches 30 runs, the cartridge is blocked or the water jet is not straight. Result analysis 1. Run result is stored automatically on the flash drive. Insert the drive into a computer with installed PyroMark Q24 Advanced software. 2. Open the software. Click File à Open the run file. 3. The run file is now open in SEQ mode. 4. On the SEQ screen, the top, middle, and bottom panels are plate Overview (I), Pyrogram (II) and Histogram (III) (Fig. 34.2). 5. To view a reaction, click it in the plate Overview (I). The run result will populate in the Pyrogram (II), Histogram (III), and the Well Information panel (IV). The info in General Warnings is useful for base calling analysis. 6. The called sequence of the selected sample is displayed on the top of the Pyro- gram panel. 7. Sequencing quality is colour coded, Blue: Passed; Yellow: Check; Red: Failed. 8. Called sequences of all samples can be exported by clicking Reports à SEQ Analysis Results, then choose All wells and Passed + Checked. Save it into a folder. Fig. 34.2. Analysis of PyroLN12 run Panel I summarizes the run results; the quality of base-calling is colour coded (blue, passed; yellow, checked; red, failed). The algorithm-called sequences of selected wells are listed at the bottom of panel I. The raw sequencing signal is in panel II for a selected well and the histogram of the sequencing results is in panel III. Panel IV contains error messages. Laboratory techniques in rabies Fifth edition 91 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Making a diagnosis and genetic typing using BLAST (Basic Local Similarity Searching Tool) 1. Go to the nucleotide Blast website at NCBI (https://blast.ncbi.nlm.nih.gov/ Blast.cgi). 2. Copy the called sequences (only blue- and yellow-coloured sequence) and paste into the query sequence box. 3. Perform Blast search using the program optimized for “Somewhat similar sequences”. 4. Among all the hit sequences, only top hits with the highest maximum scores are considered. 5. The sample is positive if the top hits contain RABV sequence(s). Additional notes 1. Reconstituted enzyme mix and substrate mix of the PyroMark Advanced reagent can be stored at 4 °C and last for one week. Unused aliquots can be stored at −20 °C. Do not thaw or freeze the reconstituted enzyme and substrate mix more than three times. 2. High-quality base calling of pyrosequencing usually has an initial peak value above 20. The initial peak height of a positive control is usually around 45–55 relative light units. If the initial peak value is lower than 20, discard the consti- tuted enzyme and substrate mix. 3. Never freeze and thaw the nucleotides of the kit. Freeze–thaw cycling raises background peaks, making base call more difficult. 4. Cartridges should not be used more than 30 times. Discard the cartridge if it is blocked. Keep a record of usage. 5. A Filter Probe can be used 100 times. It needs to be cleaned using sonication or replaced when usage reaches 100 times. Keep a time record of usage. 6. Streptavidin Sepharose beads (6%) should not exceed 1.0 µL per reaction. Overuse will cause baseline drifting. 7. Rinse troughs with high-purity water. Air dry and place them back into their position in the station. 8. The cartridge should be cleaned as soon as possible after a run has been completed to prevent a blockage in the cartridge. Laboratory techniques in rabies Fifth edition 92 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences References 1. WHO Expert Consultation on Rabies, third report. Geneva: World Health Organization; 2018 (WHO Technical Report Series, No. 1012; http://apps.who.int/ iris/bitstream/ handle/10665/272364/9789241210218-eng.pdf, accessed 1 October 2018 ). 2. Franka R, Smith TG, Dyer JL, Wu X, Niezgoda M, Rupprecht CE. Current and future tools for global canine rabies elimination. Antiviral Res. 2013;100:220–5. doi:10.1016/j. antiviral.2013.07.004. 3. Hampson K, Coudeville L, Lembo T, Sambo M, Kieffer A, Attlan M, et al. Estimating the global burden of endemic canine rabies. PLoS Negl Trop Dis. 2015;9:e0003709. doi:10.1371/journal.pntd.0003709. 4. Birhane MG, Cleaton JM, Monroe BP, Wadhwa A, Orciari LA, Yager P, et al. Rabies surveillance in the United States during 2015. J Am Vet Med Assoc. 2017;250:1117– 30. doi:10.2460/javma.250.10.1117. 5. Mani RS, Madhusudana SN. Laboratory diagnosis of human rabies: recent advances. ScientificWorldJournal. 2013; 2013:569712. doi:10.1155/2013/569712. 6. Wadhwa A, Wilkins K, Gao J, Condori Condori RE, Gigante CM, Zhao H, et al. Pan-lys- savirus Taqman real-time RT-PCR assay for the detection of highly variable rabies virus and other lyssaviruses. PLoS Negl Trop Dis. 2017;11(1):e0005258. doi:10.1371/ journal.pntd.0005258. PMCID: PMC5230753 following competing interests: Patents have been filed for assays described in this manuscript through CDC Technology Transfer Office/NIH Office. 7. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emerg Infect Dis. 2006;12:310–3. doi: 10.3201/eid1202.050812. 8. Dupuis M, Brunt S, Appler K, Davis A, Rudd R. Comparison of automated quantita- tive reverse transcription-PCR and direct fluorescent-antibody detection for routine rabies diagnosis in the United States. J Clin Microbiol. 2015;53:2983–9. doi:10.1128/ JCM.01227-15. 9. Harrington CT, Lin EI, Olson MT, Eshleman JR. Fundamentals of pyrosequencing. Arch Pathol Lab Med. 2013;137:1296–303. doi:10.5858/arpa.2012-0463-RA. 10. Heaton PR, Johnstone P, McElhinney LM, Cowley R, O’Sullivan E, Whitby JE. Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. J Clin Microbiol. 1997;35:2762–6. 11. Markotter W, Kuzmin I, Rupprecht CE, Randles J, Sabeta CT, Wandeler AI, et al. Isolation of Lagos bat virus from water mongoose. Emerg Infect Dis. 2006;12:1913–8. doi:10.3201/eid1212.060514. 12. De Benedictis P, De Battisti C, Dacheux L, Marciano S, Ormelli S, Salomoni A, et al. Lyssavirus detection and typing using pyrosequencing. J Clin Microbiol. 2011;49:1932–8. doi:10.1128/JCM.02015-10. 13. De Benedictis P, De Battisti C, Marciano S, Mutinelli F, Capua I, Cattoli G. Pyrosequen- cing of the rabies virus glycoprotein gene to demonstrate absence of vaccine-asso- ciated rabies cases following oral vaccination. Vet J. 2013;195:388–90. doi:10.1016/j. tvjl.2012.06.030. 14. Troupin C, Dacheux L, Tanguy M, Sabeta C, Blanc H, Bouchier C, et al. Large-scale phylogenomic analysis reveals the complex evolutionary history of rabies virus in multiple carnivore hosts. PLoS Pathog. 2016;12:e1006041. doi:10.1371/journal. ppat.1006041. Laboratory techniques in rabies Fifth edition 93 Part 6. Production of biologicals Part 6. Production of biologicals Laboratory techniques in rabies Fifth edition 94 Regulatory perspectives Part 6. Production of biologicals Chapter 35 Regulatory perspectives on the design of human rabies biologicals Introduction The regulation of medicines demands the application of sound scientific, medical and technical knowledge, and operates within a legal framework. While medicines regulation is often associated with administrative aspects, far more relevant is the science that supports it. All medicines should meet three main criteria: to be of acceptable quality, to be safe, and to be effective. Any judge- ments about these criteria should be based on solid science. The use of unsafe and low-quality medicines could lead to treatment failures, adverse effects, resistance to medicines and even death. In the case of rabies, the quality, safety and effectiveness of medicines are essential as the onset of clinical disease can only be prevented effectively by timely administration of rabies vaccine and rabies immunoglobulins (RIG) in the event of a severe expo- sure (WHO category III). Ineffective or poor-quality medicines could have detri- mental effects on patients, and also undermine the community’s trust in health systems, medical professionals, manufacturers and distributors. Moreover, finan- cial resources spent on ineffective and poor-quality medicines are lost – whether by patients or governments. This is a concern for rabies, which occurs mostly in developing countries with limited resources. Institutions such as WHO and national regulatory authorities ensure that the manufacture, use and distribution of medicines are adequately controlled. Medi- cines regulation is based on a number of documents including pharmacopoeial monographs, WHO guidance documents and regional guidelines (published e.g. by the United States Food and Drug Administration and the European Medicines Agency). These documents describe the requirements necessary to ensure that the safety and efficacy of medicines such as rabies biologicals are acceptable, assuring for instance that a tested vaccine does indeed induce neutralizing anti- bodies. A fundamental of medicines regulation is the evaluation of their quality. Quality control of rabies biologicals should be ensured at two levels: by the manufac- turer and by a national control authority, e.g. the national rabies laboratory or national veterinary service laboratory. Quality control will, for instance, ensure that the potency of RIG for rabies post-exposure prophylaxis (PEP) is correctly and accurately determined using virus neutralization assays in line with the regula- tory requirements, e.g. according to pharmacopoeial monographs (1) as further described in this chapter. Medicines regulation also addresses necessary inspections of manufacturers, ensuring that the medicines are compliant with good practice (GxP) regulations. The “x” in GxP is a variable that stands for manufacturing, clinical, laboratory, or clinical laboratory. For example, GMP (Good Manufacturing Practice) covers all Laboratory techniques in rabies Fifth edition 95 Regulatory perspectives Part 6. Production of biologicals aspects of production from starting materials, premises and equipment to the trai- ning and personal hygiene of staff. Detailed, written procedures are essential for each process that could affect the quality of the finished product. Systems must be available to provide documented proof that correct procedures are consistently followed at each step in the manufacturing process, each time a product is made.  Regulatory requirements evolve over time following the course of scientific progress. Substantial scientific advances have been made to improve the methods of producing rabies vaccines and RIG and in developing new assays and tests. Major advances in molecular biology techniques have been extensively applied, for instance to express recombinant monoclonal antibodies directed against the rabies virus (RABV) glycoprotein for testing in clinical trials (2, 3). Thus, additional regulatory requirements need to be taken into consideration nowadays by rabies researchers and professionals, such as the existing guidelines and pharmaco- poeial monographs for monoclonal antibodies (4, 5). There has been a great deal of efforts to align regulatory requirements across the world. The establishment of the International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) in 1990, a collaborative initiative among the European Union, Japan and the United States with observers from WHO, the European Free Trade Association and Canada, was a milestone in facilitating the harmonization of medicines regulation (6). ICH guide- lines focus primarily on technical requirements for new, innovative medicines. Outside of the ICH regions and associated countries, many regulatory requi- rements have been addressed by WHO. In the field of quality assurance of medi- cines, WHO plays an important role, especially for those countries with few means to develop their own quality controls, and helps national competent authorities with various activities such as creating nomenclatures, guidelines, delivering trai- ning and awareness courses, and fostering discussions surrounding regulatory science to build and increase capacity. A regulatory tool particularly relevant for developing countries is the “WHO prequalification of medicines”, a process which vets promising medicines around the world. Prequalification is often a condition under which international donors, such as the vaccine alliance GAVI, consider procuring them. The WHO Prequalifi- cation of Medicines Programme helps ensure that medicines supplied by procure- ment agencies meet acceptable standards of quality, safety and efficacy (7). The work of WHO is supported and complemented by other organizations and authorities, using specific regulatory pathways such as the European Union Article 58 of Regulation (EC) No 726/2004. This procedure enables the European Medi- cines Agency (EMA) to assess products and provide scientific advice for WHO. A procedure based on Article 58 includes an EMA assessment of the quality, safety and efficacy of a medicine intended for use outside the European Union, based on the same standards and procedures as those for medicines marketed in the Euro- pean Union. Article 58 has been applied successfully in recent years, for example for assessment of the malaria vaccine Mosquirix and anti-HIV medicines (8). Laboratory techniques in rabies Fifth edition 96 Regulatory perspectives Part 6. Production of biologicals Regulatory challenges for rabies biologicals To facilitate the availability of safe, effective and good-quality medicines, products such as RIG and vaccines need to be tested in laboratories, as mandated by their pharmacopoeial monographs. One challenge in testing rabies biologicals is the need for high-containment biosecure laboratories, e.g. for measuring the neutralizing potency of RIG or neutralizing antibodies in serum following vaccina- tion. Serological methods to analyse vaccine-induced humoral responses to RABV include the fluorescent antibody virus neutralization (FAVN) test (see Chapter 20), the rapid fluorescent focus inhibition test (RFFIT), discussed in Chapter 19, and the enzyme-linked immunosorbent assay, ELISA (9) as well as variations of the aforementioned assays (10, 11). The routinely used FAVN assay and RFFIT are the assays of choice with OIE/ WHO reference laboratories and make use of live virus neutralization assays. The standard methods to test for neutralizing antibodies against RABV involve high containment, Biosafety Level 3 facilities; however, most rabies-endemic countries have resource-limited laboratories and performing the assays under high contain- ment presents several financial and logistical challenges. To address these issues, several techniques have been developed, including the pseudotype neutralization assay (PNA) (12, 13). Pseudotypes are viruses that carry the genome and core of one virus and the envelope of another. RABV pseudotypes have been constructed using lentiviral backbones and an analytical method established that utilizes these replication-incompetent viruses to accurately measure neutralizing antibody titres. This method has the advantage of allowing experiments to be conducted in category 2 biosafety laboratories as the pseudotypes cannot replicate and are unable to cause a lasting infection (12, 13). The assay also benefits from detecting virus neutralizing antibody alone, in contrast to ELISA, and gives a more detailed picture of the protective antibodies present (as not all virus-binding antibodies are necessarily neutralizing). Furthermore, the RABV pseudotypes were demonstrated to be stable during freeze–thaw cycles and storage at room temperature, confir- ming that the proposed analytical method could be a useful option for conducting neutralization studies in regions most affected by these infections (12, 13). Although not currently registered in pharmacopoeias, such an assay would be ideally suited for use in resource-limited countries and should be incorporated in the relevant guidance and monographs in future. Apart from the financial and logistical challenges associated with current neutralization assays, low accessibility to medicines for post-exposure prophy- laxis (PEP) is problematic across many rabies-endemic countries. Access to the recommended complete PEP regimen components such as RIG remains insuffi- cient. Human RIG (HRIG) is widely unavailable in rabies-endemic countries and its supply depends on a limited number of vaccinated individuals as donors (14). Cheaper equine rabies immunoglobulins (ERIG) are available in limited quantities but several manufacturers are discontinuing ERIG production. The remaining ERIG manufacturers are mainly local ones with limited capacities for expansion. In the past, there were also some safety concerns regarding adverse events in recipients of ERIG, although purification techniques have advanced and the safety profile of ERIG has greatly improved. Adverse events with ERIG have been mitigated by generating antibody fragments lacking the equine antibody Fc region, i.e. F(ab’)2 fragments, but these are less potent than whole antibodies and usually have only Laboratory techniques in rabies Fifth edition 97 Regulatory perspectives Part 6. Production of biologicals a few days of half-life. Thus, a widely available product that could be used along- side HRIG and ERIG would be highly desirable. The use of monoclonal antibodies (MAbs) could address the low availability of RIG and overcome variability in specificity and potency. MAbs can be produced in cell lines using large bioreactors and can therefore easily be expanded to address the low availability of RIG. While MAbs have significant promise as rabies PEP agents, they are not without limitations, including expense, but some low-cost production platforms have been described (15, 16). As MAbs come in the form of a concentrated product, they may also be more effective than polyclonal serum at wound infiltration, and thereby reduce the introduction of excess volume at the site of intramuscular injection, which in turn could lead to a better local tolerabi- lity (2). While MAbs are a step ahead in terms of scalability and lot-to-lot consistency, navigating the complicated clinical development path for rabies MAbs and asso- ciated ethical considerations remains complicated. Their effect may be difficult to measure in any feasible clinical trial, particularly for phase III efficacy studies. Most trials so far have been conducted in the non-RABV exposed population, which allow the study of different components and combined regimens of esta- blished and proposed PEP. Initial exploration of tolerability of a novel rabies MAb and information about adverse events can be understood from these types of trials. While early stage clinical trials in non-RABV exposed healthy volunteers can provide some information about the safety and tolerability of a medicine, the rela- tion to protection against disease when used after exposure may be complex. A range of factors could potentially contribute to the absence of RABV after recei- ving PEP following a suspected exposure; thus, the absence of clinical disease may not indicate the effect of the antibody component. Differences in bite sites, viral strains and animal vectors might influence any studies in a population poten- tially exposed to RABV. The risk of developing rabies after a suspected expo- sure depends on multiple factors, such as whether the biting animal was rabid, whether the animal was shedding RABV, how close the bite was to the central nervous system, whether the bite site was thoroughly cleaned, and whether an appropriate rabies vaccination series was initiated and completed. While a placebo control would put patients at inappropriate risk and might not be ethically possible for rabies in a clinical trial setting, the use of HRIG for compa- rison presents some challenges including its low availability and the fact that the efficacy of the RIG/vaccine combination has not been rigorously tested under controlled conditions, as stated in the Imogam HRIG product label. Close atten- tion must therefore be paid to the clinical trial design, to ethical considerations of such testing in adults and children, and to measurements that might aid our understanding about whether a new rabies MAb product provides early protection without increasing vaccine interference. Worldwide, several rabies MAbs are in various stages of development (17). One MAb has received a marketing authorization in a pioneering project completed by MassBiologics and the Serum Institute of India (3, 18). A phase I clinical trial and a phase II/III trial were undertaken for this Mab. The phase II/III randomized, single blind, non-inferiority study was conducted in 200 participants with WHO category III suspected  rabies  exposures. Study participants received proper Laboratory techniques in rabies Fifth edition 98 Regulatory perspectives Part 6. Production of biologicals wound care followed by injections of either the investigational MAb or the stan- dard HRIG treatment in combination with the vaccine (18). On Day 0, participants received either the MAb or HRIG (1:1 ratio) into wounds and, if required, five doses of rabies vaccine intramuscularly on days 0, 3, 7, 14 and 28. The primary end-point was the ratio of day 14 geometric mean concentration of rabies virus neutralizing antibodies (RVNA) activity as measured by RFFIT for MAb recipients relative to HRIG recipients. Initially, only patients with category III exposures on the lower extremities were enrolled, followed by evaluation in patients with any type of category III exposure after interim analysis. No case of PEP failure or rabies was observed during the study period. The PEP regimen containing the MAb was safe and demonstrated non-inferiority to HRIG PEP in neutralizing anti- body production. A marketing authorization was received in India in October 2016 and an event announcing the launch of this antibody (branded as Rabishield) was held in October 2017 in Mumbai. Two presentations of the MAb are available, including a 100 IU/2.5 mL (40 IU/mL) vial and a 250 IU/2.5mL (100/mL) vial (19). According to the Serum Institute of India, Rabishield might be offered at a cost 25% cheaper than existing RIGs (20). It will be interesting to see how this innovative product is taken up by medical professionals. The availability of this MAb could fill critical public health gaps. As it is made by recombinant technology, it will be less prone to problems such as availability, safety and purity. It should be recommended for use in public health programmes, depending on the epidemiological and geographical setting, with monitoring of its safety and efficacy (clinical outcomes) during post-marketing use. The advent of this MAb presents an important step in making rabies PEP more accessible, and cost savings compared with RIG might be even more pronounced once additional MAbs are licensed. Another project on rabies MAbs, initiated by the WHO Rabies Collaborating Centres (21), provided several MAbs for inclusion in an antibody cocktail. Two MAbs were selected based on their strong potencies and different epitope specifi- cities and were transferred to other parties and manufacturers. Preclinical studies of the WHO MAbs were undertaken by multiple groups (22, 23); the Indian company Zydus Cadila has taken the MAbs into clinical trials. Another project on a Mab cocktail comprising two MAbs was undertaken by Crucell (2); however, the company was sold following phase II clinical trials and product development was discontinued. Clinical trials for a MAb combination have also been initiated by Synermore Biologics, China (17, 24). Finally, several other companies including the Korean biologicals manufacturer Celltrion have generated strong preclinical data (25) which could pave the way for clinical studies of their MAbs. The following sections will focus on general quality requirements for rabies biologicals, whether they are MAbs, RIGs or rabies vaccines. Laboratory techniques in rabies Fifth edition 99 Regulatory perspectives Part 6. Production of biologicals Specifications and controls A specification is a list of tests and methods with appropriate acceptance criteria, such as numerical ranges or other criteria for the tests described. The tests concern the active substance, finished product or, potentially, materials at other stages of their manufacture. “Conformance to specification” means that the drug substance and drug product, when tested according to the listed analytical procedures, will be compliant with their prespecified acceptance criteria. Specifications are just one part of a total control strategy designed to ensure quality and consistency of products. Other parts of this strategy include extended characterization during development, compliance with Good Manufacturing Prac- tice (GMP), validation of the manufacturing process, validation or qualification of the analytical methods, quality of raw materials, in-process testing and stability studies. Specifications are chosen to corroborate the quality of the active subs- tance and finished product and should not focus on all quality attributes, but rather on those that are most relevant for the safety and efficacy of the medicine. Minimum standards for specifications are listed in monographs and usually include at least identity, potency and impurities. Additional product-specific specifications are set by the manufacturers and must be assessed by regulatory authorities before approval of products. Specifications and limits can be set for both the active substance (often also referred to as drug substance) and the fini- shed product (often also referred to as drug product). Pharmacopoeial specifications apply to all products across a class (e.g. rabies cell culture vaccines), independent of their manufacturer. These limits are decided by pharmacopoeial committees, e.g. at the European Directorate for the Quality of Medicines (EDQM) in Strasbourg, France. Conversely, product-specific specifi- cations are set for each individual product by their respective manufacturer. Since specifications are chosen to confirm the quality rather than to fully characterize each product batch, the manufacturer must provide the justification for inclu- ding and/or excluding testing for specific quality attributes. The following points are usually taken into consideration by manufacturers and regulatory agencies when reviewing proposed specifications: specifications should be based on data obtained from lots used to demonstrate manufacturing consistency; they should account for the stability of drug substance and drug product; they are linked to qualified or validated analytical procedures; and they should be based on data obtained for lots used in preclinical and clinical studies. Both pharmacopoeial specifications and product-specific specifications for representative rabies biologicals are further described in the following para- graphs. The setting of specifications and limits is often accompanied by appro- priate control standards, such as the international standard for rabies immunoglo- bulins. Standards are important to ensure that repeatability and reproducibility are maintained. The first international standard for HRIG was established in 1985 and the second was established in 1993 (26). Laboratory techniques in rabies Fifth edition 100 Regulatory perspectives Part 6. Production of biologicals Pharmacopoeial specifications Pharmacopoeias contain important requirements pertaining to certain analy- tical procedures and acceptance criteria, which, where relevant, are part of the evaluation of either the active substance or the finished product. Such mono- graphs, applicable to biological products including rabies vaccines or immuno- globulins, generally include, but are not limited to, tests for sterility, endotoxins, microbial limits, volume in container, uniformity of dosage units and particulate matter. Compliance with available monographs is mandatory, but all tests listed in a monograph do not necessarily have to be performed at release. When agreed by the competent authority, alternative (validated) methods may be used for control purpose. Several pharmacopoeias are in use around the world, e.g. the European Phar- macopoeia (Ph. Eur.), the British Pharmacopoeia (BP) and the United States Phar- macopoeia (USP). These monographs contain the basic requirements for medi- cines, and their content should theoretically also be largely applicable to other regions. As an example, the Ph. Eur. monograph with the specifications for HRIG is summarized below (for full details, refer to Ph. Eur. monograph 0723, Immuno- globulinum humanum rabicum). The Ph. Eur. specifications for RIG include require- ments for definition/identity, potency limits and methods, culture medium, storage and labelling: Definition Sterile liquid or freeze-dried preparation containing immunoglobulins, mainly immunoglobulin G. The preparation is intended for intramuscular administration. It is obtained from plasma from donors immunized against rabies. It contains specific antibodies neutralizing the rabies virus. Human normal immunoglobulin for intramuscular administration (monograph 0338) may be added. It complies with the monograph on Human normal immunoglobulin for intramus- cular administration  (0338), except for the minimum number of donors and the minimum total protein content. Potency The potency is determined by comparing the dose of immunoglobulin required to neutralize the infectivity of a rabies virus suspension with the dose of a refe- rence preparation, calibrated in international units (IU), required to produce the same degree of neutralization. The test is performed in sensitive cell cultures and the presence of unneutralized virus is revealed by immunofluorescence. The IU is the specific neutralizing activity for rabies virus in a stated amount of the Inter- national Standard for anti-rabies immunoglobulin. The equivalence in IU of the International Standard is stated by WHO. Human rabies immunoglobulin BRP is calibrated in IU by comparison with the International Standard. Laboratory techniques in rabies Fifth edition 101 Regulatory perspectives Part 6. Production of biologicals Methods The method for the neutralization assay in suitable cells such as the BHK-21 cell line is described in detail in the monograph. The stated potency is not less than 150 IU/mL. The estimated potency is not less than the stated potency and is not greater than twice the stated potency. The confidence limits (P = 0.95) are not less than 80% and not more than 125% of the estimated potency. Culture medium The culture medium for growth of BHK-21 cells is described in the monograph. Storage and labelling The monograph states requirements for storage and labelling (in IU). As RIG is derived from blood donations, certain regulatory requirements for blood products apply. These products need to be treated to eliminate or reduce any risks of transmission of infectious agents. Briefly, plasma donors are initially screened for exposure to a range of viruses. After fractionation with cold ethanol of plasma from vaccinated donors, the HRIG products such as HyperRAB S/D and Imogam Rabies-HT are treated to eliminate potential pathogens. Use of HRIG in the USA has not resulted in any known cases of transmission of infectious agents (14). For blood products such as HRIG, only donations from qualified donors (“Regular donors”) are accepted for fractionation. To qualify, applicant donors (“First time donors” and “Repeat donors”) usually have to pass a history of two accepted donations given within 6 months of each other. For source plasma, the National Donor Deferral Registry (NDDR) allows donor deferral information to be shared on a confidential inter-company nationwide basis. This ensures that any donor who has been deferred at one centre under NDDR criteria may not donate at another (27). Each manufacturer also operates an inter-centre deferral to ensure that “higher risk” donors are excluded. Donors are encouraged to donate regularly, resulting in frequent virus testing and review of post-donation information. A quali- fied donor who has not donated plasma for 6 months reverts to applicant donor status. All donations are tested at least for Hepatitis B surface antigen (HBsAg), anti-HCV and anti-HIV 1 and 2 antibodies. The lower incidence of positive results in qualified than in applicant donors confirms the effectiveness of donor selection, testing and exclusion in limiting the risk of transmitting infections in plasma. A three-stage system is usually in place to ensure the safety of blood products such as RIG, namely: 1. Selection of healthy donors, with all donations tested and traceable to the donor; 2. Further safety tests of plasma minipools and pools in advance of the manufac- turing process; and 3. Virus removal and inactivation steps during the manufacturing process (e.g. low pH virus inactivation steps, virus filtration, heat treatment). Laboratory techniques in rabies Fifth edition 102 Regulatory perspectives Part 6. Production of biologicals Manufacturers’ product specifications In contrast to the pharmacopoeial specifications mentioned in the preceding paragraphs, product-specific specifications are set for each individual product by their respective manufacturer and are part of the registration process for each individual rabies vaccine and immunoglobulin. These specifications are critical quality standards that are proposed and justified by the manufacturer and reviewed by regulatory authorities as conditions of approval. They vary depending on the manufacturing process and are usually part of commercially confidential information provided in marketing authorization dossiers; hence they will not be described here. However, some general considerations apply: specifications set by the manufacturer should take into account the control of raw materials and excipients, in-process testing, process evaluation or validation, batch analysis data and stability. Finished product specifications should normally also be justi- fied with reference to batch analysis data from clinical trial batches and the limits for potency/purity/impurities should be clinically qualified. An in-depth characterization of a biological product by appropriate methods is necessary to allow suitable specifications to be set. Extensive characterization is performed in the development stages of a product and occasionally after licen- sing following substantial process changes. Heterogeneity may be observed during manufacture and/or storage of the drug substance or drug product. The degree of this heterogeneity should be evaluated, to assure consistency between production lots. When these variants have proper- ties closely related to those of the desired product with respect to activity, effi- cacy and safety, they are considered product-related substances. When process changes and degradation products result in heterogeneity patterns which are not clinically qualified, i.e. they differ from those observed in the material used during preclinical and clinical development, the significance of these alterations must be further investigated. Purity The absolute as well as relative purity should be analysed using suitable analy- tical methods. Traditionally, the relative purity of a biological product is expressed in terms of specific activity (that is, units of biological activity per mg of product) which could be highly method-dependent. Thus, the purity of the drug substance and drug product is usually assessed by a range of analytical methods. For the purpose of lot release, an appropriate set of methods is selected and justified for determination of purity. Impurities The manufacturer should assess impurities, either process or product-related. When adequate quantities of impurities can be enriched, they should be evaluated to the extent possible, including their impact on biological activity. Product-related impurities (e.g. precursors, certain degradation products) encompass molecular variants arising during manufacture and/or storage, which do not have properties comparable to those of the desired product with respect to activity, efficacy, and safety. Process-related impurities are those that are derived from the manufac- turing process, i.e. cell substrates (e.g. host cell proteins, host cell DNA), cell Laboratory techniques in rabies Fifth edition 103 Regulatory perspectives Part 6. Production of biologicals culture (e.g. inducers, antibiotics, or media components), or materials used in downstream processing. The acceptance criteria for impurities should be based on data obtained from lots used in preclinical and clinical studies and manufactu- ring consistency lots. Contaminants Contaminants include all adventitiously introduced materials not intended to be part of the manufacturing process, such as chemicals or microbial proteases. Contaminants should be strictly avoided and/or suitably controlled with appro- priate in-process acceptance criteria or action limits for drug substance or drug product specifications. In-process controls In addition to specifications for the active substance and the finished product, so called in-process controls (IPC) and tests are performed at critical decision-ma- king steps during manufacture. These data should be used to confirm consistency of the process during the production of either the active substance or the fini- shed product. The results of in-process testing may be recorded as action limits or reported as acceptance criteria. Performing such testing may eliminate the need for testing of the active substance or finished product. In-process testing for adventitious agents at the end of cell culture is an example of testing for which acceptance criteria should be established. Data obtained during development and validation runs should provide the basis for provisional action limits to be set for the manufacturing process. These limits, which are the responsibility of the manufacturer, may be used to initiate investigation or further action. They should be further refined as additional experience and further data are obtained after product approval. Raw materials and excipient specifications The quality of the raw materials used in the production should meet standards. Moreover, the quality of the excipients should meet pharmacopoeial standards. Otherwise, suitable acceptance criteria should be established for any non-phar- macopoeial excipients. Release limits vs shelf-life limits The stability of the medicine should be established, and an appropriate shelf- life should be set. The limits might be different for release and during shelf-life, i.e. limits are usually tighter for the release than for the shelf-life of the drug substance or drug product, e.g. in the case of potency and degradation products. Future perspectives An interesting development that could help advance the regulation of medi- cines such as rabies biologicals is the launch of an African Medicines Agency (AMA) (28). The AMA is intended to be an organ of the African Union legally mandated by Member States to provide a platform for coordination and stren- gthening of ongoing initiatives to harmonize the regulation of medicines. The remit Laboratory techniques in rabies Fifth edition 104 Regulatory perspectives Part 6. Production of biologicals of the AMA will be to speed up the availability of affordable medicines that are needed on the continent and reduce dangerous, poor-quality and falsified medi- cines. It will protect public health across 54 Member states, serving 1.13 billion African people. Like the EMA, its European counterpart, the AMA will not replace national regulators, who will continue their work to register medicines that are safe and efficacious for their own populations. Instead, the AMA will provide regulatory guidance, oversee emerging issues such as pandemics, review adverse effects of medicines and vaccines, and conduct inspections of manufacturing facilities to check that medicines are being manufactured at good international manufactu- ring quality standards. The agency has been set up by African Heads of State and Government with help from the WHO Regional Committee for Africa, as the result of a longstanding strategy to improve regulatory capacity on the continent (29). The establishment of the AMA, together with the advent of rabies MAbs and innovations such as pseudotype neutralization assays, should contribute to the widespread availability of high-quality, safe and effective rabies biologicals in the future. References 1. Immunoglobulinum humanum rabicum. In: European Pharmacopoeia, 9th edition monograph 0723; (http://www.uspbpep.com/ep60/human%20rabies%20 immunoglobulin%200723e.pdf, accessed 1 October 2018). 2. Bakker AB, Python C, Kissling CJ, Pandya P, Marissen WE, Brink MF, et al. First administration to humans of a  monoclonal antibody  cocktail against  rabies  virus: safety, tolerability, and neutralizing activity. Vaccine. 2008;26:5922–7. doi:10.1016/j.vaccine.2008.08.050. 3. Gogtay N, Thatte U, Kshirsagar N, Leav B, Molrine D, Cheslock P, et al. Safety and pharmacokinetics of a human monoclonal antibody to  rabies  virus: a randomized, dose-escalation phase 1 study in adults. Vaccine. 2012;30:7315– 20. doi:10.1016/j.vaccine.2012.09.027. 4. Monoclonal antibodies for human use. In: European Pharmacopoeia, 9th edition (monograph 2031; http://www.uspbpep.com/ep60/monoclonal%20 antibodies%20for%20human%20use%202031e.pdf, accessed 1 October 2018). 5. Guideline on development, production, characterisation and specification for monoclonal antibodies and related products. London (UK): European Medi- cines Agency; 2016. 6. ICH guidelines. In: ICH: harmonization for better health [website]. Geneva: International Council for Harmonisation of technical Requirements for Phar- maceuticals for Human Use (http://www.ich.org/products/guidelines.html, accessed 1 October 2018). 7. Prequalification of medicines by WHO [fact sheet]. Geneva: World Health Organization; 31 January 2013 (http://www.who.int/mediacentre/factsheets/ fs278/en/, accessed 1 October 2018). Laboratory techniques in rabies Fifth edition 105 Regulatory perspectives Part 6. Production of biologicals 8. Medicines for use outside the European Union. In: Marketing authorisa- tion [website]. London (UK): European Medicines Agency (http://www.ema. europa.eu/ema/index.jsp?curl=pages/regulation/document_listing/docu- ment_listing_000157.jsp, accessed 1 October 2018). 9. Cliquet F, McElhinney LM, Servat A, Boucher JM, Lowings JP, Goddard T. Development of a qualitative indirect ELISA for the measurement of rabies virus-specific antibodies from vaccinated dogs and cats.  J Virol Methods. 2004;117:1–8.  doi:10.1016/j.jviromet.2003.12.001. 10. Brookes SM, Parsons G, Johnson N, McElhinney LM, Fooks AR. Rabies human diploid cell vaccine elicits cross-neutralising and cross-pro- tecting immune responses against European and Australian bat lyssa- viruses. Vaccine. 2005;23:4101–4109. doi:10.1016/j.vaccine.2005.03.037. 11. Khawplod P, Inoue K, Shoji Y, Wilde H, Ubol S, Nishizono A. A novel rapid fluorescent focus inhibition test for rabies virus using a recombinant rabies virus visualizing a green fluorescent protein. J Virol Methods. 2005;125:35– 40. doi:10.1016/j.jviromet.2004.12.003. 12. Wright E, Temperton NJ, Marston DA, McElhinney LM, Fooks AR, Weiss RA. Investigating antibody neutralization of lyssaviruses using lentiviral pseudotypes: a cross-species comparison.  J Gen Virol.  2008;89:2204–13. doi:10.1099/vir.0.2008/000349-0. 13. Wright  E, McNabb S, Goddard T, Horton DL, Lembo T, Nel LH, et al. A robust lentiviral pseudotype neutralisation assay for in-field serosurveillance of rabies and lyssaviruses in Africa. Vaccine. 2009;27:7178–86. doi:10.1016/j. vaccine.2009.09.024. 14. Both L, Banyard AC, van Dolleweerd C, Horton DL, Ma JK, Fooks AR. Passive immunity in the prevention of rabies. Lancet Infect Dis. 2012;12:397–407. doi:10.1016/S1473-3099(11)70340-1. 15. Both L, van Dolleweerd C, Wright E, Banyard AC, Bulmer-Thomas B, Selden D, et al. Production, characterization, and antigen specificity of recombinant 62-71-3, a candidate monoclonal antibody for rabies prophylaxis in humans. FASEB J. 2013;27:2055–65. doi:10.1096/fj.12-219964. 16. Ko K, Tekoah Y, Rudd PM, Harvey DJ, Dwek RA, Spitsin S, et al. Function and glycosylation of plant-derived antiviral monoclonal antibody. Proc Natl Acad Sci U S A. 2003;100:8013–8. doi:10.1073/pnas.0832472100. 17. Rabies monoclonal antibodies post exposure (http://www.who.int/rabies/ resources/Summary-rabies-mAbs-for-Web_Dec2016.pdf, accessed 1 October 2018). 18. Gogtay NJ, Munshi R, Ashwathnarayan DH, Mahendra BJ, Kshirsagar V, Gunale B, et al. Comparison of a novel human rabies monoclonal antibody to human  rabies  immunoglobulin for post-exposure prophylaxis: a phase 2/3 randomized, single blind, non-inferiority, controlled study. Clin Infect Dis. 2018;66:387–95. doi:10.1093/cid/cix791. Laboratory techniques in rabies Fifth edition 106 Regulatory perspectives Part 6. Production of biologicals 19. Rabishield: rabies human monocloncal antibody. In: Products supplied over- seas [webpage]. Pune: Serum Institute of India PVT Ltd (https://www.seru- minstitute.com/product_recombinant5.php, accessed 1 October 2018). 20. AdarPoonawalla, CEO Serum Institute of India: “Our new drug – Rabishield – is a first-of-its-kind product for passive immunization against rabies [news article]. In: Indian News & Times; 2018. http://www.indiannewsandtimes. com/2017/10/31/63925our-new-drug-rabishield-is-a-first-of-its-kind-pro- duct-for-passive-immunization-against-rabies/, accessed 1 October 2018). 21. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Development of a mouse monoclonal antibody cocktail for post-ex- posure  rabies  prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. 22. van Dolleweerd CJ, Teh AY, Banyard AC, Both L, Lotter-Stark HC, Tsekoa T, et al. Engineering, expression in transgenic plants and characterisa- tion of E559, a  rabies virus-neutralising monoclonal antibody. J Infect Dis. 2014;210:200–8. doi:10.1093/infdis/jiu085. 23. Tsekoa TL, Lotter-Stark T, Buthelezi S, Chakauya E, Stoychev SH, Sabeta C, et al. Efficient in vitro and in vivo activity of glyco-engineered plant-pro- duced rabies monoclonal antibodies E559 and 62-71-3. PLoS One. 2016;11:e0159313. doi:10.1371/journal.pone.0159313. 24. Chao TY, Ren S, Shen E, Moore S, Zhang SF, Chen L, et al. SYN023, a novel humanized monoclonal antibody cocktail, for post-exposure prophy- laxis of rabies. PLoS Negl Trop Dis. 2017;11:e0006133. doi:10.1371/journal. pntd.0006133. 25. Kim PK, Keum SJ, Osinubi MOV, Franka R, Shin JY, Park ST, et al. Deve- lopment and characterization of novel chimeric monoclonal antibodies for broad spectrum neutralization of rabies virus. PLoS One. 2017;12:e0186380. doi:10.1371/journal.pone.0186380. 26. Other rabies biological products. In: Rabies [website]. Geneva: World Health Organization; 2018 (http://www.who.int/rabies/resources/other_rabies_ biolog_product/en/, accessed 1 October 2018). 27. National Donor Deferral Registry. In: Quality and standards [website]. Plasma Protein Therapeutics Association (http://www.pptaglobal.org/plas- ma-protein-therapies/overview?catid=0&id=19, accessed 1 October 2018). 28. African Medicines Agency [news story]. In: New Partnership for Africa’s Development (NEPAD) [website]; 22 February 2017 (http://www.nepad.org/ content/african-medicines-agency, accessed 1 October 2018). 29. Zarocostas J. Health ministers adopt African Medicines Agency treaty. Lancet. 2018;391:2310. doi:10.1016/S0140-6736(18)31313-8. Laboratory techniques in rabies Fifth edition 107 Regulatory issues Part 6. Production of biologicals Chapter 36 Regulatory issues in the development of animal biologicals for rabies Introduction Vaccinating domestic animals against rabies creates an effective barrier between the human population and rabies reservoirs. In multiple countries, mass canine vaccination yields a concomitant decrease in the incidence of human rabies cases (1–4). For this reason, many countries require vaccination of dogs and cats, and have strict requirements for importation of these animals regarding rabies vaccination status. Under some conditions of herd health management, it may be advisable to vaccinate livestock as well, especially in areas endemic for rabies where exposure to lyssavirus virus vectors is likely, such as with vampire bat exposure in the New World (5). In addition, vaccination of wildlife reservoirs can be a powerful tool for controlling endemic rabies in susceptible wildlife popu- lations (2–4, 6, 7). These efforts can further reduce human exposure by decreasing the likelihood of direct human contact with a rabid wild animal, and the likelihood of domestic animal contact and subsequent secondary human exposure. Hence, use of veterinary rabies vaccines can substantially reduce human exposures, resulting in fewer human deaths and reduced need for expensive post-exposure prophylaxis (PEP) in humans. Similarly, licensed diagnostic kits may be used for the detection of viral antigens, antibodies and amplicons from suspect animals. Regulatory considerations concerning vaccines for use in domestic animals Regulatory approval of rabies vaccines for use in domestic animals should be based upon solid evidence of their safety, purity, potency and efficacy. Early vaccines were based upon rabies virus (RABV) grown in adult or suckling animal brain tissue (3). While these products provided a much-needed tool for control of rabies in domestic animals, they are now obsolete and, given the high rates of adverse events, should not be considered for use. Tissue culture origin, inac- tivated vaccines and recombinant vaccines are now the preferred candidates for use in domestic animals. Worldwide, many vaccines are available for use in domestic animals. For example, products available from the United States, Canada, the European Union, Australia, New Zealand and Japan have met rigorous standards of safety, purity, potency and efficacy as required by these countries and regions. While the requirements for approval of rabies vaccines have not been harmonized worldwide, competent regulatory authorities use similar principles to assure that products are safe, pure, potent and effective. Evaluation for safety should include laboratory studies in host and non-host animals, as well as large-scale field studies. Batch safety should be confirmed either by laboratory and/or host animal testing and through demonstration of a high level of consistency in production. Laboratory techniques in rabies Fifth edition 108 Regulatory issues Part 6. Production of biologicals Evaluations for purity should begin with using a Master Seed and Master Cell concept. The cell cultures and virus seeds used should be characterized thoroughly and shown to be free of adventitious agents, before being approved for vaccine production. In addition, purity checks should be done at various stages of production. These might include testing of working seeds, production seeds and harvested bulks. Finally, each batch should be tested for mycoplasma, fungal, and bacterial contamination after filling of final containers. Assays should be well validated and should include proper controls to ensure assay integrity. Potency testing will be dependent upon the nature of the product. Currently, the standard approach for inactivated rabies vaccines for most countries is the NIH test or a modification of this assay (8). Briefly, mice are vaccinated with finished product, then challenged with a standard rabies challenge virus (see Chapter 42). This assay has been in place since the 1950s, and has several drawbacks. The assay takes at least one month to perform, and the outcome is highly variable. This results in frequent “no tests” because of the stringent validity requirements, requiring frequent retests. The assay is costly to run, represents a human health risk and results can vary dramatically from one operator to the next based on experience with the assay. In addition, the test relies on a standard reference vaccine, which must be replenished or replaced frequently (9). Efforts have been made to replace the mouse potency assay, but because most inactivated rabies vaccines for animals include an adjuvant, the development of an ELISA or other assay platform is complicated by the need to break the emulsion or dissociate antigen from the adjuvant (8, 10). This has proven challenging and, to date, there is no well-characterized, well-validated assay to replace the National Institutes of Health test for veterinary vaccines. However, efforts are ongoing to define a replacement test or battery of tests to measure potency (10, 11). Currently, most of the work being done is based on measurement of the trimeric form of the RABV glycoprotein (G). Recombinant vaccines for use in domestic and feral animals have been developed using various viral vectors, including non-virulent viruses such as raccoonpox, canarypox and others (4, 12). The RABV G gene is spliced into the vector, and the products are replication-competent in tissue cell culture, but most are replication-limited in vaccinates. Potency can be based on a simple virus titre accompanied with confirmation of protein expression. The titre for finished product should be based on the titre used in the pivotal efficacy trials, with some overage included to account for assay variability and titre loss over shelf-life. Efficacy should be based on host animal vaccination or challenge studies. The challenge phase of the efficacy trial should take place at the end of the recom- mended revaccination period; that is, if the product is labelled for annual revac- cination, the challenge event should occur at least one year after the vaccination event, and so forth for other duration of immunity claims. Products for domestic animals should result in a prevented fraction that approaches 85–90%. Relevant regulatory authorities should require that manufacturers of RABV vaccines have a vaccinovigilance or pharmacovigilance programme that is regu- larly reviewed and monitored. While no vaccine can be expected to provide 100% efficacy, reports of lack of efficacy should be investigated thoroughly. At the very least, a complete history of the animal involved should be obtained, the condi- tions of product administration should be determined, and retention samples of Laboratory techniques in rabies Fifth edition 109 Regulatory issues Part 6. Production of biologicals the product serial or batch should be tested for potency. If vaccine failure in an individual case is determined to be the result of a lack of sufficient potency, or if a cluster of reports occurs, a product recall should be conducted. End users should be notified, and animal revaccination should be strongly encouraged. Regulatory considerations for use of vaccines in wildlife Many countries have used wildlife vaccination campaigns to address epizootic outbreaks in wildlife reservoirs, such as raccoons, foxes, coyotes, and other meso- carnivores. Early work in this area involved trap/vaccinate/release campaigns using conventional parenteral vaccination. These efforts are resource intensive, and success is variable (3). Subsequent efforts that have shown success involve distribution of vaccine- laden baits. These products are either highly attenuated modified-live RABV or recombinant virus vectors containing the RABV G gene (3). Regulatory considerations for wildlife vaccines should include similar standards as those for domestic animals regarding safety, purity and potency. However, effi- cacy requirements may be adjusted species-by-species based on disease preva- lence, animal distribution density, migratory patterns, species behaviour and other factors. For example, it might be possible to disrupt an epizootic with a slightly less efficacious vaccine if the baiting programme achieves adequate coverage, but this is dependent upon the nature of the target species and factors specific to the disease situation. Regulatory authorities should work closely with wildlife specialists and other experts to develop a rational approach for establishing effi- cacy requirements for wildlife vaccines. Diagnostic test kits for use in animals Diagnostic tests for suspected rabies cases in animals should be conducted by well-trained personnel, using well-validated assays. Currently, there are no testing protocols for use in living animals; the “gold standard” is based on the direct fluorescent antibody test or DFAT (see Chapter 11), using postmortem brain tissue  (12). Most developed countries have established testing protocols, and laboratories engaged in testing have appropriate quality systems in place and participate in regular proficiency testing. Routine use of point-of-care diagnostic test kits is controversial. Although these types of tests can be useful, they should only be used as screening tools, or in situations where < 100% sensitivity and specificity is tolerable. An example situation would be attempts to conduct disease surveillance in wildlife, where the results are not being used to make management decisions for individual animals, especially in situations of human PEP. Point-of-care kits should be well characterized and validated for sensitivity, specificity, ruggedness, repeatability and reproducibility. Pre-marketing evalua- tion should include a robust field trial to establish and confirm those parameters. End use should be limited to researchers and wildlife management officials. Regulatory oversight of diagnostic test kits varies considerably from region to region. For example, in the United States, point-of-care kits for veterinary use Laboratory techniques in rabies Fifth edition 110 Regulatory issues Part 6. Production of biologicals must be licensed by the United States Department of Agriculture’s Center for Veterinary Biologics. Other countries and regions have requirements ranging from a similar model to limited or no regulatory oversight of such products. Authori- ties considering the approval and use of point-of-care kits should ensure that the products have adequate data supporting sensitivity and specificity claims. Use of post-exposure prophylaxis for unvaccinated domestic animals After exposure to a vaccinated animal, an immediate vaccine booster is recom- mended. Annually, in many countries, thousands of naive animals are euthanized after rabies exposure. Many are unvaccinated because they are too young (i.e. less than 3 months of age). There are currently no well-defined PEP protocols recom- mended for use with such naive domestic animals. However, objectively, there is no reason why such protocols could not be developed. Historically, supplies of anti-rabies immunoglobulin have been limited, costs are very high, and shortages have been commonplace. This situation raised ethical considerations around the use of a scarce commodity in animals when people in many parts of the world have no access to these life-saving materials. Recently, monoclonal antibodies have been developed that are much less expensive to produce and can likely be supplied in large quantities (13, 14). When these products have been fully evaluated, their availability may change the current paradigm related to using such products in exposed or potentially exposed naive animals. Evaluation of such products should be done using host animal exposure-prophylaxis studies as agreed upon by relevant regulatory authorities. Future considerations As technical advances continue, it can be expected that the tools available for rabies diagnosis, prevention and control in animals will expand. Next-generation products should be safer, more efficacious, more user-friendly and, hopefully, more economically sound. Given the status of rabies as a neglected tropical disease, future developments should allow for improved ability for enhanced, decentralized laboratory-based surveillance, to detect and reduce endemic rabies and respond effectively to rabies epizootics as they arise. Efforts should continue to educate at-risk regions as well as funding agencies as to the products and methods avai- lable. These efforts should include information related to product attributes and limitations to help ensure the most efficient allocation of limited resources, parti- cularly as considered by regulatory authorities for all relevant species at risk. Laboratory techniques in rabies Fifth edition 111 Regulatory issues Part 6. Production of biologicals References 1. Lucas CH, Pino FV, Baer G, Morales PK, Cedillo VG, Blanco MA, et al. Rabies control in Mexico. Dev Biol (Basel). 2008;131:167–75. PMID:18634477. 2. Franka R, Rupprecht CE. Treatment of rabies in the 21st century: curing the incu- rable? Future Microbiol. 2011;6:1135–40. doi:10.2217/fmb.11.92. 3. King AA, Fooks AR, Aubert M, Wandeler AI, editors. Historical perspective of rabies in Europe and the Mediterranean Basin. Paris: World Organisation for Animal Health; 2004. 4. Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, et al. Rabies – epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51. doi:10.108 0/01652176.2017.134351. 5. Liu Y, Zhang HP, Zhang SF, Wang JX, Zhou HN, Zhang F, et al. Rabies outbreaks and vaccination in domestic camels and cattle in Northwest China. PLoS Negl Trop Dis. 2016;10:e0004890. doi:10.1371/journal.pntd.0004890. 6. Slate D, Algeo TP, Nelson KM, Chipman RB, Donovan D, Blanton JD, et al. Oral  rabies  vaccination in North America: opportunities, complexities, and challenges. PLoS Negl Trop Dis. 2009;3:e549. doi:10.1371/journal.pntd.0000549. 7. Rupprecht CE, Hanlon CA, Slate D. Oral vaccination of wildlife against rabies: oppor- tunities and challenges in prevention and control. Dev Biol (Basel). 2004;119:173– 84. PMID:15742629. 8. Bruckner L, Cussler K, Halder M, Barrat J, Castle P, Duchow K, et al. Three Rs approaches in the quality control of inactivated rabies vaccines. The report and recommendations of ECVAM workshop 48. Altern Lab Anim. 2003;31:429–54. PMID:15601248. 9. Hermann J, Fry A, Reising M, Patterson P, Siev D, Gatewood D. Rabies vaccine standards: comparison of the 5th and 6th WHO international reference standards to the USDA veterinary reference standard. Vaccine. 2012;30:6892–6. doi:10.1016/j. vaccine.2012.09.002. 10. Jungback C, editor. Potency testing of veterinary vaccines for animals: the way from in vivo to in vitro. Dev Biol (Basel). Basel: Karger; 2012:29–33. 11. Lewis CE, Fry AM, Hermann JR, Siev D, Dusek DM, Gatewood DM. Potency testing of veterinary rabies vaccines: replacement of challenge by in vitro testing: consi- derations for development of alternative assays. Dev Biol (Basel). 2012;134:29–33. doi:10.1016/j.biologicals.2011.10.004. 12. National Association of State Public Health Veterinarians; Compendium of Animal Rabies Prevention and Control Committee. Brown CM, Slavinski S, Ettestad P, Sidwa TJ, Sorhage FE. Compendium of animal rabies prevention and control. J Am Vet Med Assoc. 2016;248.doi:10.2460/javma.248.5.505. 13. De Benedictis P, Minola A, Rota Nodari E, Aiello R, Zecchin B, Salomoni A, et al. Deve- lopment of broad-spectrum human monoclonal antibodies for rabies post-exposure prophylaxis. EMBO Mol Med. 2016;8:407–21. doi:10.15252/emmm.201505986. 14. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Develop- ment of a mouse monoclonal antibody cocktail for postexposure rabies prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. Laboratory techniques in rabies Fifth edition 112 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Chapter 37 Preparation of fluorescent antibody conjugate for the direct fluorescent antibody test Introduction During the past several decades, various live virus or purified antigens have been used to produce polyclonal or monoclonal antibodies for rabies diagnosis, as described in this manual and elsewhere (1–8). Monoclonal antibodies are characterized by their specificity of binding, their homogeneity and their ability to be produced in large quantities. For example, all the antibodies produced by descendants of one hybridoma are identical, making them powerful in testing for the presence of a desired epitope (4). In 1975, Köhler and Milstein developed a technique that allows the growth of clonal populations of cells secreting antibo- dies with a defined specificity (5). In an animal, antibodies are synthesized prima- rily by plasma cells, a type of terminally differentiated B lymphocyte. Polyclonal antibodies are a mixture of antibodies that are secreted by different B cell lineages. These antibodies are a collection of immunoglobulin molecules that react against a specific antigen, and each identifies or recognizes a different epitope(s) on an antigen. In 1973, Dean and Abelseth used inactivated rabies virus (RABV) infected mouse brain suspensions as a source of antigen to immunize animals and from the hyper-immune serum obtained concentrated specific antibodies (3). Generally, antibodies are typically produced by inoculating a suitable mammal, such as mice, rabbits, goats, chickens, guinea pigs, hamsters, horses, rats and sheep. Larger mammals are often preferred, as greater volumes of serum can be harvested. The basic principle is that an antigen is injected into the mammal, and this induces the B-lymphocytes to produce immunoglobulins (e.g. IgG) specific for that antigen. The primary goal of antibody production in animals is to obtain high titre, high affinity antisera for use in experimentation or diagnostic tests. The antigen may be administered with an adjuvant to improve or enhance the immune response to antigens. This chapter outlines the methods used to obtain polyclonal antibo- dies from goats and their labelling with fluorescein isothiocyanate (FITC). At least two animals per antigen should be used, as this reduces the failure resulting from non-responsiveness to antigens of individual animals. Purification of ribo- nucleoprotein (RNP) from baby hamster kidney (BHK) cells infected with a labo- ratory strain, such as Evelyn Rokitniki Abelseth (ERA) and/or Mokola virus 97/252 (MOKV), is described. The RNP is purified by employing ultracentrifugation in a cesium chloride gradient; the resulting RNP is checked for intactness and authen- ticity by immunoblotting with a specific lyssavirus antibody. The protein product(s) can be used for immunizing goats to raise hyperimmune serum, which is subse- quently labelled with either biotin for use in the direct rapid immunohistochemistry test (DRIT), as described in Chapter 12, or the FITC for detection of lyssavirus antigens in the direct fluorescent antibody test (DFAT); see Chapter 11. Laboratory techniques in rabies Fifth edition 113 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Ammonium sulfate precipitation is one of the most commonly used methods for removing proteins from solution. Water molecules are removed from the proteins, thereby decreasing their solubility. Although other salts, such as sodium sulfate, are sometimes used, precipitation of antibodies is commonly done with ammonium sulfate. Ideally, only the highest purity ammonium sulfate should be used. The concentration at which antibodies will precipitate varies from species to species. One disadvantage of using ammonium sulfate is that during the preci- pitation step, other high molecular weight proteins are trapped in the large floc- culent precipitates, thereby improving the purity of the preparation. Antigen production for antibody generation The antigens are purified from BHK-21 cells [ATCC CCL-10] infected with ERA and/or MOKV (Fig. 37.1A). The cells are ruptured by five freeze–thaw cycles, homogenization and detergent action to disrupt the virus envelope. Lipids are removed using solvent and centrifugation. Proteins are separated by polyethylene glycol 8000 (PEG) precipitation followed by elution. Finally, the RNP is purified on a cesium chloride gradient and is dialysed against phosphate buffered saline (PBS) buffer for use in immunization and antibody induction. Fig. 37.1A. RABV-infected murine neuroblastoma cells stained with FITC-labelled conjugate Laboratory techniques in rabies Fifth edition 114 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Protocol 1. Virus isolation and titration 1.1 Lyssavirus infection is confirmed by the DFAT as described (3). From a lyssa- virus-infected sample selected for RNP and hyperimmune serum production, prepare a 10% (w/v) brain tissue homogenate in tissue culture (TC) medium consisting of Dulbecco’s Modified Eagle Medium (DMEM F-12), supple- mented with 10% fetal bovine serum (FBS) and 5% antibiotics/antimycotic. Note: It is crucial that cells are actively growing and healthy. 1.2 Centrifuge the homogenate at 1076 x g (2500 r/min in a Sorvall centrifuge) for 30 min to separate tissue debris, then transfer the supernatant into a sterile 2.0 mL or 5.0 mL polypropylene tube. Repeat this step if necessary to clarify the supernatant further. The supernatant is now ready for use as inoculum. 1.3 Trypsinize a confluent T25 cm2 monolayer of BHK cells and resuspend the cell suspension in 20 mL of TC medium, then infect the cell suspension with a specific lyssavirus species at a multiplicity of 0.1. Mix gently by swirling and distribute 200 µL of the cell suspension into three adjacent wells in two separate 96-well plates as monitor plates. Incubate the two monitor plates and flask at 37 °C in a humidified incubator with 5% CO2 for up to 72 h. After 48 h, fix the first monitor plate with 80% cold acetone for 15 min and air dry for 5 min at room temperature and then stain the monolayer (see Chapter 11). Dilute the current batch of the FITC-conjugated anti-lyssavirus polyclonal antibody to a working concentration with PBS (pH 7.2–7.4). Distribute 50 µL of the conjugate into each well and incubate the plate in a humidified chamber or container at 37 °C for at least 45–60 min. Remove the plate from the incubator, discard the conjugate and rinse three times with PBS (pH 7.2–7.4) to remove unbound conjugate and excess buffer. Blot the plates dry on a stack of paper towel, view under a fluorescent microscope, then record the observations. 1.4 Keep the flask in the incubator until the last monitor plate has been acetone- fixed and stained as in step 1.3. Harvest the supernatant when the infection is 80–100% and establish the virus titres using the Spearman–Kärber method (see Chapter 20). Briefly, remove the flask from the incubator and freeze–thaw three times at −20 oC and room temperature. Harvest the supernatant and clarify at 1076 x g (2500 r/min) for 30 min to remove cell debris and store at −70 oC until required. The virus titre should be at least 105 tissue culture infectious doses (TCID50) for use in subsequent steps. Otherwise, repeat the process as in step 1.1. 2. Virus propagation and cell harvesting 2.1 The virus supernatant with a known titre is used to infect BHK cells re-sus- pended in TC medium. Briefly, determine the cell concentration of BHK cells from a confluent T75 cm2 flask and re-suspend in 10.0 mL of TC medium using a haemocytometer. Detach the BHK cells from 16 T75 cm2 [or T150 cm2] from the surface of the flask using trypsin, pool aliquots together and re-sus- pend into a total volume of 1000 mL with TC medium. For the virus use the formula: volume of virus stock to be added = multiplicity of infection x number of cells / (virus titre) to calculate how much virus is required to infect the re-suspended cells. Laboratory techniques in rabies Fifth edition 115 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 2.2 Infect the re-suspended BHK cells with a lyssavirus at a multiplicity of infection (MOI) of 0.1 and mix by gentle swirling. Sub-culture about 25 mL of infected BHK cells into 40 x T175 cm2 flasks or T150 cm2 and 200 µL into a specific well (take note of the flask from which it originated) into two separate 96-well monitor plates (i.e. one can also use 60- or 72-well plates). Incubate both the monitor plates and the flasks at 37 °C in a humidified incubator with 5% CO2 for 72 h. After 48 h, fix the first monitor plate with 80% cold acetone for 15 min and repeat step 1.3 after 72 h. 2.3 Harvest the BHK cells from the flasks when the monolayer infection is between 80% and 100% on the monitor plate. Remove the flasks from the incubator and carefully pour off TC medium into virucidal solution. 2.4 Scrape the infected monolayer of cells from the surface of the flask using a clean, sterile cell scraper into a 50-mL polypropylene centrifuge tube and collect the pellet of BHK cells by centrifuging at 2988 x g (5000 r/min) for 5 min. Re-suspend the cell pellet in 8.0 mL of cold STE buffer (pH 7.8), and store at −70 °C until required. 3. Ribonucleoprotein (RNP) purification 3.1 Thaw the infected pellet of cells under running cold water and once thawed transfer the sample into a Dounce homogenizer placed in a beaker filled with crushed ice. Homogenize the cell pellet with 10–20 strokes of the loose pestle, followed by 10 to 20 strokes of the tight pestle. Note: It is important that the suspension does not become warm. Sterilized glass beads may also be added to infected pellets; when thawing suspension, shake vigorously. Add 0.2 mL of cold 10% IGEPAL [Sigma Aldrich, USA] for every 1.0 mL of the cell homogenate and stir gently for 30 min using a magnetic stirrer in a cold room (4 °C) or mix the cell homogenate with 10 strokes of the loose pestle without forming foam. 3.2 Add an equal volume of cold 1,1,1,2,3,4,4,5,5,5 decafluoropentane and mix well by inverting the tube several times. Stir the reaction mixture vigorously with a magnetic stirrer for 30 min in a cold room, then centrifuge the reaction mixture for 20 min at 2988 x g (5000 r/min) at 4 °C to separate the phases. Harvest the aqueous layer into a clean 50 ml polypropylene centrifuge tube using a sterile glass Pasteur pipette and store the aliquot at 4 °C. Add cold STE buffer (pH 7.8), equivalent to the starting volume of the cell homoge- nate to the inter-phase and bottom layer. Mix the solution by inverting the tube, then stir vigorously at 4 °C for 30 min using a magnetic stirrer. Centrifuge the reaction mixture at 2988 x g (5000 r/min) at 4 °C for 20 min and harvest the aqueous layer. Pool the aqueous layer supernatant with the previously harvested sample and estimate the total volume of the pooled supernatant. 3.3 Add a final concentration of 0.3 mol NaCl and continue stirring until completely dissolved. For every 1.0 mL of the solution, slowly (over 4–6 h), add 0.06 g of PEG (polyethylene glycol) 8000 while stirring at 4 °C overnight. Laboratory techniques in rabies Fifth edition 116 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Fig. 37.1B. Ultracentrifuge tube demonstrating the two opaque bands observed after RNP purification from infected MNA cells 3.4 Centrifuge the mixture at 7649 x g(8000 r/min) for 30 min at 4 °C and discard the supernatant. Remove traces of moisture from the centrifuge tube using strips of Whatman No. 4 filter paper to absorb the moisture and allow to air dry for 5 min. Add about 500 µL of cold diluted STE buffer (1:4) and break the pellet using a Pasteur glass pipette, then stir at 4 °C overnight. 3.5 Centrifuge the reaction mixture at 7649 x g (8000 r/min) for 30 min at 4  oC and harvest the supernatant using a sterile Pasteur glass pipette into a sterile 50.0 mL polypropylene centrifuge tube. Add 500 µL of cold diluted STE buffer (1:4) to the pellet and solubilize by stirring at 4 °C for 4 h. Collect the superna- tant by centrifugation at 7649 x g (8000 r/min) for 30 min and repeat the same process as previously. Harvest the supernatants and pool with the previous supernatant, then clarify by centrifugation at 11 952 x g (10 000 r/min) for 30 min to remove any cell debris. 3.6 Prepare the different cesium chloride (CsCl) solution densities or gradients of 1.2 g/mL, 1.3 g/mL and 1.4 g/mL with STE buffer (pH 7.8). Note: The supernatant should not exceed 1.5 mL due to size limitation of the centrifuge tube to be used. Overlay the supernatant with 3.0 mL of each CsCl solution starting with 1.2 g/mL, 1.3 g/mL and 1.4 g/mL. Balance the tubes by adding 1.3 g/mL of cold STE buffer. Centrifuge the tubes at 266 676 x g (38 000 r/min) using a high-speed rotor (e.g. SW 41 rotor) for 16 h or overnight. Visualize the bands by placing the tube underneath a light source and a black sheet behind the tube (see Fig. 37.1B). 3.7 Harvest each opaque band into a separate and sterile 2 mL Eppendorf tube. Dialyse the harvested bands using nitrocellulose membrane against 2000 mL of STE buffer (pH 7.8) for 24 h with an STE buffer (pH 7.8); change every 2 h. Finally, dialyse against 2000 mL of PBS (pH 7.2–7.4) overnight. Distribute the harvested and dialysed proteins into labelled cryotubes and store at −70 °C until required. Laboratory techniques in rabies Fifth edition 117 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 4. SDS-PAGE and western blotting 4.1 Assemble the plates on the casting stand with the short glass facing the front and securely tighten to avoid leaking of the gel. Cast two gels, one for the Western Blot analysis and the other for the Coomassie blue staining. 4.2 Prepare both resolving and stacking gels according to Table 37.1, starting with the resolving gel. 4.3 Add the resolving gel between the plates, about 5 cm from the top, and overlay with 2% SDS to prevent bubbles from forming within the resolving gel. Allow the gel to polymerize for at least 30 min. Pour off the 2% SDS, then add 3 mL of the stacking gel on top of the resolving gel. Insert the comb gently between the plates and allow polymerizing for at least 5 min. Dilute samples and controls (10 µL) with an equal volume of sample loading buffer in a locking top Eppendorf tube and boil for 5 min. Mount the casting plates together with the gel onto a mini gel electrophoresis apparatus assembly with the short glass plate facing inwards and add about 20 µL of each sample into the wells. Fill the chamber with running buffer (see Annex) and electrophorese the samples at 100 V for 90 min or turn off when the dye is about a centi- meter from the bottom. Remove the gels and cut-off the stacking gel. Clearly mark the gels by cutting off the bottom corner to indicate the sequence of the samples on the gel. Place the gel in a large Petri dish, add stain solution (see Annex) to cover the gel and shake for 10 min (at 150 r/min). De-stain the gel with de-staining solution until clear. 4.4 For the Western Blot analysis, add running buffer into the gel contained in a Petri dish and allow to equilibrate for 15 min at room temperature with shaking. Cut two pieces of filter paper and nitrocellulose membrane to match the size of the gel and place each in a separate Petri dish containing running buffer. Place on the base of blotting apparatus filter paper, nitrocellulose membrane, gel, filter paper then roll out the bubbles using a Pasteur pipette. 4.5 Attach to power supply and run at a constant 12 V for 40 min. Remove the membrane from the blotting apparatus and block with 5% skimmed milk in PBS (pH 7.2–7.4) buffer. Allow blocking for 60–120 min at room temperature with shaking. Air dry the membrane and mark the top of the membrane to indicate the sequence of the samples. Dilute a labelled anti-lyssavirus mono- Table 37.1. Ratios of reagents used to prepare both resolving and stacking gels for SDS-PAGE and Western Blot analysis Item Resolving gel (10%) Stacking gel (4%) Distilled water 4.00 mL 2.80 mL Acrylamide mix 3.30 mL 0.83 mL 1.5 mol Tris pH 8.8 2.50 mL None 0.5 mol Tris pH 6.8 None 1.30 mL 10% sodium dodecyl sulfate (SDS) 0.10 mL 0.05 mL 10% ammonium persulfate (APS) 0.10 mL 0.05 mL TEMED 0.004 mL 0.005 mL Laboratory techniques in rabies Fifth edition 118 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals clonal antibody with horse radish peroxidase (HRP) in a 1:5 ratio known to react with specific lyssavirus species nucleoprotein or the target protein and add into the Petri dish containing the membrane. Incubate for 60–120 min with shaking at room temperature. Wash the membrane three times with PBS (pH 7.2–7.4) buffer and add chromogenic substrate buffer (TMB) to visualize the bands (Fig. 37.1C). 5. Immunization of animals 5.1 Obtain female goats aged 4–6 months. Provide all routine veterinary care, such as deworming (i.e. using anthelminthics [such as Valbazen Ultra and closantel, or similar]) and observe for 7 days. Collect 25 mL of blood from the jugular vein before the animals are immunized to obtain baseline antibody data. 5.2 Immunize the goats intramuscularly into the biceps femoris on day 0 with the RNP of interest (e.g. ERA RABV) together with complete Freund’s adjuvant in a total volume of 1 mL (1:1 ratio). It is recommended that the adjuvant is well emulsified prior to immunization. 5.3 On day 21, collect 25 mL blood through the jugular vein and administer a booster with ERA RNP together with incomplete Freund’s adjuvant in a total volume of 1 mL (1:1 ratio). Separate serum by centrifugation at 2988 x g (5000 r/min) and establish antibody titres by performing the immunofluores- cence assay (IFA) as described in Chapter 21 of this manual. 5.4 On day 42, collect blood (25 mL) from the goats, separate serum by centri- fugation and establish antibodies titres using IFA as described previously. Administer further booster doses on day 49 if a low antibody titre is observed (< 1:1000). Fig. 37.1B. Ultracentrifuge tube demonstrating the two opaque bands observed after RNP purification from infected MNA cells Laboratory techniques in rabies Fifth edition 119 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 5.5 On day 63, collect a sufficient blood sample (at least 50 mL) into sterile 250 mL bottles. Allow the blood to clot and collect serum by centrifugation as done previously. Establish the antibody titre by IFA and store serum at −20  °C if > 1:10 000 until required. Administer a further booster with a different lyssa- virus species (e.g. MOKV RNP) to generate broadly cross-reactive polyclonal antibodies. 5.6 On days 77 and 91, collect sufficient blood (at least 50 mL) from the jugular vein of animals into sterile 250 mL bottles. Allow the blood to clot, collect serum and clarify by centrifugation as done previously. Establish the antibody titre by IFA and store serum at −20 °C until required. Once the titre is adequate, sedate the animals, conduct a final bleeding and serum collection, euthanize the animals appropriately and incinerate the carcasses upon completion of the last collection. 6. Ammonium sulfate precipitation of immunoglobulins A maximum of 25 mL of serum should be processed at any one time. All solutions are prepared in advance and stored at 4 °C until required. Each newly prepared batch of FITC-conjugated immunoglobulin is tested for sensitivity and specificity against known circulating lyssaviruses in the geographical area. 6.1 Thaw serum and centrifuge at 12 000 r/min for 10 min at 4 °C. 6.2 Remove serum and place in a 100-mL sterile Schott bottle. 6.3 Add a stir bar and place the Schott bottle on the magnetic stirrer in a cold room at 4 °C. 6.4 Add 1.0 mL cold saturated ammonium sulfate for every 1.5 mL of serum, dropwise, with constant stirring at low speed to minimize protein denatura- tion. 6.5 Stir the mixture overnight at 4 °C. A white precipitate should form. 6.6 Collect the precipitated proteins by centrifuging the mixture at 5000 r/min for 30 min at 4 °C. 6.7 Discard the supernatant and re-suspend the sediment in 0.01 mol PBS until the final volume equals that of the original serum (in step 6.1 above). 6.8 Add an equal amount of cold saturated ammonium sulfate dropwise with constant stirring for 30 min and repeat steps 6.5–6.6 twice. 6.9 Re-suspend the final sediment in PBS (in half the original volume of serum). 6.10 Place this volume in a dialysis bag and dialyse the bag in a 2 L-beaker contai- ning PBS. 6.11 Change the buffer and leave stirring at 4 °C. 6.12 Check the PBS for the presence of sulfate ions. To 2–3 mL of PBS collected in a tube, add 1–2 drops of acidified saturated barium chloride, and watch for the formation of a visible white precipitate, barium sulfate. If sulfate ions are present, replace the PBS and let stir for another 2 h. Replace the 0.01 mol PBS at the end of the day and leave stirring at 4 °C overnight. Laboratory techniques in rabies Fifth edition 120 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 6.13 If sulfate ions are no longer present, replace 0.01 mol PBS, and let stir for a further 2 h. 6.14 Collect the immunoglobulins from the dialysis bag into a graduated cylinder and record the volume. 6.15 Determine the protein content on an aliquot using a protein assay kit or other protein concentration determining method. Calculate the total amount of protein. Continue on with labelling only if the amount of protein exceeds 2 mg/mL. 7. Labelling of the globulins 7.1 Add carbonate/bicarbonate buffer dropwise under constant stirring. The amount of buffer should not exceed 1/10th of the total volume of the collected globulins. 7.2 Monitor the pH of the globulins/carbonate buffer. 7.3 Add FITC (0.01 mg FITC per mg of protein) while stirring. 7.4 Let stir overnight or for a minimum of 8 h at 4 °C. 7.5 Centrifuge conjugate at 12 000 r/min for 10 min. 7.6 Remove untagged FITC from the conjugate [either with the Centriprep Centrifugal Filter Concentrator or Vivaspin tubes]. 7.7 Centrifuge tubes at 2400 r/min for 20 min at 4 °C. 7.8 Repeat the process until all excess dye is removed and the filtrate is clear. 7.9 Centrifuge the final product at 6140 r/min for 1 h at 4 °C. 7.10 Withdraw 0.2 mL of conjugate into a vial and determine the working dilution for DFAT and the RABV tissue culture isolation test (RTCIT; see Chapter 9). 7.11 Aliquot 1 mL of conjugate concentrate into sterile labelled containers and store at −70 to −80 °C, or 0.6 mL into small vials and freeze-dry. Each vial should contain the following information: identity of animal, year serum was collected, bottle number of serum, vial number of conjugate and date the conjugate was bottled. The hyperimmune serum produced as described above can be labelled with FITC for use in lyssavirus diagnosis or biotiny- lated for the DRIT assay (2). As this is a polyclonal hyperimmune serum, it is capable of detecting a large spectrum of lyssaviruses. However, these preparations should be validated against commercial conjugates such as those manufactured by Centocor, Fujirebio or others (7). Laboratory techniques in rabies Fifth edition 121 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 8. Experimental tips 8.1 Viral isolation and titration Select a highly infected brain tissue sample or further passage the virus in mice to increase virus titres for the initial preparation of 10% brain tissue homogenate. 8.2 Ribonucleoprotein purification Avoid foam and heat formation at any step of the experiments. The foam and heat will decrease the yield and denature the protein of interest. Check the pH of diluted STE buffer, as it should not be below pH 7.8 or exceed pH 8.3. It will also affect the yield and denatures the protein. 8.3 SDS-PAGE and Western blot analysis Always add TEMED last and quickly add to the glass plates as it will polymerize with the tube. Protein concentration can be established using the nanodrop or with any other appropriate protein determining method. 9. Critical parameters and trouble shooting 9.1 Infection and harvesting of BHK cells It is recommended that the monolayer should be at least 80% infected before harvesting to ensure maximum yield of the target protein (RNP). Use clean and sterile cell scrapers to avoid contaminating particles within the end product. Avoid foam formation during homogenization of infected MNA cells and subsequent steps, since the target protein has been released from the cells. Slowly and care- fully homogenize BHK cells as mentioned above. This step will determine if you will obtain a good yield. 10. Precautions Wear protective clothing when handling virus and work in Biosafety Level 2 or 3 facilities, especially when growing up virus and infecting BHK cells. 11. Alternative materials and methods For SDS-PAGE, pre-cast gels as well as buffers are available commercially. There are also nitrocellulose membranes and semi transfer blots commercially available, which shorten the time required to complete the analysis. 12. Time considerations Adequate equipment, supplies, planning, budget and staff are needed for each of the steps in antigen preparation, immunization, antibody production and conju- gation over the time frames suggested above. 13. Limitations Facilities are needed to handle live virus, since lyssaviruses are classified as Biosafety Level 2 or 3 viruses, depending on the recommendations for each labo- ratory performing the procedure. Laboratory techniques in rabies Fifth edition 122 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals References 1. Aubert FA. Methods for the calculation of titres. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:445. 2. Caporale GMM, da Silva ACR, Peixoto ZMP, Chaves LB, Carrieri ML, Vassa RM. First production of fluorescent anti-ribonucleoprotein conjugate for diagnosis of rabies in Brazil. J Clin Lab Analysis. 2009:23:7–13. 3. Dean DL, Abelseth MK, Atanasiu P. The fluorescent antibody test. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:88–95. 4. Harlow E, Lane D. Antibodies, a laboratory manual. New York (NY): Cold Spring Harbour Laboratory Press; 1988. 5. Köhler G, Milstein C. Pillars Article: Continuous cultures of fused cells secreting antibody of predefined specificity. Nature. 1975;256:495–7. 6. Perrin P, Techniques for the preparation of rabies conjugate. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. Geneva: World Health Organization; 1996:434. 7. Robardet E, Andrieu S, Rasmussen TB, Dobrostana M, Horton DL, Hostnik P, et al. Comparative assay of fluorescent antibody test results among twelve European National Reference Laboratories using various anti-rabies conju- gates. J Virol Methods. 2013:191:88–94. 8. Dietzschold B. Techniques for the purification of rabies virus, its subunits and recombinant products. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Labo- ratory techniques in rabies. Geneva: World Health Organization; 1996:177. Laboratory techniques in rabies Fifth edition 123 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Annex 1. Materials Reagents • sodium chloride, molecular grade • Tris-base, molecular grade • ethylene diamine tetra-acetic acid (EDTA), molecular grade • IGEPAL CA-630 (Sigma 1-3021) • polyethylene glycol PEG 8000 • cesium chloride, optical grade • Premix 30% acrylamide/Bis 29:1 • mol Tris buffer pH 8.8 • 0.5 mol Tris buffer pH 6.8 • nitrocellulose membrane • protein, molecular weight (MW) standards • sodium dodecyl sulfate (SDS), molecular grade • N,N,N’,N’-Tetramethylenediamine (TEMED) • tissue culture grade water or double distilled water • DMEM F-12 • fetal bovine serum (FBS) • penicillin streptomycin and amphotericin • trypsin • ammonium sulfate • FITC-conjugated anti-lyssavirus polyclonal antibody • 1,1,1,2,3,4,4,5,5,5 Decafluoropentane Equipment • centrifuges (Sorvall RC-3 and Beckman ultracentrifuge) • centrifuge rotors (SL-50T and SW 41 T) • Beckman ultracentrifuge tubes, ultra-clear • hard polypropylene tubes 35 mL, round bottom, screw cap (e.g. Oakridge tubes) Note: Propylene tubes do not bind antigen as compared with polystyrene tubes. It is advisable therefore to use hard polypropylene tubes, as they are able to handle high centrifugal forces. • electronic balance • Pasteur pipettes • dialysis tubing, 12–14000 MW cut-off, 10 mm flat-width • magnetic stirrer • cold room or refrigerator set at 4 °C • semi-dry protein transfer apparatus • gel casting trays, gel combs and plates Laboratory techniques in rabies Fifth edition 124 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals • running chamber • mini gel electrophoresis tank and power supply • Petri dishes (large) • shaker (mini) Biologicals • BHK-21 cells (CL1300 [European Cell Culture Collection, Salisbury, UK]) • Lyssavirus species (MOKV, ERA, etc.) • purified ribonucleoprotein (RNP) • laboratory animals – for this SOP, young female goats aged 4–6 months Labelling of the hyperimmune serum • serum, thawed, prior to use • magnetic stirrer with bar • crushed ice in a bucket • saturated ammonium sulfate (see Annex) • 0.01 mol PBS (12 L and 100 mL sterile) • acidified and saturated barium chloride (see Annex 2) • carbonate/bicarbonate buffer (see Annex 2) • 5 mmol EDTA/100 mmol sodium bicarbonate (see Annex 2) • dialysis bags. Spectra pro 1 membranes (6000–8000 MW cut-off), 20.4 x 30.5 cm with closures • FITC reagent • Viva spin • Sorvall RC-5C centrifuge with fixed angle rotor (SS-24) • glassware 2 L beaker, and graduated cylinder Laboratory techniques in rabies Fifth edition 125 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Annex 2. Reagents RNP purification STE buffer pH 7.8 • Sodium chloride (NaCl) • Tris (hydroxymethyl) aminomethane • EDTA • Measure 1000 mL of distilled water • Dissolve the salts in 90% of the total volume of water • Adjust the pH to 7.8 with 10 N HCl Phosphate buffered saline (PBS) pH 7.2–7.4 • Sodium chloride (NaCl) • Sodium phosphate, dibasic (Na2HPO4) • Potassium phosphate, monobasic (KH2PO4) • Distilled water to prepare 20 L • Adjust the pH to 7.2–7.4 by adding either 10 N HCl or NaOH pellets SDS-PAGE Sample loading buffer (4x) • 50 mmol Tris-HCl, pH 6.8 • 2% SDS • 100% glycerol • 1% 14.7 mol ß-mercaptoethanol • 12.5 mmol mol EDTA • 0.02% bromophenol blue • Distilled water Staining solution • Use at 1x for loading samples onto SDS-polyacrylamide gels • 0.25 % Coomassie blue R-250 • 50% methanol • 10% acetic acid • 39.75% distilled water Destaining solution • 20% methanol • 10% acetic acid • 70% distilled water Laboratory techniques in rabies Fifth edition 126 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Running buffer • 10% SDS • Glycine • Tris base • 1000 mL distilled water Western blot analysis • Running buffer (pH 8.3) • 25 mmol Tris base • 192 mmol glycine • 20% methanol • 1000 mL distilled water Washing buffer (pH 7.4–7.6) • 50 mmol Tris • 200 mmol NaCl • 0.5% Tween Saturated ammonium sulfate • Add sufficient amount of ammonium sulfate to 400 mL of double distilled water to produce a saturated solution (undissolved ammonium sulfate must be visible). • Store at 4 °C. • Before use, dispense the saturated solution into a beaker, being careful not to disturb the undissolved sediment, adjust to pH 7.0 with 4N HCl. Acidified saturated barium chloride • To 50 mL of water add enough barium chloride to prepare a saturated solution. • To 20 mL of saturated barium chloride add 1–2 drops of 4N HCl. • Mix well and store at room temperature until needed. Carbonate-bicarbonate buffer • Add 0.3 g of Na2Co3 to 25 mL of sterile double distilled water. • Add 1.85 g of NaHCO3 to 20 mL of sterile double distilled water. Mix well. • Combine both and add sterile double distilled water to make a final volume of 50 mL. • Verify pH and adjust if necessary with 10N NaOH. • Store at 4 °C. Laboratory techniques in rabies Fifth edition 127 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals mmol EDTA/200 mmol sodium bicarbonate • Add the following to 1000 mL of sterile double distilled water: • EDTA 1.46 g • NaHCO3 16.8 g • Mix well and store at 4 °C until needed. Preparation of dialysis bags • Place 500 mL of the EDTA/sodium bicarbonate solution into a beaker and bring to boil. • Place dialysis bags into the boiling solution and leave for 5 min. • Bring the remaining 500 mL to boil and immerse the dialysis bags in this solu- tion and leave for 5 min. • Remove bags, place in sterile PBS, and store at 4 °C until needed. • Rinse bags well in PBS before use. Laboratory techniques in rabies Fifth edition 128 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Chapter 38 Anti-rabies monoclonal antibody production using mammalian expression systems Introduction The overall applications for monoclonal antibodies (MAbs) have expanded during the past several decades. In the field of rabies, MAbs have been used not only in research but also for diagnostic purposes, and evaluated as a repla- cement for rabies immunoglobulins (RIG). Moreover, MAbs have proven to be very useful tools in research to identify antigenic sites, including for typing of rabies virus (RABV). To aid identification of RABV in tissue in rabid animals or human rabies victims, MAbs have been employed over the past several decades. Finally, a number of groups have identified MAbs that could potentially replace RIG in a post-exposure prophylaxis (PEP) setting for severe exposures to RABV, or so-called category III exposures (1). Today, RIG is obtained from rabies-immu- nized human or equine donors (2,3) and is limited in supply, partially due to the complexity and inconsistency of the manufacturing process. Using standard DNA recombinant technology, MAbs can be expressed in mammalian cell systems from which they can be produced in large quantities and, more importantly, produced consistently. Clearly, the use of MAbs has played a large role in research, since the original concept of hybridoma technology was introduced in 1975 (4). MAbs can be used as valuable tools in basic research to detect or purify a specific antigen in a variety of ways, but also for diagnostic purposes and as treatment and/or prevention of disease. In the context of rabies, all of the above options apply. For example, MAbs have long been of importance with the pioneering work described by Lafon and colleagues (5) to define the antigenic sites on the RABV glycoprotein. Further- more, MAbs directed against RABV antigens, labelled with fluorescein isothiocya- nate (FITC) or biotin, are used as tools for postmortem diagnostic testing, such as the direct fluorescent antibody test (DFAT) (6) or the direct rapid immunohisto- chemistry test (DRIT) (7) respectively, to determine whether a bite victim was truly exposed to RABV from a rabid biting animal. Finally, based on the recommenda- tions of WHO in 2002 (1) the use of anti-RABV MAbs as alternatives for equine RIG (ERIG) and human RIG (HRIG) has been explored and begun in practice (8–10). WHO recommends administration of PEP to all patients with category III expo- sure or to immunodeficient patients with category II exposure to RABV (1). A major component of PEP is passive immunization from RIG. However, given a lack of supply, financial constraints and noncompliance with WHO rabies exposure guidance, many patients die because no PEP or RIG is administered (11,12). To illustrate, in a recent study in the Philippines, several bite victims had inadequate knowledge of proper wound management, and some had resorted to “tandok”, a folk medicine practice where an animal horn is placed over the bite wound to suck out the virus (unpublished data). Access to RIG in the developing world is Laboratory techniques in rabies Fifth edition 129 Anti-rabies monoclonal antibody production Part 6. Production of biologicals particularly poor – a survey in India revealed that only 2.1% patients bitten by a rabid animal received RIG (13). Recombinant MAbs can be obtained through hybridoma technology, or phage display technology. The former depends on antibody responses in animals and subsequent generation of hybridoma cells expressing the antibody of interest, whereas the latter involves cloning of immunoglobulin gene segments to create antibody libraries with large numbers of specificities from which antibodies with desired specificities can be selected (14). The expression and purification of MAbs in mammalian expression systems are suitable for use in research settings or for prevention, treatment and diagnosis of rabies. This chapter describes techniques for expressing MAbs in mammalian cell lines, purifying MAbs via Protein A chromatography, and desalting with both manual and automated methods. Generic steps for production and purification are discussed, in addition to analysis of product quality. Materials Reagents • RABV glycoprotein • FITC-labelled anti-rabies and control reagents • cell culture medium • expression vectors • fetal bovine serum (FBS) • phosphate buffered saline (PBS) • transfection reagent [e.g. Lipofectamine or FuGene]. Equipment • CO2 incubator • ELISA reader • Protein A sepharose column • size exclusion high-performance liquid chromatography (HPLC) column • fluorescence microscope • gel electrophoresis equipment Biological materials • human embryonic kidney (HEK) 293T cells • Chinese hamster ovary (CHO) cells • mouse myeloma cells (NS0, SP2.0) • challenge virus standard strain (CVS)-11 (or other laboratory RABV strain) • non-expressing bacteria cells (e.g. DH1, DH5α™, XL1Blue) Laboratory techniques in rabies Fifth edition 130 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Methods Cells and cell culture Successful MAb production can be achieved in commercially available cell lines such as HEK293T, CHO or mouse myeloma cells (NS0 or SP2.0) depending on the user requirements. If a specific hybridoma is available, these cells can be used as well for antibody production. Preparation of expression vector A variety of standard expression vectors can be used to express MAbs. Because MAb purification is mainly based on natural binding properties of the antibodies, the use of tags is not needed. Typically, the heavy and light chains are cloned into a single vector, each under control of its own promotor. If such plas- mids are not available, separate vectors can be used to express both antibody chains. In either case, standard cloning techniques can be employed to obtain the expression plasmid(s). Preparation of mammalian cell stocks Quickly thaw a vial of cells and transfer them into pre-warmed media: for HEK 293T, CHO, grow cells in 10 mL DMEM [Dulbecco’s minimum essential medium] (with 10% FBS) overnight in a 25 mL flask. For NS0, SP2.0, grow cells in 10 mL MEM at 37 °C with 0.5% CO2 at 37 °C with 10% CO2 overnight in a 25 mL flask. In all cases, after growth, re-suspend cells in PBS and harvest. Transfection and clone selection Plate out adherent cells at 3.5 × 106 cells into a 96 mm dish. Before trans- fection, incubate the plasmid (2 µg of each) with 10 µL transfection reagent in serum-free medium for 30 min. Add plasmid to cells for 5 h before adding DMEM with 10% FBS and incubating overnight. Add growth medium containing appro- priate antibiotic. Wash cells twice a week for 3 weeks to remove dead cells. Pick and transfer clones to a 96-well plate. After several days of further growth under selective pressure, cell culture supernatants can be directly analysed for the presence of antibody using Protein A HPLC or Octet system [ForteBio]. Alterna- tively, antibody concentration can be quantified by ELISA specifically detecting mouse or human MAbs. With each approach, the assay results can be used to select the highest expressing clones to be expanded further using 24- and 6-well plates before transferring to T25 or T80 culture flasks and growing for several days before flash freezing cells (−80 °C). The process is repeated to select the highest expressing clones and to ensure the construct is stably expressing MAbs. At this stage, selective pressure is typically no longer needed. Depending on the requirements, it could also be considered to produce small batches through transient transfection. The principles are the same as those described above but this approach has limitations with respect to the amount of antibody that can be produced in one run. Nowadays, new transient transfection systems or kits are commercially available that can produce at relatively high titres (e.g. 2–3 g/L), such that for a research setting it will yield more than sufficient material to perform a large set of experiments. For application such as diagnostic Laboratory techniques in rabies Fifth edition 131 Anti-rabies monoclonal antibody production Part 6. Production of biologicals purposes, where batch to batch consistency is preferred, a stable clone should be considered as most optimal. Production of MAb using HEK 293T or CHO cells Thaw a vial of frozen cell clone stocks or take cells from ongoing cultures. Inoculate clones to a target concentration of 1 × 106 viable cells/mL into DMEM containing 10% FBS at 37 °C in 10% CO2. Expand the cells to the desired biomass in T flasks and shaker flasks or roller bottles before production is started. The total biomass will be highly dependent on user needs. Prior to the production phase, it is advised that serum containing medium should be washed away and replaced with DMEM, without serum, or lower concentrations of serum be used (e.g. up to 2%). The production phase is ideally performed in shake flasks, where again the selected working volume should be based on required yield. To monitor culture performance, daily samples can be taken to determine cell concentration and viability (using a cell culture analyser). In addition, MAb concentration in culture can be analysed by Protein A HPLC or Octet system (ForteBio). The culture should be harvested if the cell viability drops below 50%. Transfer medium to centrifuge bottles and centrifuge at 5000 x g for 20 min. Filter supernatant through 0.22 µm filter and collect for purification. For larger scale expression, roller bottles or bioreactors can be used instead of shake flasks. Ensure optimal inoculation cell densities are used according to the cell type. Production of antibody using hybridoma cells It is assumed that hydridoma cells are available that express the antibody of interest. It is up to the reader to assess whether the hybridoma is stable enough or if additional subcloning is required. To reach consistently high antibody titres, a relatively pure MAb cell population is recommended. Subcloning of hybridoma cell lines can be achieved by performing serial dilutions to eliminate non-antibody producing cells. Plate 1 to 0.5 cells per well in 96-well plates and culture them until visible colonies appear. Once the colonies appear large enough, they can be tested for antibody production by ELISA. Hybridoma cell lines can be grown in Roswell Park Memorial Institute medium (RPMI) plus 10% FBS during expan- sion, and grown at lower FBS (e.g. 2% but will be clone-dependent) or even in special serum-free hybridoma cell culture medium, such as EX-CELL Hybridoma medium (Sigma Aldrich) during antibody production. Depending on the antibody requirements, these cultures can be grown for 3–5 days to obtain small quantities or in bigger batches by increasing the number of flasks or expanded into larger production vessels. The yield is highly dependent on the hybridoma cell line itself. The choice of production medium with or without use of FBS is dependent on subsequent application of the purified MAb and the level of the purification proce- dure itself. To prevent potential background staining, binding or neutralization, production in the absence of serum is recommended. It must be noted that if a number of purification steps (as described below) are being executed, the serum impurities can be easily removed. MAb purification Depending on the end use of the MAb, different purification strategies can be executed. For research purposes, a straightforward Protein A chromatography will typically provide sufficient purity to perform a number of different experiments. Laboratory techniques in rabies Fifth edition 132 Anti-rabies monoclonal antibody production Part 6. Production of biologicals For diagnostic MAb tools, as well as MAb with the intention to use in humans, additional purification steps are recommended. Protein A chromatography Protein A has a high affinity for human IgG1/IgG2 and mouse IgG2a/IgG2b, moderate affinity for human IgM/IgA/IgE and mouse IgG3/IgG1, but no affinity for other human or murine immunoglobulins. Protein A chromatography can be performed via gravity columns or liquid chromatography systems. Use of the purest water available is recommended for use in all buffers (e.g. HPLC grade). Either prepacked columns can be used, or home-made columns can be gene- rated using Protein A sepharose resin. Before purification of larger batches, it is advised to perform scouting experiments to ensure that optimal conditions are established for purification of antibody. Performing Protein A separation on a gravity column Each Protein A column will have manufacturer-specific protocols to follow. In short, columns must be equilibrated with binding buffer (e.g. PBS pH 7.4) before applying the sample with a syringe or peristaltic pump. Several wash steps to remove all unbound sample and impurities (protein presence should be determined by UV absorbance at 280 nm) can be implemented. This is somewhat dependent on the starting material and its purity. If highly enriched medium is used, and/or cell viability at the time of harvest was low, the column load can contain high levels of impurities. Using additional wash steps, in which a combination of high salt (up to 1 mol NaCl) and lower pH buffers (down to pH 5.5) are incorporated, such impurities can be removed prior to elution of the MAb. Bound MAb is displaced with elution buffer at low pH (range 3–3.6). Depending on the MAb in question, it is important to investigate which elution conditions are best for each antibody. It is known from experience that low pH can induce antibody aggregates at this stage of purification, which could be as high as 20%. Therefore, it may be helpful to achieve a higher recovery to explore slightly higher pH levels which are less harsh for the bound antibody. In addition, fraction collection into a high pH buffer (e.g. Tris buffer pH 8) to ensure a final pH in the more neutral range will also help to reduce aggregate formation. After elution, columns can be cleaned with 0.1 mol NaOH, flushed with PBS, and stored in 20% ethanol at 4–8 °C. Performing a Protein A separation using liquid chromatography systems By using liquid chromatography systems (e.g. FPLC, HPLC), a very similar yet much faster process is applied, but performed in an automated manner thereby obtaining more consistency between MAb batches. Desalting columns MAbs for research purposes can be processed further using desalting columns to exchange buffers and make them suitable for subsequent use. Desal- ting columns are very fast and efficient in doing so, with recoveries typically in the range of 90–100%. Similar to Protein A chromatography, this step can be performed either with bench top gravity columns or using liquid chromatography systems. In the case of gravity desalting columns, the manufacturer’s protocol Laboratory techniques in rabies Fifth edition 133 Anti-rabies monoclonal antibody production Part 6. Production of biologicals can be followed and typically works efficiently. The advantage of using liquid chro- matography systems is that it provides a more consistent approach, but is not an immediate necessity for research MAb batches. Additional purification steps To achieve highly purified MAbs with high-quality standards, a combination of anion and cation exchange chromatography steps should be implemented. This is most likely more applicable to MAbs used for diagnostic purposes or for human use, for which the latter obviously would have to be produced under GMP (good manufacturing practice) conditions (which are beyond the scope of this chapter). However, in a research setting, there may also be reasons to include more puri- fication steps (e.g. if high levels of aggregates have been observed during the Protein A purification step). Antibody aggregates can cause nonspecific binding and false–positive results during experimental evaluation, which can be prevented by additional purification steps to remove the aggregates. Most suitable in that case would be a cation exchange chromatography step, in which the MAb is bound to the column at low salt conditions and eluted with a high salt gradient. The monomer MAb species will elute before the aggregate peak and hence sepa- ration can be achieved. The detailed conditions are highly dependent on the MAb, type of resin, pH and buffer conditions, such that this will have to be explored further by the reader. Generally, a binding buffer at 25–50 mmol NaCl and a pH range of 5–6.5 dependent on the isoelectric point (pI) of the MAb can be used as starting point. Elution up to 1 mol NaCl can be achieved using a linear gradient. If additional impurities are still present, anion exchange chromatography could be explored to further purify the antibody. MAb product testing To assess the quality and purity of antibody, various analytical techniques can be used. The MAb concentration can be determined by a standard UV280 method using a nominal value of 1.5 as the theoretical extinction coefficient. Purity is most often assessed using SDS-PAGE to separate proteins by molecular weight. If the purified MAb has incurred significant insertions or deletions, this should be detected by SDS-PAGE. Non-reducing SDS-PAGE and reducing SDS-PAGE will indicate intact antibody and heavy and light chains, respectively. Precast gels (4–12%) will yield suitable results. Fig. 38.1A shows a composite SDS-PAGE of a purified intact human IgG MAb under reducing and nonreducing conditions, as well as a stressed MAb sample to illustrate the presence of antibody fragments. If the purified MAb shows such fragments, the batch needs to be discarded and a novel MAb production should be initiated. In addition, isoelectric focusing (IEF) can be employed to assess charged isoforms of the MAb and their respective pI. Furthermore, IEF will detect if there have been events that altered the overall charge of the purified MAb, protein degradation or protein deamidation during purification and/or storage. Therefore, this method is also suitable to determine MAb consistency between antibody productions and to detect potential varia- tions. Fig. 38.1B shows an intact MAb sample in comparison with a stressed sample in which the antibody is purposely degraded. Such observations in the purified sample will indicate that the intact MAb has been altered and should be replaced with novel MAb batches. The theoretical molecular weight and pI for the MAb that is being purified can be determined using an online tool such as ExPASy (http://web.expasy.org/compute_pi/) to assess pI of the purified MAb. Laboratory techniques in rabies Fifth edition 134 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Size exclusion HPLC (SE-HPLC) can be used to detect aggregates as well as fragments in the purified MAb product. A small amount (10–20 µg) of antibody can be applied to a SE-HPLC with an appropriate cut-off and equilibrated using a suitable buffer (e.g. 50 mmol sodium phosphate, 250 mmol NaCl [pH 7.0]) at a flow rate of 0.15 mL/min. Absorbance at A280 or A214 can then be used to determine the presence of aggregates and/or fragments. Aggregates (i.e. dimers, trimers, tetramers and oligomers) can form during the purification steps (e.g. protein A elution at low pH), during longer term storage or during multiple freeze–thaw cycles. The monomer intact MAb will be preceded by aggregates and elute prior to potential fragments that may be present in the sample (Fig. 38.2). A monomer concentration of >  95% should be achieved to have a MAb batch that yields reliable results when used in experiments. High aggregate content could result in background staining, or generate other false–positive results. To complement the analytical quality testing, additional assays that test for functionality can be included. For instance, the specific binding of the MAb to its target can be tested using an ELISA method. Depending on the MAb target, purified RABV glycoprotein or nucleoprotein can be coated onto 96-well plates. Coating conditions for the purified antigen would have to be determined, but typi- cally a target of 0.5 µg/mL as coating concentration will be a good starting point. After overnight incubation, each well is blocked with 0.3 mL of a 3% BSA (bovine serum albumin) solution for at least 1 h at room temperature. Then, the wells are washed and each well is incubated with MAb samples (a range of concentration can be used) or control samples for another 1 h. The plate is washed again and incubated with conjugate antibody for 1 h at room temperature, washed once and incubated with TMB substrate for 5–10 min. The reaction is stopped by the addi- tion of 1 mol sulfuric acid and the absorbance is read by an ELISA plate spectro- photometer. Alternatively, inactivated RABV, either prepared in-house or obtained as a rabies vaccine, could be used although typically the signal is less strong compared with purified antigens. If purified RABV glycoprotein is not available, commercially available RABV glycoprotein pre-coated ELISA plates [e.g. Platelia Fig. 38.1. Monoconal antibody (MAb) analysis by SDS-PAGE and IEF A: Purified MAb (10 µg) was loaded onto NuPAGE Novex 4–12% Bis-Tris gel under nonreducing (lane 1) or reducing (lane 2) conditions. Intact IgG and heavy (H) and light (L) chains are visualized with Coomassie Blue staining solution. A MAb sample exposed to low pH (2.7) was loaded under reducing conditions (lane 3) to illustrate occurrence of potential fragments in purified MAb batches. B: Purified MAb (20 µg) was loaded onto a FocusGel 3–10 24S IEF gel to separate the charged isoforms (lane 1). Additionally, a purified MAb sample was pretreated at high pH (9.5) before loading onto isoelectric focusing gel to illustrate the effect of protein degradation or deamidation (lane 2). Note that several bands will be observed, which will be specific for each sample due to multiple protein states with different isoelectric points. B y co ur te sy o f W ilf re d E. M ar is se n, C ru ce ll H ol la nd , T he N et he rla nd s Laboratory techniques in rabies Fifth edition 135 Anti-rabies monoclonal antibody production Part 6. Production of biologicals kit, BioRad] can be used. Demonstration of strong binding indicates correct MAb identity and functionality. Weak or lack of binding would suggest a loss of tertiary structure, mutations in the complementarity determining regions, or instability of the MAb, among others. Specific binding could also be assessed by flow cyto- metry using cell lines expressing RABV glycoprotein on the cell surface (15). Additional functionality can be assessed by analysis of in vitro potency testing such as RFFIT (see Chapter 19) if the MAb is directed against RABV glycoprotein. The capability of a MAb to neutralize RABV will be the ultimate test of its func- tionality and proof of appropriate quality. For each MAb, the 50% neutralizing titre against RABV (e.g. CVS-11 laboratory strain) can be determined and used to calculate an effective (EC50) or inhibitory (IC50) concentration. Most often, the MAbs are benchmarked against the 50% neutralizing titre (2 IU/mL) of a standard reference serum (e.g. standard RIG, lot R3); however, caution should be taken in doing so as neutralizing responses of a polyclonal antibody mixture versus a highly purified MAb may not necessarily be parallel. Lack of parallelism may result in an under- or over interpretation of MAb potency. In such a case, it is better to establish one’s own MAb reference standard that can be used to assess the potency of MAb batches and report MAb potency in EC50 in ng/mL. If required, several purified MAbs can be ranked according to potency. Alternatively, if the appropriate biosafety level laboratory for working with virus is unavailable, in vivo neutralization testing using rabies pseudoviruses can be used, as described previously (10). Interpretation of results The methods presented here allow quick expression of RABV MAbs at small scale but also at larger scale to obtain larger batches of MAb. Purification of anti- bodies can be performed using standard purification techniques as described that can be supplemented with additional purification steps depending on the end-user requirements. The quality of the purified MAb is demonstrated by SDS-PAGE, IEF, SE-HPLC, ELISA, flow cytometry or RFFIT. The MAbs are suitable for both in vivo and in vitro research purposes. If the MAb is used for in vivo testing, analysis of bioburden and endotoxin levels is highly recommended to confirm that the MAb batches are suitable for animal testing. Fig. 38.2. Determination of aggregate levels using SE-HPLC Purified MAb (20 µg) was injected onto a TSKgel SuperSW3000 column equilibrated in 50 mmol sodium phosphate, 250 mmol NaCl (pH 7.0) at a flow rate of 0.15 mL/ min. Absorbance was measured at 214 nm. Elution of aggregates, monomer IgG, and fragments, respectively can be observed. B y co ur te sy o f W ilf re d E. M ar is se n, C ru ce ll H ol la nd , T he N et he rla nd s Laboratory techniques in rabies Fifth edition 136 Anti-rabies monoclonal antibody production Part 6. Production of biologicals References 1. WHO Consultation on a rabies monoclonal antibody cocktail for rabies post expo- sure treatment. WHO, Geneva, 23–24 May 2002. Geneva: 2002 (http://www.who. int/rabies/resources/mabs_final_report_WHO_consultation_2002.pdf?ua=1, accessed 1 October 2018). 2. Rupprecht CE, Hanlon CA, Slate D. Oral vaccination of wildlife against rabies: oppor- tunities and challenges in prevention and control. Dev Biol (Basel). 2004;119:173–84. PMID:15742629. 3. Rupprecht CE, Hanlon CA, Hemachuda T. Rabies re-examined. Lancet Infect Dis. 2002;2:327–43. PMID:12144896. 4. Milstein C. The hybridoma revolution: an offshoot of basic research. BioEssays. 1999;21:966–73. 5. Lafon M, Wiktor TJ, Macfarlan RI. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J Gen Virol. 1983;64:843–51. doi:10.1099/0022- 1317-64-4-843. 6. Protocol for postmortem diagnosis of rabies in animals by direct fluorescent antibody testing. Atlanta (GA): United States Centers for Disease Control and Prevention; 2006 (https://www.cdc.gov/rabies/pdf/rabiesdfaspv2.pdf, accessed 1 October 2018). 7. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emer- ging Infect Dis. 2006;12:310–3. doi:10.3201/eid/1202.050812. 8. Goudsmit J, Marissen WE, Weldon WC, Niezgoda M, Hanlon CA, Rice AB, et al. Comparison of an anti-rabies human monoclonal antibody combination with human polyclonal anti-rabies immune globulin. J Infect Dis. 2006;193:796–801. doi:10.1086/500470. 9. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Deve- lopment of a mouse monoclonal antibody cocktail for post-exposure rabies prophy- laxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. 10. Sloan SE, Hanlon C, Weldon W, Niezgoda M, Blanton J, Self J, et al. Identifica- tion and characterization of a human monoclonal antibody that potently neutralizes a broad panel of rabies virus isolates. Vaccine. 2007;25:2800–10. doi:10.1016/j. vaccine.2006.12.031. 11. Dodet B. Asian Rabies Expert Bureau. Preventing the incurable: Asian rabies experts advocate rabies control. Vaccine. 2006;24:3045–9. PMID:16652450. 12. Wilde H. Failures of post-exposure rabies prophylaxis. Vaccine. 2007;25:7605–9. 13. Sudarshan MK. Assessing burden of rabies in India: WHO sponsored National Multi- centric Rabies Survey, 2003. Indian J Community Med. 2005;30:100–1. 14. Kramer RA, Marissen WE, Goudsmit J, Visser TJ, Clijsters-Van der Horst M, Bakker AQ, et al. The human antibody repertoire specific for rabies virus glycoprotein as selected from immune libraries. Eur J Immunol. 2005;35:2131–45. doi:10.1002/ eji.200526134. 15. Marissen WE, Kramer RA, Rice A, Weldon WC, Niezgoda M, Faber M, et al. Novel rabies virus–neutralizing epitope recognized by human monoclonal antibody: fine mapping and escape mutant analysis. J Virol. 2005;79:4672–8. doi:10.1128/ JVI.79.8.4672-4678.2005. Laboratory techniques in rabies Fifth edition 137 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Chapter 39 Generation of anti-rabies single domain antibodies by display technologies Introduction Rabies virus (RABV)-specific, cross-neutralizing llama-derived heavy- chain antibody fragments (VHH, or nanobodies) can rapidly be generated from immunized llamas using phage display technology. Phage display is a well- established technique that uses bacteriophage to connect genotype with phenotype by expression and display of proteins that can be selected from large protein-encoding libraries. The technique was first described in 1985 (1). Proteins displayed may be peptides, antibody fragments such as single-chain antibody fragment (scFv), antigen-binding fragments (Fabs) or, as described here, variable heavy-chain fragments (VHH). The VHH are the antigen-binding, variable part of “heavy-chain only” antibodies present in Camelidae family members, such as llamas (2). The VHHs are small (12–15 kDa), biophysically stable molecules with good solubility characteristics and similar affinities to conventional antibodies (3). Llama-derived VHHs have proven to be powerful virus-neutralizers, including for RABV (4–6). Their single-chain nature allows construction and production of multimeric molecules using the same or different VHH building blocks joined by flexible Glycine4Serine (G4S) linkers, thereby targeting either one or two different epitopes on the same molecule (5, 7). By linking two VHH into bivalent (two identical VHH) or biparatopic (two different VHH) constructs, the neutralizing potency can be increased to the picomolar range. In mouse challenge models, the protective effect further improves significantly by increasing the half-life through linkage with a third VHH targeted against serum albumin. Although some interference with the antigenicity of rabies vaccine is observed, combined use of anti-rabies VHH and vaccine can act synergistically to protect mice after RABV exposure (8, 9). These properties make them promising molecules for prophylactic and therapeutic purposes, as well as for diagnostics and research. Ablynx (Sanofi) is developing VHH-based therapeutical proteins (trademarked as Nanobodies®). The principles of phage display and panning are illustrated in Fig. 39.1. Methods Immunizations Inactivated rabies vaccine Mérieux HDCV for use in humans contains the Wistar strain of the Pitman Moore RABV grown on human diploid WI38 lung cells (PM/ WI38 1503 3M). It contains human albumin, but no adjuvant. Intramuscular injec- tion of the vaccine suspension, divided over two spots (0.5 mL/spot, correspon- ding to 2.5 IU), was performed in the neck of llamas on days 0, 7, 28, 35 and 57. Blood was collected in tubes containing ethylenediaminetetraacetic acid (EDTA) Laboratory techniques in rabies Fifth edition 138 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals at time points as indicated in Table 39.1. The neutralizing potency of the immune serum from immunized llamas can be determined with the rapid fluorescent focus inhibition test (RFFIT) as described (10). A serum titre of 0.5 IU/mL indicates a seroconversion. The serum titre of neutrali- zing antibodies in two immune llamas is shown in Table 39.1. They both had a titre in the range of 15–35 IU/mL after repeated immunization with HDCV (Table 39.1). Immune variable heavy-chain fragment library construction for phage display Immune VHH library construction is divided into five parts: (i) isolation of total RNA, (ii) cDNA synthesis, (iii) polymerase chain reaction (PCR) amplifica- tion of VHH (variable domain fragments, derived from llama heavy-chain immu- noglobulins (2)), (iv) ligation into phagemid vectors and (v) expression of VHH containing phage for selections (caution: work on ice as much as possible). Isolation of total RNA Isolate peripheral blood lymphocytes (PBL) from total blood using routine ficoll gradients (PBL1-3 can be combined or used alone depending on the immune response). Total RNA from PBL can also be extracted using the RNeasy Midi Kit [Qiagen] following the manufacturer’s protocol. Lymph nodes may be indistingui- shably enlarged, which makes them difficult to find and therefore unsuitable for use as a source of lymphocytes. Determine the OD260/OD280 ratio as an indication of the quality of the puri- fied RNA (should be around 2). Estimated total RNA amounts from 150 mL blood are ~ 200–1000 µg. Determine the integrity of the sample on a 1% agarose gel in a tank (combs and tray) cleaned with 0.1 % SDS (at least for 1 h and rinse with ddH2O) to avoid degradation. Three bands of RNA should be observed: ~1500 bp, 800 bp and a band below 200 that corresponds to 28S, Fig. 39.1. Principles of phage display and panning Source: reference (12) Laboratory techniques in rabies Fifth edition 139 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 18S and 6S rRNA, respectively. Occasionally, a band of 70–100 bp can be visible representing tRNA. Possible DNA contamination will be above 10 000 bp. cDNA synthesis Use random primers and the SuperScript III First-Strand Synthesis System for RT-PCR according to the manufacturers’ recommenda- tions to amplify VHH encoding gene fragments. [The QIAquick PCR Puri- fication Kit can be used for clean up, but is not a necessary step.] PCR amplification This is divided into two amplifications: the first step amplifies conventional and heavy-chain antibody genes from cDNA, resulting in antibody fragments from FR1 to CH2 of VHH using two framework 1 (FR1) specific primers (051 and 052) and a CH2-specific primer (003). DNA fragments corresponding to 600 bp and sepa- rated from the conventional antibody-derived VH of around 900 bp are extracted from a 1% agarose gel and used as a template in the second nested PCR reac- tion using primers flanked with SfiI and BstEII restriction sites in the 5’ and 3’ end, respectively (primers 050 and 003). These fragments are cloned into a phagemid vector upstream of a c-myc tag and a His6-tag as well as gene3 for display on filamentous bacteriophage, as previously described (11). Electrocompetent Esche- richia coli TG1 are transformed, generating library sizes of around 108 and phage expressing VHH are prepared as described in Annex 2. Table 39.1. Immunizations, blood collection and sero-conversion Day Immunization (vaccine potency IU) Blood collection RFFIT titre* (50% dilution) Llama 1 Llama 2 0 2.5 10 mL pre-immune blood < 0.5 IU/mL (1/9) < 0.5 IU/mL (1/9) 7 2.5 – 27 10 mL immune blood 2 IU/mL (1/66) 6 IU/mL (1/179) 28 2.5 – 35 2.5 – 37 10 mL immune blood 22 IU/mL (1/674) 27 IU/mL (1/789) 42 150 mL immune blood (PBL1) 37 IU/mL (1/989) 33 IU/mL (1/896) 49 150 mL immune blood (PBL2) 23 IU/mL (1/674) 15 IU/mL (1/441) 57 2.5 – 62 150 mL immune blood (PBL3) 22 IU/mL (1/673) 35 IU/mL (1/1071) IU, international unit; RFFIT, rapid fluorescent focus inhibition test, virus-neutralization test Laboratory techniques in rabies Fifth edition 140 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Phage display for selection of RABV-specific llama variable heavy-chain fragments Selections for RABV glycoprotein (G protein)-specific VHH are performed on 8-well strips pre-coated with native G protein from the PV (Pasteur virus) strain (Platelia II Rabies plates). An overnight culture of E. coli TG1 is prepared from a single colony taken from a minimal M9 agar plate. Both the strips and the input phage, prepared using standard protocol (Annex 1), are blocked in superblock (Pierce) or 1% skimmed milk (Marvel) in PBS for 1 h at room temperature. Add 10  µL phage to 90 µL superblock per well and incubate with shaking for 2 h at room temperature. Remove the phage-containing solution in each well with clean filter tips and wash carefully 20 times with PBS + 0.05% Tween 80, followed by five times PBS. Use new tips for every well. Elute with 100 µL trypsin/well (1 mg/mL) for 15 min at room temperature with shaking. Stop the trypsin reac- tion by addition of 5 µL 4 mg/mL ABSF (adult bovine serum). Infect exponentially growing TG1 for 30 min at 37 °C and titrate for determination of output enrich- ment compared with control as described below. Infect 50 µL of eluted phage into 333 µL TG1 (OD600=0.5) + 666 µL 2×TY. Infect for 30 min at 37 °C without shaking. Add 10 mL 2×TY amp100 Glu2 % and grow overnight at 37 °C, 250 r/min. Store grown culture as glycerol stock at −80 °C. Output phage titration Prepare serial dilutions (10-1–10-5) in a 96-well culture plate (10 µL output phage in 90 µL PBS); add 5 µL of phage dilutions to 95 µL of exponentially growing TG1 (OD600=0.5). Infect for 30 min at 37 °C without shaking. Plate 5 µL drops in dupli- cate on LB/amp100/gluc2% plates and incubate at 37 °C overnight. Calculate the number of input phage when colonies have grown. Store remainder of eluted output phages as glycerol stock at −80 °C. For calculation of input phage Prepare serial dilutions of input phages in 96-well culture plate (10 µL output phage in 990 µL PBS); typically, 1E2, 1E4, 1E6, 1E8 and 1E10. Infect as described for output phage. Repeat the selections if needed to enrich for RABV-binding VHH expressed on phage. Use 1 µL of input phage in selection round 2. When enrich- ment is observed compared to the control (PBS or irrelevant coated protein), the overnight cultures of infected TG1 are diluted and plated on LB/amp100/gluc2% plates. Dilute enough to have individual colonies that are transferred to a 96-well plate (v-shaped) with 85 µL of 2×TY amp100/Glu2% and let them grow overnight at 37 °C. This is a master plate and is used for production of VHH and sequencing. The plate is stored at −80 °C in glycerol to be able to trace back the individual clones. Periplasmic expression of variable heavy-chain fragments From the overnight cultures in the 96-well plate, periplasmic extracts contai- ning VHH are prepared by induction of exponentially growing E. coli TG1 with 1 mmol isopropyl-ß-D-1-thiogalactopyranoside (IPTG) and continued cultivation overnight at 37 °C (can be performed in 1–400 mL scale) at 250 r/min for produc- tion of VHH. After centrifugation, the bacterial pellet is freeze-thawed and re-sus- pended in PBS. The His6-tag is used for purifications with Talon Metal affinity Laboratory techniques in rabies Fifth edition 141 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals resin [Clontech] according to the manufacturer’s instructions. The concentration of the purified VHH is determined by OD280 and the purity (1 µg) by SDS-PAGE under reducing (with DTT) and non-reducing conditions. A band of around 15 kDa corresponds to a VHH. Purified VHH can be characterized by enzyme-linked immunosorbent assay (ELISA), competition assays and virus-neutralization assays (RFFIT). VHH encoding genes can be fused into multimeric constructs with flexible G4S-linkers of different lengths to form bivalent or biparatopic molecules targeting one or more different epitopes. Enzyme-linked immunosorbent assay The RABV G pre-coated on 8-well strips (BioRad) can also be used to identify the G-specific VHH by addition of periplasmic extracts containing VHH, followed by incubation for 2 h at room temperature. After washing, add rabbit anti-VHH anti- body (MCA, The Netherlands) (1/5000 dilution) and incubate for 1 h at room tempe- rature. Add horseradish peroxidase-conjugated goat anti-rabbit IgG (1/10  000, Jackson) and incubate for 1 h at room temperature. Add 3,3’,5,5’-Tetramethyl- benzidine (TMB) substrate and read at 620 nm. Competition assays can be set up using ELISA to home in on specific epitopes or to evaluate if the selected VHH bind to the same or different epitopes. Label the first VHH (VHH1) with biotin as described by the manufacturer [Thermo Scientific], and determine the concentration at 50% binding. Incubate this fixed amount of VHH1-biotin with a dilution series of a second VHH (VHH2) and evaluate compe- tition by reduction in signal. Use cold unlabelled VHH1 as positive control for the competition assay. Virus-neutralization assay (rapid fluorescent focus inhibi- tion test) The RFFIT is a virus-neutralization assay using baby hamster kidney (BHK)-21 cells as susceptible targets. It is performed according to the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals and as described in Chapter 19 of this manual. Serial three-fold dilutions of heat-inactivated serum samples are incubated with the CVS-11 strain of RABV in 8-well tissue culture chamber slides for 90 min at 37 °C. BHK-21 cells are then added to the serum– virus mixture and incubated for an additional 20–24 h at 37 °C and 5 % CO2. Slides are acetone-fixed and stained with an FITC-coupled anti-nucleocapsid conjugate and evaluated using a fluorescence microscope to score the number of virus-in- fected cells (foci) under 200× magnification. The number of positive fields (of 20) with RABV-infected cells per well is recorded. The neutralization end-point titre is defined as the highest sample dilution at which 50% of the observed microscopic fields contain no infected cells. The in vitro neutralizing potency is expressed in International Units (IU)/mL in reference to “The 2nd International Standard for Anti-rabies Immunoglobulin, Human” from the United Kingdom National Institute for Biological Standards and Control (NIBSC, Potters Bar, Herts, UK). Laboratory techniques in rabies Fifth edition 142 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Discussion VHHs have been shown to be excellent virus neutralizers, including of RABV. Part of this success is due to what is termed “targeting precision”. Antibodies should recognize their cognate epitope but not the adjacent amino acids of the epitope. Conventional antibodies often interact with these amino acids because they are large, whereas VHH often do not interact at all with adjacent amino acids. Moreover, due to their small size VHH often can interact with cavities of the para- tope. The monovalent nature of the molecules allows for multimerization to increase both potency and virus cross-neutralization (5, 8). The length of the flexible linker can be varied to optimize intramolecular binding within a trimeric protein such as the RABV G, or between two different trimeric proteins, potentially preventing viral escape. Experimental tips Critical parameters and troubleshooting All steps should be properly quality controlled before proceeding with the next steps. High-quality RNA is important. Always work RNase-free and on ice. TG1 must be kept on minimal M9 agar plates to maintain the sex pilus on TG1 for infection by the phage when grown to exponential phase. As a contamination control, always include TG1 both in culture medium and on plates when spotting. Alternatives Elutions can be performed with pH shock using 100 mmol triethylamine (TEA, pH 12) or 0.2 mol Glycine-HCl, pH 2.2 for 15 min at room temperature with shaking. Transfer eluted phage to a new well or tube and neutralize immediately. Blocking solution can be exchanged with 1% skimmed milk (Marvel), 2% casein or 2% BSA (all dissolved in PBS). Even if biotinylated antigens are used for selections, milk-derived blocking agents can still be used, but superblock is preferred. Precautions • Use gloves when working with RNA. • Clean bench and pipettes with RNase away [Molecular BioProducts]. • Use a separate set of pipettes for library constructions to avoid contaminations. • Use QIAquick PCR Purification Kit and QIAquick Gel Extraction Kit dedicated only for library construction. • Clean gel chambers with 0.2 mol NaOH and rinse well with deionized or sterile water. • Clean gels chambers with 0.2 mol HCl O/N and rinse well with deionized or sterile water before use. • Work on ice. Laboratory techniques in rabies Fifth edition 143 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals • Make sure that there is no excess chromosomal DNA after RNA isolation because it will bind the RNA upon precipitation. • To avoid contamination of phage, use filter tips for every step and clean care- fully the bench with bleach before and after use. Preferably work in dedicated laminar flows. • Never use pipettes for inoculation of TG1, but sterile stripettes to avoid conta- mination. Time considerations Immunizations take at least 6 weeks, RNA extraction and library preparation 1–2 weeks. Selections take 2–4 weeks dependent on complexity and rounds of selection. Limitations Displaying VHH by bacteriophage does not allow for affinity selections since more than one copy of VHH is displayed on each phage, with the exception of monomeric target proteins (should be kept in solution as a biotinylated protein). Laboratory techniques in rabies Fifth edition 144 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals References 1. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 1985;228:1315–7. PMID:400194. 2. Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, et al. Naturally occurring antibodies devoid of light chains. Nature. 1993;363:446–8. doi:10.1038/363446a0. 3. Harmsen MM, de Haard HJ. Properties, production, and applications of camelid single-domain antibody fragments. Appl Microbiol Biotechnol. 2007;77:13–22. doi:10.1007/s00253-007-1142-2. 4. Forsman A, Beirnaert E, Aasa-Chapman MnMI, Hoorelbeke B, Hijazi K, Koh W, et al. Llama antibody fragments with cross-subtype human immunodeficiency virus type 1 (HIV-1)-neutralizing properties and high affinity for HIV-1 gp120. J Virol. 2008;82:12069–81. doi:10.1128/JVI.01379-08. 5. Hultberg A, Temperton NJ, Rosseels V, Koenders M, Gonzalez-Pajuelo M, Schepens B, et al. Llama-derived single domain antibodies to build multivalent, superpotent and broadened neutralizing anti-viral molecules. PLoS One. 2011;6:e17665. doi:10.1371/ journal.pone.0017665. 6. van der Vaart JM, Pant N, Wolvers D, Bezemer S, Hermans PW, Bellamy K, et al. Reduc- tion in morbidity of rotavirus induced diarrhoea in mice by yeast produced mono- valent llama-derived antibody fragments. Vaccine. 2006;24:4130–7. doi:10.1016/j. vaccine.2006.02.045. 7. Roovers RC, Laeremans T, Huang L, De Taeye S, Verkleij AJ, Revets H, et al. Effi- cient inhibition of EGFR signalling and of tumour growth by antagonistic anti-EGFR Nanobodies. Cancer Immunol Immunother. 2007;56:303–17. doi:10.1007/s00262- 006-0180-4. 8. Terryn S, Francart A, Lamoral S, Hultberg A, Rommelaere H, Wittelsberger A, et al. Protective effect of different anti-rabies virus VHH constructs against rabies disease in mice. PLoS One 2014;9:e109367. doi:10.1371/journal.pone.0109367. 9. Terryn S, Francart A, Rommelaere H, Stortelers C, Van Gucht S. Post-exposure treat- ment with anti-rabies VHH and vaccine significantly improves protection of mice from lethal rabies infection. PLoS Negl Trop Dis. 2016;10:e0004902. doi:10.1371/journal. pntd.0004902. 10. Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabies neutra- lizing antibody. Bull World Health Organ. 1973;48:535–41. PMID:4544144. 11. De Haard HJW, Bezemer S, Ledeboer AM, Müller WH, Boender PJ, Moineau S, et al. Llama antibodies against a lactococcal protein located at the tip of the phage tail prevent phage infection. J Bacteriol. 2005;187:4531–41. doi:10.1128/JB.187.13.4531- 4541.2005. 12. Hoogenboom HR, de Bruïne AP, Hufton SE, Hoetab RM, Arends JW, Roovers RC. Antibody phage display technology and its applications. Immunotechnology. 1998;4:1–20. PMID:9661810. 13. Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 1991;19:4133–7. PMID:1908075. Laboratory techniques in rabies Fifth edition 145 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Annex 1. Materials Reagents For total RNA isolation • RNAeasy Midi kit [Qiagen] • 96% ethanol (RNase-free) • 2 M NaAc pH 4 (RNase-free) • RNase-free 1.5 mL microcentrifuge tubes • double autoclaved distilled water • RNase away solution [Molecular BioProducts, catalogue number 7002] cDNA synthesis: SuperScript III First-Strand Synthesis System [Invitrogen] Primers for amplification of VHH • 051 (homology to FR1) 21 bp: GGCTGAGCTGGGTGGTCCTGG • 052 (homology to FR1) 21 bp: GGCTGAGTTTGGTGGTCCTGG • 003 (homology to CH2) 23 bp: GGTACGTGCTGTTGAACTGTTCC • 050 (SfiI containing FR1) 55 bp: CATTTGAGTTGGCCTAGCCGGCCATGGCAGAGGTGCAGCTGGTGGAGTC- TGGGGG PCR reagents • 20 mmol dNTP • 10× buffer (+Mg) and Expand High Fidelity enzyme (3.5 U/µL) [Roche Diagnos- tics GmbH] • TAE buffer and agarose • DNA QIAquick PCR Purification Kit and QIAquick Gel Extraction Kit [Qiagen] Restriction enzymes and ligase • BstEII (10 U/µL) and SfiI (20 U/µL [Biolabs]) • T4 ligase (3 U/µL [Promega]) Antibodies coupled anti-RABV nucleocapsid IgG – FITC conjugate [Bio-Rad Laboratories, France] Platelia II Rabies kit [Bio-Rad Laboratories, catalogue number 355-1180], 8-well strips pre-coated with native RABV G Phagemid vector for fusion of VHH with c-myc-His6 and gene3 at sites BstEII 5’ and SfiI 3’ (11), which is identical to pHEN-1 (13), but contains a hexahistidine tail for immobilized metal affinity chromatography (IMAC). Laboratory techniques in rabies Fifth edition 146 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Equipment • spectrophotometer (UV: preferably 230–310 nm and 600 nm) and cuvettes (if necessary) • table centrifuge • PCR thermocycler • DNA electrophoresis systems cleaned with NaOH and HCl • UV/VIS camera for DNA gel and agar plate imaging • UV camera for slicing out DNA fragments • incubator at 50 °C and 60 °C and 16 °C (without shaking) • incubator at 37 °C with shaker • electroporator • fluorescence microscope [Olympus IX73] Biological materials • rabies vaccine Mérieux HDCV [Sanofi Pasteur MSD] • BHK-21 cells (ATCC CCL-10) • CVS-11, a reference laboratory strain of RABV, genus Lyssavirus, family Rhab- doviridae, ATCC VR959) • Escherichia coli TG1, electrocompetent Escherichia coli TG1 [Stratagene] • M13KO7 Helper phage Laboratory animals Two llamas (Lama glama) [purchased from N.V. Neerhofdieren Bocholt] were located at the animal facilities of the Belgian Scientific Institute of Public Health (WIV-ISP, authorization no. LA1230177). All experimental procedures were approved by the Ethical Committee of the WIV-ISP and the Veterinary and Agro- chemical Research Centre (CODA-CERVA). Laboratory techniques in rabies Fifth edition 147 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Annex 2. Phage preparation, composition of solutions and preparation of helper phage Phage preparation Precipitate phage with 1/4 volume 20% PEG6000/2.5 mol NaCl, for 10–15 min on ice. Centrifuge 5 min, max speed, remove supernatant. The pellet contains your precipitated phage. Repeat the centrifugation, remove remaining supernatant and leave the tubes head down on a tissue to remove all PEG. Re-suspend the pellet in 1/2 volume PBS. Centrifuge 5 min, max speed, and take the supernatant into a new microcentrifuge tube. If there is still a pellet (cellular debris), repeat the centrifugation step and transfer the supernatant to a new microcentrifuge tube. Composition of media, buffers, solutions 2×TY media (1 L) 1. Dissolve 16 g tryptone, 10 g yeast extract, 5 g NaCl, deionized water to 1 L. 2. Autoclave. 3. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media has cooled down to 55°C. LB (Luria broth) media (1 L) 1. Dissolve 10 g tryptone, 5 g yeast extract, 5 g NaCl, deionized water to 1 L. 2. Autoclave. 3. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media have cooled down to 55 °C. LB agar (1 L) 1. Dissolve 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 950 mL deionized water. 2. Adjust the pH of the medium to 7.0 using 1N NaOH. 3. Autoclave. 4. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media have cooled down to 55 °C. Minimal (M9) agar plates (1 L) 1. Dissolve 15 g Difco Bacto agar in 888 mL H2O and autoclave. Laboratory techniques in rabies Fifth edition 148 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 2. Prepare 100 mL 10×M9 salts (60 g Na2HPO4, 30 g KH2PO4, 10 g NH4Cl, 5 g NaCl, final volume 1 L autoclaved and stored at 4 °C), 1 mL 1 mol MgSO4, 0.1 mL 1 M CaCl2, 1 mL 1% thiamine HCl (filter sterilized), 10 mL 20 % glucose and add to the autoclaved agar solution when the temperature reaches 60 °C. 3. Fill to final volume of 1 L with deionized water when the temperature reaches 60 °C, pour plates. 20 glucose (w/v) (100 mL) 1. 20 g glucose, add to 100 mL with deionized water. 2. Autoclave. 20% glycerol in 2×TY (90 mL) Add 30 mL 60% glycerol (autoclaved; do not autoclave 100% glycerol) to 60 mL sterile 2×TY. 1×TAE (1 L) 20 mL 50×TAE and fill to 1 L with deionized water. TE buffer (100 mL) 1 mL 1 mol Tris-HCl, 0.2 mL 0.5 mol EDTA pH 8.0, 98.8 mL deionized water. Preparation of M13KO helper phage 1. Grow an overnight culture of TG1 in LB media at 37 °C starting from a single colony grown on a minimal M9 plate. 2. Inoculate 1:100 in LB and grow to log phase (OD600: 0.6–0.9). 3. Make top agar (2×TY-agar 0.75 %) and let it cool to 50 °C in a water bath. 4. Streak 1 µL of a helper phage stock (e.g. ~3×1012 pfu/mL) and 1 µL of a 100× diluted stock onto the surface of a pre-warmed 2×TY plate. 5. Add 5 mL of the TG1 culture to 30 mL of top agar (at 50 °C). 6. Immediately pour 3 mL of TY top agar containing the TG1 culture across the plate from the end towards the start of the streak. Allow the top agar to solidify for a few minutes and incubate at 37 °C overnight. Do not forget to inoculate new TG1. 7. Pick four well-separated single plaques (small ones) with a glass pipette and drop into 4×4 mL of 2×TY with a 1:100 dilution of an overnight TG1 culture. 8. Grow for 2 h at 37 °C. 9. Dilute the 4 mL cultures into 100 mL of 2×TY in a 2 L flask, preferably baffled for good aeration. 10. Grow for 1 h at 37 °C. If baffled flasks are available, add 300 mL of 2×TY with kanamycin (final concentration: 25 µg/mL) and grow overnight. If baffled flasks are not available just add kanamycin (final concentration: 25 µg/mL). 11. Spin down the bacteria in 50 mL tubes for 15 min. Laboratory techniques in rabies Fifth edition 149 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 12. Pour 40 mL of the supernatant in tubes with 10 mL 20 % PEG6 000/2.5 M NaCl and incubate on ice for at least 30 min. Spin down for 15 min and discard the supernatant, leave the tubes head down on tissue paper to remove all PEG. 13. Re-suspend the pellet (for 4×400 mL: 4 times 8 pellets) in 1 mL of filter sterile TE buffer. Centrifuge the bacteria in microcentrifuge tubes to remove remai- ning cell debris for 5 min at 4 °C. 14. Combine all supernatants (approximately 32 mL) and add an equal volume of 100% sterile glycerol. 15. Determine the titre of the phages by making dilutions of 104 to 1014 in PBS and plate 100 µL of these dilutions on 2×TY plates and add top agar with TG1 (see above). Make aliquots and store at –80 °C. Laboratory techniques in rabies Fifth edition 150 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Chapter 40 Production of monospecific polyclonal rabies virus antibodies in birds Introduction An antigen-specific IgY was purified from egg yolk laid by intramuscularly immunized hens independently by Jensenius (1) and Polson (2) during the 1980s. Since then, numerous reports have demonstrated that IgY is the functional equi- valent of mammalian IgG to be used as an immunological tool in diagnosis as well as in passive immunization, administered either systemically or orally to indivi- duals for prevention of infectious diseases. Recent advances in molecular biology, together with a newly invented method of producing antigen-specific IgY, have created opportunities to develop a safe, convenient and inexpensive way of manufacturing various immunodiagnostics (3). These methods have already led to the development of orally administered agents for the prevention of enteric colibacillosis, dental caries and human rotavirus infection (4–6). The method of producing IgY antibodies has certain advantages over their production from mammals, in that: there is no need to bleed animals; it is easy to purify a large amount of antibody; and it is feasible to produce a specific antibody to a small amount of antigen that is poorly immunogenic in mammalian hosts (3, 7, 8). The technique of producing polyclonal antibodies in birds has great potential to advance rabies virus (RABV) diagnosis, research and use of biologicals, with the possibility of in-house production in developing countries (9, 10). Advantages of IgY compared with IgG Comparison of the methods for preparation of IgY and serum IgG and advan- tages in preparation of antibody using hens instead of animals are summarized in Table 40.1. Of note is that preparation of IgY requires only collection of eggs whereas preparation of serum IgG involves drawing blood or euthanasia of animals (Fig. 40.1). Egg yolk contains a considerable amount of IgY (around 100–150 mg/egg), and a laying hen produces an average of 240 eggs per year (11, 12). Therefore, one immunized hen could produce > 30 g of IgY a year, and > 60% of IgY in the egg yolk could be isolated with > 95% purity by a simple purification method. Conver- sely, exsanguination produces an antiserum of only 50 mL per rabbit wherein only 1400 mg of purified IgG could be isolated (6,13). Immunochemical differences between IgY and serum IgG are listed in Table 40.2. Of note is that IgY can be used in diagnosis because it is not asso- ciated with mammalian complement or rheumatoid factors (RF), and its binding Laboratory techniques in rabies Fifth edition 151 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals with human and bacterial Fc-receptors on cell surfaces is less than that of IgG. Also, IgY does not bind to protein A or G, as does IgG. These immunological properties are superior for IgY to avoid false–positive results due to human serum characteristics in diagnosis. Fig. 40.1. Preparation of specific polyclonal antibodies Rabbit immunization Immunity egg way 1. Extraction source of an antibody Blood of rabbit Hen egg yolk 2. A specific antibody preparation (1) Immunity to rabbit (2) Exsanguination (3) Serum separation (4) Purification of the IgG (1) Immunity to chicken (2) Egg collection and yolk separation (3) Water solubility, protein separation (4) Refinement of the IgY 3. Class of the antibody An IgG in addition to a IgA and a IgM are included in the serum Yolk includes only IgY and purification is easy. 4. Animal culture way Mass rearing is difficult It’s possible to raise in quantities (large-scale poultry farming). 5. Immunization Rabbit is fixed and performed An immunization way is systematized for the purpose of chicken disease prevention. 6. Antibody manufacturing scale The laboratory level Industrial scale mass production is possible. Table 40.1. Comparison of a specific antibody preparation Laboratory techniques in rabies Fifth edition 152 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Materials and methods Immunization Rhode Island Red hens were used in this experiment as the donor host of egg yolk. The anti-rabies IgY was purified from the egg yolk of hens immunized a part of the G gene encoding truncated protein (rG-F2), the recombinant nucleoprotein (rN) and the P protein (rP) of RABV, CVS-11 strain (9,10). Preparation of RABV antigens Preparation of rG-F2, rN and rP of RABV was carried out according to a protocol reported elsewhere (14,15). The rG-F2, rN and rP expressed in Escherichia coli DH5α after transformation by plasmid DNAs were purified using a nickel-nitrilotriacetic acid column [Qiagen] and the expected sizes of purified proteins were confirmed by SDS-PAGE (9,10,15). Preparation of water in oil emulsion of antigens Counter-Lock type glass syringes (5 or 10 mL volume) were connected to each other by specially ordered 0.5 cm length jointing stainless tube (0.5 mm inner diameter) and used to prepare a stable water-in-oil emulsion of antigens. For one immunization to a hen, an antigen solution (1 mL) containing about 0.3  mg of recombinant protein was emulsified with 1 mL of Freund’s Complete Adjuvant by passing the mixture in the syringes back and forth through the joint tube. One drop of the emulsion was dropped through a 23-gauge needle attached to the syringe on water to confirm its intactness. For booster shots, an antigen solution (0.5 mL) was emulsified with Freund’s Incomplete Adjuvant (0.5 mL) as described above. The emulsion prepared can be stored for several days in a refrigerator before use. Immunization of hens and collection of samples Two hens were used for each recombinant antigen (rGF-2, rN, and rP). The emul- sion (1–2 mL) was injected by a 23-gauge needle intramuscularly into several sites evenly under the hen’s wings. Booster shots were injected in a manner similar to the first shot twice, with an interval of 2 weeks. Blood samples (about 1 mL) were a. The molecular weight of IgY is about 180 000 and of IgG is about 15 000. The H chain is large, has a constant region and consists of four domains. The IgG has three domains. b. The isoelectric point of IgY is about 6.0, which is almost 1 pH unit lower than IgG. c. The thermal denaturation temperature of IgY is 73.9 °C; the IgG of rabbits is 77 °C. d. Something has radical glucose at the end in a sugar chain of IgY. e. IgY does not activate a complement of the mammals. f. IgY does not combine with proteins A and G (IgG binding protein). g. IgY does not combine with a rheumatic factor (autoantibody to an Fc radical of an IgG). h. IgY does not combine with the Fc receptor of a mammalian cell. Table 40.2. Comparison of yolk (IgY) and serum (IgG) in mammalian antibodies Laboratory techniques in rabies Fifth edition 153 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals drawn from the wing vein on every immunization day, and serum was separated by conventional methods and stored frozen until use for determination of antibody titres by an enzyme-linked immunosorbent assay (ELISA) using the recombinant antigens (rGF-2, rN, and rP) during the solid phase (16). Egg production after immunization The hens’ weight changed little from the first immunization for 18 weeks and maintained at around 2.0 kg. The egg-laying rates of the immunized hens dropped drastically from 80% to 20% during the 2 weeks after the first immunization; however, these rates recovered individually to 70–80 % after the third immuni- zation. The egg-laying rates of immunized hens were almost identical to those of unimmunized hens, starting at around 80% and maintaining at around 60% at 18 weeks after the first immunization. Total egg production per hen averaged 98 eggs in 18 weeks, resulting in 78% of the average egg-laying rate. Eggs were collected daily and stored in a cold room up to one month to sepa- rate egg yolk from egg white by using a yolk separator instrument, followed by breaking the eggs. The egg yolk was then rotated carefully on paper towels to remove excess egg white from the yolk membrane. An aliquot of yolk from an egg laid every 2 weeks after the first immunization was diluted with an equal volume of water containing 0.05% NaN3 as a preservative and stored in the cold room until titrated. The egg yolk samples were pooled in alternate weeks and frozen until IgY separation. The ELISA values of egg yolks obtained from individual hens against antigens (rGF-2, rN, and rP) generally increased after the second immunizations and reached a maximum at 6 weeks after the third immunization. The ELISA values decreased gradually after a maximum during the immunization period (16). Control egg yolk from unimmunized hens did not bind any antigens at all. Pooled egg yolks between 6 to 8 weeks of the individual hens were selected for further IgY purification. Purification of IgY The modified λ-carrageenan method was used, as summarized in Fig. 40.2. Briefly, the stored egg yolk (100 g) was mixed and homogenized with 700 mL of 0.36% NaCl. The homogenate was mixed slowly with 400 mL of 0.4% λ-car- rageenan solution to confirm generation of floating lipoprotein coagulum, while being gently stirred with a spatula. The mixture was then left for 1 h at 20 °C followed by centrifugation at 7000 × g for 30 min. The supernatant was filtered with filter-paper, precipitated with 15% (w/v) sodium sulfate three times, then dialysed against 10 mmol disodium hydrogen phosphate. Purified IgY fractions were stored at −80 °C until use after the dialysates were centrifuged and filtrated through 0.45 µm syringe filters. Egg yolk generally contains IgY of about 1% (w/w). λ-carrageenan precipitate most lipoproteins in egg yolk by the mode of the ionic binding in slightly acidic pH of around 6. Since the IgY is a water-soluble protein in egg yolk, it is recovered Laboratory techniques in rabies Fifth edition 154 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals in the supernatant after precipitating the λ-carrageenan-lipoproteins complex. The IgY recovery is generally 68% with 29% purity in the water-soluble fraction. A salting out procedure using sodium sulfate performed quite well to precipitate IgY. This procedure was repeated several times by monitoring IgY purity using analytical SEC-HPLC. The final dialysate contained quite pure IgY with 61% of recovery and 98% of purity (16). Fig. 40.2. Modified λ-carrageenan method Antibody titres of egg yolks The ELISA values of IgY obtained from individual hens against antigens (rGF-2, rN and rP) are shown in Fig. 40.3. The values generally increased after the second immunizations and reached a maximum at 6 weeks after the third immunization individually. The ELISA values decreased gradually after a maximum during the immunization period. Thus, an appropriate booster shot is needed to maintain high antibody titres. Control egg yolk from unimmunized hens did not bind any antigens. Pooled egg yolks between 6 to 8 weeks of the individual hens were selected for further IgY purification. Laboratory techniques in rabies Fifth edition 155 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Detection of RABV antigens by IgY Immunological staining of RABV antigens has been reported with rabbit IgY developed by the immunization of RABV proteins (rGF-2, rN and RP), as described previously, using brain tissues of mice infected with RABV and rabid dogs, which had been submitted and diagnosed by using fluorescence isothiocyanate (FITC)-conjugated anti-rabies monoclonal antibody at the Research Institute of Tropical Medicine in the Philippines (9, 15, 17–19). The specific binding to the N and P proteins of RABV was also detected by anti-rN IgY and anti-rP IgY, respectively (9, 10). The viral P antigens in the Ammon’s horn of two rabid dogs (No. 64 and No. 86) are shown in Fig. 40.4. Small transverse sections (2–3 mm in thickness) of Ammon’s horn, one a slide, were fixed with cold acetone overnight and incubated with anti-rP Ig Y for 30 min at 37 °C in a high-humidity chamber. After washing, the slides were further incubated with FITC-conjugated anti- chicken IgY rabbit IgG fraction for 30 min. The slides were examined using a fluorescence microscope. Fig. 3 Changes of Antibody Activities in Egg yolk (ELISA) A. Hens immunizedwithrGF-2 Ê o,i C 0,7 li) 0.'6 0 0"5 0,4 � 0.3 (/) ::J 0.2 w 0,1 0 0 2 4 • • week -.-eocrai ..... N'Cl..13 -.-No.14 10 12 14 B. Hens immunizedwithrN o"" Ê 0,7 C 0,6 li) 0"5 0 0,4 � 0.3 (/) 0.2 ::J w 0,1 0-0 .,. .... ...... .. . .............. . --·-···�·-· ....... � .............. : ........ :: ._ ......... ······· 0 2 4 " 10 12 14 week C. Hens immunized with rP 0..0 o"" -+-co,,trd -N'0.17 •••••No.18 Ê C 0.6' li) 0 0"5 � � 0,4 (/) :J 0..3 w 0.2 0,1 0.0 2 " 10 week • Egg yolk was diluted 800-fold for use in ELISA. • lmmunization t 12 14 Fig. 40.3. Changes in antibody activity in egg yolk Laboratory techniques in rabies Fifth edition 156 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Discussion The anti-rN and rP IgY were shown to bind specifically to the respective proteins of the CVS-11 strain of RABV by western blotting, indirect fluorescent antibody test and immunohistochemistry, indicating that IgY to RABV recombi- nant proteins could serve as a reagent for diagnosis of RABV infection (9, 10). The progression of the signs in RABV-infected mice was also substantially delayed by the inoculation of anti-rG-F2 IgY as PEP at the proximal site of RABV inoculation (10). Therefore, anti-RABV IgY prepared following this method is suitable not only for diagnosis but also for potential therapeutic use instead of antibodies origina- ting from mammals. Trott and colleagues reported that older hens generally had higher IgY titres than younger hens (20). In our experience, older hens also tend to tolerate severe immunization. We used Rhode Island Red hens aged around 300 days for immu- nization. To avoid a reduction in egg production due to the inflammation in the hens, Freund’s Complete Adjuvant with recombinant antigens was applied for primary immunization and Freund’s Incomplete Adjuvant was applied for booster immunizations. Higher antibody activity and purity of the IgY would enable the application of IgY in diagnosis as well as a passive immunization therapy. The most common injection route is the intramuscular route. Chang and collea- gues demonstrated that intramuscular immunization results in higher levels of specific IgY when compared with the subcutaneous route (21). However, intramus- cular injections into the hen’s legs sometime cause limping and improper feed intake and therefore we chose to inject the muscle under the hen’s wing. Although egg-laying rates drastically dropped after the first injection for several weeks, immunized hens recovered well to achieve comparable egg-laying rates (around 80%) to those of the unimmunized hens, which lasted for 4 months. B y co ur te sy o f S at os hi In ou e, N at io na l I ns tit ut e of In fe ct io us D is ea se s, S hi nj uk i, To ky o, J ap an Fig. 40.4. IFA staining of rabies virus P proteins in Ammon’s horn of rabid-dog brain Laboratory techniques in rabies Fifth edition 157 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals IgY is one of the water-soluble proteins in egg yolk. Therefore, separation of the water-soluble IgY from abundant yolk lipoproteins is the first step of IgY purifica- tion. Many purification methods for IgY have been developed that involve preci- pitation of lipoproteins with polyethylene glycol or poly-anions, such as dextran sulfate, sodium alginate, xanthan gum, λ-carrageenan and pectin (1, 2, 20, 22–24). These lipoprotein-coagulating agents work effectively to retain the water-so- luble proteins in the supernatant after centrifugation. Thereafter, IgY is generally isolated in pure form by salting out using either ammonium sulfate or sodium sulfate. The λ-carrageenan method was further modified to improve IgY recovery (61%) and its purity (98%). Tan and colleagues developed a cost–effective and efficient IgY purification method to obtain IgY with high recovery and purity by employing the existing commercial IgY isolation kits (25). They obtained chicken IgY of high yields (60 mg) and high purity (about 80%) using pectin and λ-carrageenan in the presence of calcium chloride to precipitate egg yolk lipoproteins while retaining IgY in solu- tion followed by salting out IgY with higher purity. The modified λ-carrageenan method shown in this protocol might be superior to any other reported methods for obtaining the highest purity of IgY of > 90% in protein basis, and suitability for large-scale purification of chicken IgY. The method of producing antigen-specific antibodies in egg yolk (IgY) can provide new opportunities to develop a safe, convenient and inexpensive way of manufacturing various immunodiagnostics. Laboratory techniques in rabies Fifth edition 158 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals References 1. Jensenius JC, Anderson I, Hau J, Crone M, Koch C. Eggs: conveniently packaged antibodies. Method for purification of yolk IgG. J Immunol Methods. 1981;46:63–8. 2. Polson A, von Wechmar MB, van Regenmortel MH. Isolation of viral IgY anti- bodies from yolks of immunized hens. Immunol Commun. 1980;9:475–93. 3. Hatta H, Akachi S, Kim M. [Production of egg yolk antibody (IgY) and its use]. Nippon Nogeikagaku Kaishi 1994;68:1457–62 (in Japanese). 4. Yokoyama H, Peralta RC, Diaz R, Sendo S, Ikemori Y, Kodama Y. Passive protective effect of chicken egg yolk immunoglobulins against experimental enterotoxigenic Escherichia coli infection in neonatal piglets. Infect Immun. 1992;3:998–1007. 5. Hamada S, Horikoshi T, Minami T, Kawabata S, Hiraoka J, Fujiwara T, et al. Oral passive immunization against dental caries in rats by use of hen egg yolk antibodies specific for cell-associated glucosyltransferase of Streptococcus mutans. Infect Immun. 1991;11:4146–67. 6. Hatta H, Tsuda K, Akachi S, Kim M, Yamamoto T. Productivity and some properties of egg yolk antibody (IgY) against human rotavirus compared with rabbit IgG. Biosci Biotechnol Biochem. 1990;54:2531–5. 7. Carrol SB, Stollar BD. Antibodies to calf thymus RNA polymerase II from egg yolks of Immunized hens. J Biol Chem. 1983;258:24–6. 8. Lee K, Ametani A, Shimizu M, Hatta H, Yamamoto T, Kaminogawa S. Produc- tion and characterization of anti-human insulin antibodies in the hen’s egg. Agri Biol Chem. 1991;55:2141–3. 9. Motoi Y, Inoue S, Hatta H, Sato K, Morimoto K, Yamada A. Detection of rabies-specific antigens by egg yolk antibody (IgY) to the recombinant rabies virus proteins produced in Escherichia coli. Jpn J Infect Dis. 2005;58:115–8. 10. Motoi Y, Sato K, Hatta H, Morimoto K, Inoue S, Yamada A. Production of rabies neutralizing antibody in hen’s eggs using a part of the G protein expressed in Escherichia coli. Vaccine 2005;23:3026–32. 11. Rose ME, Orlans E, Buttress N. Immunoglobulin classes in the hen’s eggs: their segregation in yolk and white. Eur J Immunol. 1974;4:521–3. 12. Sim JS, Sunwoo HH, Lee EN. Ovoglobulin IgY. In: AS Naidu, editor. Natural food antimicrobial systems. New York: CRC Press; 2000:227–52. 13. Hatta H, Kim M, Yamamoto T. A novel isolation method for hen egg yolk anti- body “IgY”. Agri Biol Chem. 1990;54:2531–5. 14. Inoue S, Motoi Y, Kashimura T, Ono K, Yamada A. Safe and easy monitoring of anti-rabies antibody in dogs using His-tagged recombinant N-Protein. Jpn J Infect Dis. 2003;56:158–60. Laboratory techniques in rabies Fifth edition 159 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals 15. Inoue S, Sato Y, Hasegawa H, Noguchi A, Yamada A, Kurata T, et al. Cross-reactive antigenicity of nucleoproteins of lyssaviruses recognized by a monospecific antirabies virus nucleoprotein antiserum on paraffin sections of formalin-fixed tissues. Pathol International. 2003;53:525–33. 16. Inoue S, Park C-H, Hatta H. Production of polyclonal rabies virus antibodies in birds. In: Rupprecht C, Nagarajan T, editors. Current laboratory techniques in rabies diagnosis, research and prevention (Volume 2). Elsevier; 2015:305– 16. 17. Kojima D, Park CH, Satoh Y, Inoue S, Noguchi A, Oyamada T. Pathology of the spinal cord of C57BL/6J mice infected with rabies virus (CVS-11 strain). J Vet Med Sci 2009;71:319–24. 18. Boonsriroj H, Manalo DL, Kimitsuki K, Shimatsu T, Shiwa N, Shinozaki H, et al. A pathological study of the salivary glands of rabid dogs in the Philippines. J Vet Med Sci. 2016;78:35–42. 19. Shimatsu T, Shinozaki H, Kimitsuki K, Shiwa N, Manalo DL, Perez RC, et al. Localization of the rabies virus antigen in Merkel cells in the follicle-sinus complexes of muzzle skins of rabid dogs. J Virol Methods 2016;237:40-6. 20. Trott DL, Yang M, Utterback PL, Utterback CW, Koelkeback KW, Cook ME. Utility of spent single comb white leghorn hens for production of polyclonal egg yolk antibody. J Appl Poult Res. 2009b;18:679–89. 21. Chang HM, Ou-Yang RF, Chen YT, Chen CC. Productivity and some proper- ties of immunoglobulin specific against Streptococcus mutans serotype c in chicken egg yolk (IgY). J Agric Food Chem. 1999;47:61–6. 22. Hatta H, Sim JS, Nakai S. Separation of phospholipids from egg yolk and recovery of water-soluble proteins. J Food Sci. 1988;53:425–7. 23. Akita EM, Nakai S. Comparison of four purification methods for the produc- tion of immunoglobulins from eggs laid by hens immunized with an entero- toxigenic E. coli strain. J Immunol Methods. 1993;160:207–14. 24. Chang HM, Lu TC, Chen CC, Tu YY, Hwang JY. Isolation of immunoglobulin from egg yolk by anionic polysaccharides. J Agric Food Chem. 2000;48:995–9. 25. Tan SH, Mohamedali A, Kapur A, Lukjanenko L, Baker MS. A novel, cost-ef- fective and efficient chicken egg IgY purification procedure. J Immunol Methods. 2012;380(1–2):73–6. Laboratory techniques in rabies Fifth edition 160 Plant production of monoclonal antibodies Part 6. Production of biologicals Chapter 41 Plant production of monoclonal antibodies for rabies Introduction Virus neutralizing antibodies (VNA) are a key component of immunity against viral infections, and act by preventing or modulating viral disease progression. Polyclonal antisera are still widely used for the prevention and/or post-exposure prophylaxis (PEP) of many infections and are important products because they can provide immediate protection even in immunocompromised individuals. They can also be reasonably cheap to manufacture, allowing greater accessibility in low and middle-income countries (LMICs). In rabies, passive immunization with rabies immunoglobulin (RIG) is well established for PEP. RIG is a WHO essential medicine and the preventive method of choice in most countries where rabies is endemic (1). Polyclonal antisera have drawbacks however, being derived either from human donors or large animals with consequent risks related to the use of blood products. They are often costly and/or in scarce supply and are, by their nature, mixtures of active compounds that exhibit significant batch-to-batch variability. In addition, the active pharmaceutical ingredient, i.e. the neutralizing antibodies, is poorly defined. For these reasons, monoclonal antibodies (MAbs) have been explored as alternatives to RIG by many groups (1–4). Clinical MAbs are manufactured by mammalian cell fermentation (5). This is an established industry with a number of successful blockbuster antibody drugs. However, a monoclonal antibody RIG replacement product would impose specific constraints, which are not addressed by the commercial MAb sector. Firstly, to ensure adequate viral coverage and prevent viral escape a combination of at least two MAbs would likely be required (6). At present there are no commercial MAb products comprising more than one antibody. Secondly, antibody production would be needed at an abundant scale. Every year, more than 15 million people worldwide receive a post-bite vaccination and require PEP (WHO factsheet 2017), suggesting that production of hundreds of kilograms annually of rabies MAbs would be required. Thirdly, rabies is predominantly a disease of LMICs, so to ensure accessibility and availability of any RIG replacement product, the invest- ment cost for manufacturing and cost of goods needs to be low. Specifically, the disincentive of upfront costs for product and clinical development for a product primarily for LMICs has been an important reason why there has been virtually no interest from the pharmaceutical industry to address this unmet medical need. Molecular pharming – the use of plant biotechnology to manufacture phar- maceuticals – offers some potential solutions, particularly in relation to cost, scalability and technology transfer to under-developed regions (7, 8). The appli- cation of molecular pharming to rabies MAb production has been explored by different groups (9–11) and the antibodies produced in plants have demonstrated Laboratory techniques in rabies Fifth edition 161 Plant production of monoclonal antibodies Part 6. Production of biologicals viral neutralization equivalent to their counterparts produced in mammalian cells. For example, two MAbs identified by WHO rabies collaborating centres as poten- tial clinical candidates (6) have been successfully produced in plants (3, 12), one of which (E559) was also demonstrated to protect against rabies virus (RABV) in a hamster challenge model (12). There are two mainstream approaches to producing MAbs in plants. The pionee- ring work on expression of antibodies in plants was developed in transgenic Nicotiana tabacum (13). The rabies MAbs from plants that have been described in the literature to date have also been produced by generating stable transgenic N. tabacum plants (Fig. 41.1A), in which the heavy and light chain MAb genes were incorporated into the plant nuclear genome, transgenic plant lines were regene- rated and the plant lines underwent standard plant breeding to achieve homo- zygosity and genetic and phenotypic stability (14). This transgenic approach is relatively slow but has the advantage of resulting in transgenic seed that are easy to store, distribute and grow at massive scale at low cost. The second approach is to express recombinant MAbs transiently in plants. Although this rapid gene expression system was also initially developed in N. tabacum (15, 16), N. benthamiana (Fig. 41.1B) became more widely used because it allows the use of inhibitors of post-transcriptional gene silencing, such as p19 from tomato bushy stunt virus (17). In transient expression systems, vectors based on plant viral elements or the Ti plasmid of Agrobacterium tumefaciens (18) containing the MAb genes are introduced into plants by a process called agro-in- filtration  (19, 20). This results in transfection of all the cells in the agro-infiltrated plant tissue and short-term, or transient, expression of the MAb genes, within a few days. The ZMapp antibodies used in the 2014 West Africa Ebola outbreak were manufactured using this approach (21). The key advantages of transient expression lie in the simplicity of the technique, the speed of expression and the high antibody yield achievable at laboratory scale. This transient expression tech- nique for antibodies in plants could be extremely valuable to researchers in the rabies field, even at laboratory scale where only a few milligrams of antibodies are required for use as a reagent. This chapter describes the detailed methodology and how to get started. Fig. 41.1. Nicotiana tabacum cv. Petit Havana SR1 (A) and Nicotiana benthamiana (B) The plants were grown in the greenhouse and are shown at about 6–8 weeks old. Whereas N. benthamiana potentially reaches 0.5 m in height at maturity, N. tabacum may grow to 2 m at maturity in the greenhouse, and more in the field. B y co ur te sy o f J ul ia n K .C . M a, S t G eo rg e’ s H os pi ta l M ed ic al S ch oo l, Lo nd on , U K . Laboratory techniques in rabies Fifth edition 162 Plant production of monoclonal antibodies Part 6. Production of biologicals Key features of the stable transgenic (GM plant) and the transient gene expres- sion via agro-infiltration approaches are summarized in Table 41.1. Of note, the initial cloning work is virtually the same for both approaches and some vectors (e.g. pTRA) are well suited for both tasks. Rabies reagents produced in plant expression systems Several rabies antibodies and antigens have been expressed in plants using both stable transgenic approaches as well as transient gene expression via agro-infiltration. While the production of rabies antibodies has generally been very successful (Table 41.2), rabies antigens so far have been more challenging (Table 41.3). Specifically, high-level expression of the full-length ectodomain of the enve- lope glycoprotein has not been achieved. However, several small fragments such as the RVG peptide that binds to nAChR have been produced successfully. Expression vectors for Agrobacterium-mediated transformation For plant molecular pharming applications, the systems mostly used nowa- days are based on (i) a binary vector derived from A. tumefaciens (Rhizobium radio- bacter, A. radiobacter) and (ii) various genetic elements from plant viruses. Genetic elements from plant viruses are widely used because many plant viruses accu- mulate to very high levels in plant cells. To achieve this, plant viruses evolved different mechanisms, including highly efficient 5’ and 3’ untranslated regions (UTR) as translational enhancers, inhibitors of post-transcriptional gene silencing and amplification of genomic and subgenomic RNAs. Learning from nature, these genetic elements have successfully been harnessed in various ways to create the powerful plant expression strategies that are now available. Feature GM plant Agro-infiltration Level of integration High Mid Setup time 6 months to generation of first transformants 4–6 weeks from seed to plant ready for infiltration Scalability Agricultural Good to several kg biomass, then requires sophisti- cated facility Flexibility Limited High, particularly useful for product development Skills required Plant tissue culture Basic microbiology Protein accumulation Generally lower Generally higher Stress level Lower Higher, both biotic and abiotic stress factors Containment As for all GM plants. Deregulation may be approved. Plants can be grown anywhere; agrobacteria and infiltrated plants require containment; Robustness Very robust More input parameters, more variable Table 41.1. Comparison of key features of stable transgenic (GM plant) and transient gene expression (agro-infiltration) Laboratory techniques in rabies Fifth edition 163 Plant production of monoclonal antibodies Part 6. Production of biologicals A. tumefaciens is a natural genetic engineer with a type IV secretion system specialised to deliver genetic information to plant cells to cause crown gall disease (27). A particularly important feature of this system is that it has evolved to transfer single-strand DNA efficiently across the plant cell wall and the plasma membrane to shuttle it into the plant nucleus (28, 29). Fortunately, the only cis elements required are the left and right border 25 base pair (bp) repeat sequences, and all other necessary virulence genes can be provided in trans. This led to the develop- ment of T-DNA binary systems, where the natural tumour inducing Ti plasmid was disarmed by eliminating the transfer DNA region carrying the plant oncogenes and an artificial T-DNA was introduced into a shuttle vector that can replicate in both E. coli and A. tumefaciens. Such a pair of plasmids is called a T-DNA binary system. The disarmed Ti-plasmid is also referred to as helper plasmid and the shuttle vector as T-DNA plasmid. There are many different variants of the latter, inclu- Antibody Expression strategy / Host plant Reference ID Type SO57 Human IgG1 Transgenic N. tabacum cv. Xanthi Ko et al., 2003 (10) Suspension cells of transgenic N. tabacum cv. Xanthi Girard et al., 2006 (9) 62-71-3 Mouse–human chimeric IgG1 Transient N. benthamiana Both et al., 2013 (3) scFv-RVG fusion Transient N. benthamiana Phoolcharoen et al., 2017 (22) E559 Mouse–human chimeric IgG1 Transgenic N. tabacum cv. Petit Havana SR1 van Dolleweerd et al., 2014 (12) 8C5 Human IgG1 Transient N. benthamiana Unpublished 10H5 4H3 7A2 Table 41.2. Rabies virus antibodies produced in plants Protein Type Host Plant / Expression strategy Reference N Full-length Transgenic tomato, transient N.  benthamiana Perea Arango et al., 2008 (23) G, N G-N chimeric peptide fused to AIMV coat protein Tobacco and spinach / recombinant plant virus Yusibov et al., 2002 (24) G Full length Transgenic tomato Mc Garvey et al., 1995 (25) Full length chimeric Transgenic N. tabacum Ashraf, 2005 (26) Full-length G fused to B sub-unit of cholera toxin Transgenic N. tabacum Roy, 2010 Full-length Transgenic N. tabacum Yadav, 2012 Full length G fused to B sub-unit of ricin toxin Hairy root cell culture derived from transgenic tomato Singh, 2015 VLP, co-expression with M Transient N. benthamiana D’Aoust, Medicago, patent application Table 41.3. Rabies virus proteins produced in plants Laboratory techniques in rabies Fifth edition 164 Plant production of monoclonal antibodies Part 6. Production of biologicals ding pTRA (30), pEAQ (20), magnICON (31), pRIC, pORE, pGREEN, pCAMBIA and pBIN. Importantly, not every helper plasmid can be combined with every T-DNA plasmid and it is vital to ensure compatibility for the origin-of-replication and anti- biotic resistance genes. In the pTRA vector, gene expression is controlled by a duplicated CaMV-35S promoter, the 5’UTR from tobacco etch virus, a CaMV-35S 3’UTR and transcrip- tional terminator and scaffold attachment regions of the tobacco RB7 gene. An essential element is the inclusion of a leader sequence to target transgene expres- sion products to the plant secretory pathway. Leader sequences can be derived from either mammalian or plant sequences (34). Genes of interest are inserted using convenient restriction sites. For therapeutic antibodies, the accuracy of signal peptide cleavage is critical, whereas for research and diagnostic purposes, heterogeneity at the N-terminal end is not an issue. Details for the pTRA vectors currently used for producing human antibodies at high levels (32) are shown in Table 41.4 and Fig. 41.2. Group Element Description Backbone ColE1 ori High copy origin of replication for Escherichia coli RK2 ori Low copy origin of replication for Agrobacterium tumefaciens bla β-lactamase, resistance to ampicillin/carbenicillin T-DNA LB Left border, start of transfer-DNA (clockwise) RB Right border, end of transfer-DNA DsRed scorable marker gene expression cassette Pnos Nopaline synthase promotor CHS 5’UTR of the chalcone synthase gene from parsley DsRed-H6KDEL Red-fluorescent protein from Discosoma spp. with a His6 tag for IMAC purification and a KDEL tag for ER-retrieval pAnos 3’UTR and termination of transcription from the nopaline synthase gene Recombinant Antibody gene expression cassette 2x P35S Duplicated promotor from the 35S RNA of Cauliflower Mosaic Virus TL 5’UTR from tobacco etch virus SP Signal peptide HC Mature antibody heavy chain pA35S 3’UTR and termination of transcription from the 35S RNA of Cauliflower Mosaic Virus SAR SAR Scaffold attachment regions from the rb7 Table 41.4. Genetic elements used in pTRA plasmids Laboratory techniques in rabies Fifth edition 165 Plant production of monoclonal antibodies Part 6. Production of biologicals Fig. 41.2. Plasmid map for pTRA-Ds-g1 used for expression of human IgG1 antibodies The same plasmid is also used to express the human light chain by replacing the PstI–XbaI fragment. The elements comprising the expression cassette for the antibody are depicted in grades of green colours. The cassette for the DsRed marker gene is shown in grades of red. The region (clockwise) between the left border (LB) and the right border (RB) comprises the T-DNA that is transferred to the plant cell. Details of the various elements are given in Table 41.4. Setting up a plant expression system yourself The practical aspects of getting started with a plant-based transient expres- sion system for MAbs assumes that a standard molecular biology laboratory is available for conducting the basic recombinant DNA and protein analysis work. Consideration is given to a minimal setup scenario and estimate of the costs required to become operational. N. benthamiana seeds typically cost a few dollars only but shipping costs may apply and not every vendor will ship seeds to another country. It is often easiest therefore to identify a national collaborator who already has N. benthamiana seeds and can spare a few. As seed amplification has a lead-time of about 80 days, it is advisable to use the first seeds to grow plants for making more seeds. A single plant can produce seeds sufficient for a year or longer, and seeds are viable for many years if stored properly in dry, dark and temperate conditions. The next steps are to obtain the Agrobacteria with the helper plasmid and the corresponding T-DNA plasmid. The Leibniz Institute DSMZ – German Collection of Microorganisms and Cell Cultures – charges US$ 120–180 all-inclusive for freeze- dried R. radiobacter GV3101 (A. tumefaciens) carrying the helper plasmid pMP90RK. Laboratory techniques in rabies Fifth edition 166 Plant production of monoclonal antibodies Part 6. Production of biologicals Handling fees for the T-DNA plasmids can range from €50 to €500 largely depen- ding on the legal entities and collaborators often can receive the material free of charge from universities. Plants can be grown on a metal rack that can be obtained for less than US$ 100 from a do-it-yourself store and standard fluorescent lamps. This means that a growth rack with three levels can be setup for less than US$ 500. Plastic plant pots and good-quality compost can be purchased from a local garden centre. The cost for an entire basic setup would be less than US$ 800. Many other items that may be helpful are also inexpensive as many are sold as household goods. The running costs are also very favourable and include standard laboratory plasticware such as tips, gloves, Petri dishes, paper towels, plastic foil, cellophane, transparent tape, 1 mL syringes, and Eppendorf and Falcon tubes. The infiltration medium costs less than US$ 2 per litre at small scale, and is cheaper than the media used for growing E. coli and agrobacteria. The main cost drivers are the reagents and materials needed for analysis of expression, purification of the target protein and its characterization. This is highly specific to the target protein and therefore we do not consider this here any further. It is helpful – albeit optional – to co-express the MAb genes with a reporter gene that can easily be detected at low cost. We favour the red-fluorescent protein from Discosoma spp. for several reasons, including its high level of expression in diffe- rent cellular compartments and plant species, high stability and ease of non-inva- sive macroscopic and microscopic detection. Antibody purification by protein A affinity chromatography is a standard proce- dure that is used once the plant extract has been clarified and filtered. The overall setup and running costs for a minimal setup scenario that has a capacity for produ- cing > 20 antibodies at the 2–5 mg scale per year is summarized in Table 41.5. The apparatus for SDS-PAGE if not already available is the highest cost factor. Category Approximate cost (US$) Set-up Running Agro-infiltration 800 500 DsRed detection 100 – SDS-PAGE 1200 150 Protein-A matrix – 250 General consumables – 200 Total 2100 1000 Table 41.5. Summary of set-up and running costs for making more than 20 x 2 mg antibodies per year with the agro- infiltration technique Laboratory techniques in rabies Fifth edition 167 Plant production of monoclonal antibodies Part 6. Production of biologicals Methods Protocols for cloning antibody genes are extensively described in the litera- ture (33). The cloning of full length light and heavy chain genes is not difficult (12). Nowadays, if the gene sequences have been determined, we routinely purchase synthetic heavy chain variable regions (VH) and VL chain genes, link them to the heavy and light chain constant regions of choice, and clone the complete heavy and light chain genes into binary T-DNA vectors. Using synthetic genes is advan- tageous because it allows codon optimization, which may improve expression levels in some cases. Codon optimization is still somewhat of a dark art, and DNA synthesis companies are not usually transparent in their algorithm design (34). The Invitrogen GeneArt Gene Synthesis plant codon optimization service has been used with success by many plant groups. The recombinant plasmid is amplified in E. coli, isolated and used to trans- form A. tumefaciens. Commonly used laboratory strains of A. tumefaciens include LBA4404 [available from Clontech and ThermoFisher], EHA105 [available from LifeScience Market], GV3101 and GV3101:pMP90RK [(available from Leib- nitz Institute DSMZ – German Collection of Microorganisms and Cell Cultures, DSM-12364 and DSM-12365]. Recombinant agrobacteria carrying the expres- sion constructs are selected on agar plates containing appropriate antibiotics – for pTRA, this is carbenicillin. The host range of A. tumefaciens depends both on the Ti plasmid and the genetic background of the isolate. A description of the chromosomal backgrounds and Ti plasmid derivations for the strains LBA4404 and GV3101 can be found in  (35). These commonly used strains have a broad host range, meaning that many important crops such as beans, lettuce, pumpkin, carrot, rapeseed and members of the Solanaceae family, as e.g. tomato, potato and tobacco, can be used. Here we focus on two related species from the genus Nicotiana, i.e. N. tabacum and N.  benthamiana, which are the workhorses of Plant Molecular Pharming due to their ease of cultivation, rapid growth, prolific seed production, efficient transfor- mation and high accumulation of foreign proteins. Antibodies are expressed transiently in N. benthamiana by introducing the recombinant agrobacterium into leaf tissue by a process called agro-infiltration. At laboratory scale, this method is very simple and requires only basic skills and standard laboratory equipment (36). The only additional requirement to a standard molecular biology or protein biochemistry laboratory is a space to grow a few plants. As expression levels are usually high, 10 plants would likely be sufficient and, in good cases, even a single plant leaf can provide a milligram of reagent. The plants are not genetically modified, and the only laboratory safety requirements relate to the use of recombinant bacteria (E. coli and A. tumefaciens). Even when the plants have been agro-infiltrated and are expressing recombinant protein, they are not regarded as genetically modified. However, as recombinant A. tumefaciens is still present, normal containment regulations for genetically modified bacteria apply. The plants and compost are usually disposed of by the same process as for any biological waste. Laboratory techniques in rabies Fifth edition 168 Plant production of monoclonal antibodies Part 6. Production of biologicals The antibody expression steps (Fig. 41.3) are: 1. Grow N. benthamiana plants. 2. Produce a liquid culture of recombinant agrobacteria. 3. Agro-infiltrate by syringe or vacuum infiltration. 4. Allow transient expression to occur and protein to accumulate. 5. Extract and purify protein. An indicative timeline for antibody expression is shown also in Fig. 41.3. 2–4 3–101–2 Fig. 41.3. Antibody expression by the agro-infiltration method, with indicative timelines 1. Grow N. benthamiana plants N. benthamiana seeds can be obtained from commercial sources or through academic collaboration. Note that there are different ecotypes that differ in their susceptibility to plant viruses and in their performance in agro-infiltration (37), which depends on a natural loss-of-function in the RNA-dependent-RNA-polyme- rase 1 gene (38). Once obtained, seeds can be amplified easily and set aside in storage by keeping a few plants for flowering, self-pollination and seed-setting. Nicotiana seeds are grown in standard commercial compost for about 6 weeks. It is beneficial to have two growth phases. Germination and seedling growth until a size of about 1–2 cm is typically done in pots or trays at a high plant density. Strong seedlings are then replanted into individual pots or plant trays. We typically grow three times as many plantlets as we intend to use. The growth conditions for the wild type plants are flexible. Nicotiana species prefer warm climates and can be grown at temperatures of 18–30 °C. They also tolerate high humidity, but this may cause moulds to grow excessively on top of the soil. The plants are usually grown under long-day conditions, e.g. with lighting on an 18 h (day) and 6 h (night) cycle. Many laboratories use standard fluorescent tubes attached to a timer switch. By 6 weeks, the plants are generally 10–15 cm high, and each plant will occupy a circular space of approximately 10–15 cm diameter. Laboratory techniques in rabies Fifth edition 169 Plant production of monoclonal antibodies Part 6. Production of biologicals It should be emphasized that growing Nicotiana plants is entirely straight- forward, and within the grasp of anyone who has ever grown any kind of plant before. Although we recommend conditions for growth, in general it is difficult to get this stage wrong. For those without horticultural experience, the only require- ment is to remember to water the plants! 2. Produce a liquid culture of recombinant agrobacteria A. tumefaciens transformed with pTRA harbouring antibody genes is grown overnight on an orbital shaker (220 r/min) in complex media such as Luria-Bertani (LB) broth, YEB or PAM (39), 100 mg/mL rifampicin and 50 mg/mL kanamycin and 50 mg/mL carbenicillin at 26–28 °C. It is important to ensure that the temperature does not exceed 30 oC because the plasmids can be lost when the cells grow too quickly. Agrobacteria grows more slowly than E. coli. If starting from a single agrobacte- rium colony from an agar plate, this should be streaked onto an LB (Luria–Bertani broth) or YM (yeast minimal) agar plate and incubated at 28 °C for 2 days. Then 3 to 5 loopfuls of the culture are inoculated in liquid media to grow at 28 °C overnight. It is advisable to prepare a cell bank, i.e. aliquoted glycerol stocks of 50–500 µL stored at −80 °C. After centrifugation, the bacterial pellet is resuspended in infiltration solution containing 0.1 mmol acetosyringone (for low yield constructs), 10 mmol MES and 10 mmol MgCl2. The final OD600 of the bacterial suspensions should be adjusted to 0.5–1.0 for syringe infiltration, or 0.1–0.25 for vacuum infiltration (see below). Before scaling up, it can be worthwhile to run a titration experiment to determine the optimal OD600 for a particular gene of interest. Full length IgG antibodies derive from two gene products. While both trans- genes can be introduced on the same vector, this is not necessary. Individual heavy chain and light chain vectors can be prepared and simply mixed in a 1:1 ratio prior to Agro-infiltration, resulting in similar or sometimes even higher yields (32). The transfection process is highly efficient, so both genes will be co-transferred into a large proportion of the transfected plant cells. The same applies to the use of inhibitors of post-transcriptional gene silencing. A vector encoding, for example, the p19 silencing suppressor can also be co-infil- trated; however, this is typically done at lower levels, i.e. at a 1:5–1:10 ratio. 3. Agro-infiltrate by syringe or vacuum infiltration This is the process by which the agrobacterial suspension is introduced into the intracellular spaces of the plant leaves. The anatomy of a plant leaf is indi- cated in cross section in Fig. 41.4, illustrating the intercellular spaces that are present primarily within the spongy mesophyll cell layer. Agrobacteria are intro- duced through the stomata, which are normal structures in the lower surfaces Laboratory techniques in rabies Fifth edition 170 Plant production of monoclonal antibodies Part 6. Production of biologicals of leaves that allow gaseous exchange and transpiration. It is helpful to ensure that the plants are well watered before agroinfiltration. When the stomata are closed, it is almost impossible to infiltrate the leaves. In this case it can help to punch little holes into the leaf or make small scratches into the lower epidermis to facilitate entry of the bacterial suspension. These injuries should, however, be as small as possible as the affected tissue will ultimately die. The aim is to fill the air spaces with agrobacterium solution, and this is most simply done using a needle-less syringe on individual plant leaves. Alternatively, a whole plant can be agro-infiltrated at once using a simple vacuum device. There are numerous videos demonstrating these techniques online (search for “agroinfiltration”) or see (40). Using a 1  mL syringe pressed gently against the underside of the leaf (the abaxial surface), the bacterial suspension can be introduced directly into the leaf intercellular space. It is helpful to press a finger against the syringe nozzle from the other side of the leaf. The infiltrated area is evident by the growing “wet” patch that develops. Within a single leaf, the major veins often restrict the spread of the infiltration patch, so the procedure is repeated in different areas until most of the leaf is infiltrated. Expression of the gene of interest will be restricted to the area of infiltration, so it is possible to express multiple constructs on the same leaf. To infiltrate entire plants, a larger volume of recombinant agrobacteria is required, typically 1–2 L. The plant is immersed (upside down) in the bacterial suspension, within a dessicator vessel or pressure cooker attached to a vacuum pump. Precautions must be taken to prevent the compost from falling out of the plant pot, e.g. by wrapping the pot in plastic film. A vacuum is applied for 1–2 min at 100 mbar to draw out the air in the intracellular leaf spaces. On release of the vacuum, the agrobacterium solution is sucked back into the leaf. The plants are taken out of the suspension and excess liquid is allowed to drip off or be carefully removed with paper towels. Wax cuticule B y co ur te sy o f J ul ia n K .C . M a, S t G eo rg e’ s H os pi ta l M ed ic al S ch oo l, Lo nd on , U K . Fig. 41.4. Schematic representation of a leaf cross-section showing the general organization of the different cell types and the intercellular space targeted by agroinfiltration Laboratory techniques in rabies Fifth edition 171 Plant production of monoclonal antibodies Part 6. Production of biologicals 4. Allow transient expression to occur and protein to accumulate Following infiltration, the air space needs to be restored within the plant leaves to facilitate gas exchange (41). This also concentrates the Agrobacteria to the cell walls where they can initiate the gene transfer process. Usually no active interven- tion is necessary, but if problems arise, such as plant tissue death or rotting, it is usually helpful to incubate the plants for a couple of hours under low humidity or expose them to an airstream after agro-infiltration. The plants are then grown for 4–10 days at 22 °C. It has been shown that the transformation efficiency is temperature-dependent and drops sharply < 19 °C and > 23 °C (42). As before, lighting is typically maintained on a 16:8 h day:night cycle. Even though the infiltration medium contains a large amount of sugar and the leaf tissue does not depend on photosynthesis, incubation in the dark gene- rally results in poor expression because the leaves cannot get rid of the excess liquid as easily. Maximal recombinant antibody expression is usually seen at around 5 days, but this varies from target protein to target protein, so it is advisable to assay different plants daily starting from day 3. Detection of recombinant antibody can be performed either by ELISA or western blot or dot blot. A small sample of leaf (for example taken using a hole punch) is sufficient. The leaf tissue is homoge- nized in three volumes (volume/weight) of sodium phosphate (pH 7) buffer in a microcentrifuge tube, using a plastic or electric-pestle. After centrifugation, the supernatant can be applied to an ELISA plate pre-coated with a capture anti- serum (and further detected using a second appropriate enzyme labelled anti- serum), or 10 mL can be applied to SDS-PAGE and western blot using appropriate detection antisera. For ease of detection, we often co-express a fluorescent marker protein, such as DsRed, which provides a simple, non-invasive and cost–effective way to quickly assess the experiment. 5. Extract and purify protein Protein extraction involves homogenization of transfected leaf tissue in an extraction buffer. A simple buffer (e.g. sodium phosphate pH7) is commonly used (14), and the addition of antioxidants and/or protease inhibitors is at the discretion of the individual (43). Usually, provided the extraction is performed quickly and on ice, these are not required. Typically, 2–3 volumes of buffer are used to prepare the plant extract (volume/weight), using a micro pestle (manually), pestle and mortar or a standard kitchen blender. The resulting smooth homogenate is optionally passed through Miracloth before centrifugation at 18 000 r/min for supernatant clarification. The duration of centrifugation depends on the volume. At small scale (< 2 mL), 2 mins is sufficient, whereas at larger scale > 100 mL, up to 30 min may be necessary. The pH of the supernatant often needs to be re-adjusted, as the extract itself is slightly acidic and the buffer capacity may be insufficient, typically followed by another centrifugation step to remove further precipitates. The clari- fied extract can then either be applied directly to e.g. a self-packed disposable Laboratory techniques in rabies Fifth edition 172 Plant production of monoclonal antibodies Part 6. Production of biologicals column or the supernatant is then passed through a 0.45 µm filter followed by a 0.22  µm filter before being purified by affinity chromatography. Protein-G or Protein-A-sepharose is commonly used. Once the plant extract is loaded, the column is washed with three volumes of sodium phosphate buffer (pH 7.4), then the antibody is eluted with 100 mmol glycine (pH 2.5), followed by pH neutraliza- tion with 0.1 vol. 1 mol Tris base or 1 mol sodium acetate. Scale-up options The method described is adequate for most laboratory-based requirements for monoclonal antibodies and readily delivers high milligram quantities. Importantly, it is quick, economic and technically simple. Also important are the options for scaling up production, particularly for the development of potential products. This will, of course, require more specialist facilities, but it is useful to know that such facilities exist. For scaling up tran- sient expression, there are commercial facilities established around the world, for example in the UK (Leaf Expression Systems Limited), USA (e.g. Kentucky Bioprocessing, Inc. and Medicago) and Germany (Fraunhofer IME and Nomad Bioscience). One of the advantages of the pTRA vector system is that the recombinant agrobacteria can be used both for transient expression as well as for transforma- tion of tobacco tissue to produce stable transgenic plants. Although the process of generating and screening transgenic plants is relatively lengthy, this is the most appropriate solution for massive scale production of antibodies (as would be needed for MAbs used in rabies PEP for example). The path to the clinic for MAbs produced in transgenic plants has been made much clearer by the issuing of a Good Manufacturing Practice (GMP) licence to the Fraunhofer IME Institute (Aachen, Germany) for this process (44), and the approval of a first-in-human Phase I clinical trial for a plant derived antibody (14). While a GMP licence has yet to be issued for transient expression of MAbs in N. benthamiana, plant antibodies produced by agro-infiltration have entered clinical trials under FDA oversight. These include the patient-specific antibodies produced by non-Hodgkin’s lymphoma as an idiotype vaccine (45, 46), and ZMapp, a cocktail of three MAbs against Ebola Virus (47). With several more antibodies in the pipe- lines of academia and start-up companies and with the first big pharmaceutical company entering the scene, it is foreseeable that research manufacturing capa- city, regulatory guidelines and large-scale industrial plants will continue to grow. Production costs For those with a longer term interest in manufacturing antibodies in plants, cost aspects are considered in more detail below, starting with some general top-down considerations and then providing a bottom-up view of actual cost to establish plant antibody manufacturing. Several authors have analysed the costs of production for recombinant proteins from plants. Across all the reported studies and in agreement with the experiences Laboratory techniques in rabies Fifth edition 173 Plant production of monoclonal antibodies Part 6. Production of biologicals of many researchers in the fields, some generally accepted statements, if not dogmas, have arisen. The first and most important is that recombinant protein yield has the biggest impact on cost. In particular, low yields present additional problems such as degradation, low solubility and high losses during downstream processing. The second dogma is that upstream processing, i.e. growing the plant biomass, is generally inexpensive, immediately followed by the third dogma, which states that downstream processing represents the major bottleneck and up to 90% of the overall costs. Some 20 years ago, Kusnadi and colleagues reported the cost of producing a recombinant protein in plants, of US$ 5–60 per kilogram, assuming accumulation of 10% (w/w) of the total crop protein (48). As an example, soybean has a total protein content of 38% and the price per metric tonne was US$ 350 in May 2017, i.e. the cost of total soybean protein currently is about US$ 1/kg. Thus, at an accu- mulation rate of 10%, the recombinant protein would cost ~ US$ 10/kg. If only we could grow transgenic plants expressing valuable and lifesaving antibodies in open fields! An early techno-economic analysis was reported for MAb production in 2012, based on a production scale of 100 kg purified MAb annually in stable transgenic tobacco-based systems, assuming an expression level of 1 g/kg FW. Here, the cost of goods sold for production in greenhouses or in bioreactors was US$ 98/g and US$ 138/g respectively (49). In 2014, a similar analysis was performed for the agro-infiltration system including the investment and operating costs for the manufacturing facility (50). The  authors concluded that a 400 mg dose of a therapeutic enzyme would cost US$ 474, equivalent to US$ 1185 per gram. Adapting these numbers to the expression levels and purification yield of human MAbs suggests production costs of US$ 237 per gram. Most recently, a detailed techno-economic analysis for MAb production in a transient plant-based platform was published (51). The model analysis included evaluation of total capital investment, annual operating cost and cost of goods, and was based on published designs for a commercial-scale facility. At a production scale of 300 kg/year, the model predicted a total capital investment of US$ 122 M and cost of goods of 121 US$ per gram. Compared with the most recent data from the CHO manufacturing industry, this represents a significant reduction in capital investment and a > 50% reduction in the cost of goods (52, 53). The costs of a biological drug are also largely dependent on the required dose, i.e. the potency of the pharmaceutical protein. This is particularly true for virus-neu- tralizing antibodies and has been demonstrated impressively and documented for highly potent and broadly neutralizing HIV antibodies (54, 55). Compared with the early HIV-neutralizing MAbs, the required dose for the latest bnAbs (broadly neutralizing antibodies) is not only 100–1000 times lower, but their increased breadth of neutralization greatly facilitates the development of a cocktail antibody product. The situation is similar for rabies MAbs, where some of the more recently discovered human monoclonal antibodies have higher potencies than the murine MAbs that were the first available antibodies. A RIG product comprising a cocktail of at least three MAbs requires excellent and matching yields and potencies. The rapid and scalable transient gene expres- Laboratory techniques in rabies Fifth edition 174 Plant production of monoclonal antibodies Part 6. Production of biologicals sion by agro-infiltration of N. benthamiana provides unique opportunities for iden- tifying and developing such a challenging product. Again, the low entry barriers and costs are key enabling features. This chapter has described how recombinant proteins including antibodies can be expressed in tobacco plants and has summarized the state of the art in rela- tion to RABV-related reagents. Its main aim is to convey the message that plant expression of MAbs is technically and practically simplistic and within the grasp of any biologist. This can become a powerful tool for research laboratories to manufacture useful amounts of important reagents and candidate drugs for early in vivo studies. Laboratory techniques in rabies Fifth edition 175 Plant production of monoclonal antibodies Part 6. Production of biologicals References 1. Both L, Banyard AC, van Dolleweerd C, Horton DL, Ma JK, Fooks AR. Passive immunity in the prevention of rabies. The Lancet infectious diseases. 2012;12:397–407. 2. Bakker AB, Python C, Kissling CJ, Pandya P, Marissen WE, Brink MF, et al. First administration to humans of a monoclonal antibody cocktail against rabies virus: safety, tolerability, and neutralizing activity. Vaccine. 2008;26:5922–7. 3. Both L, van Dolleweerd C, Wright E, Banyard AC, Bulmer-Thomas B, Selden D, et al. Production, characterization, and antigen specificity of recombinant 62-71-3, a candidate monoclonal antibody for rabies prophylaxis in humans. FASEB J. 2013;27:2055–65. 4. Sloan SE, Hanlon C, Weldon W, Niezgoda M, Blanton J, Self J, et al. Identi- fication and characterization of a human monoclonal antibody that potently neutralizes a broad panel of rabies virus isolates. Vaccine. 2007;25:2800–10. 5. Kelley B. Industrialization of mAb production technology: the bioprocessing industry at a crossroads. MAbs. 2009;1:443–52. 6. Muller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Development of a mouse monoclonal antibody cocktail for post-exposure rabies prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. 7. Ma JK, Christou P, Chikwamba R, Haydon H, Paul M, Ferrer MP, et al. Reali- sing the value of plant molecular pharming to benefit the poor in developing countries and emerging economies. Plant Biotechnol J. 2013;11:1029–33. 8. Rybicki EP, Chikwamba R, Koch M, Rhodes JI, Groenewald JH. Plant- made therapeutics: an emerging platform in South Africa. Biotechnol Adv. 2012;30:449–59. 9. Girard LS, Fabis MJ, Bastin M, Courtois D, Petiard V, Koprowski H. Expres- sion of a human anti-rabies virus monoclonal antibody in tobacco cell culture. Biochem Biophys Res Commun. 2006;345:602–7. 10. Ko K, Tekoah Y, Rudd PM, Harvey DJ, Dwek RA, Spitsin S, et al. Function and glycosylation of plant-derived antiviral monoclonal antibody. Proc Natl Acad Sci U S A. 2003;100:8013–8. 11. Lee JH, Park DY, Lee KJ, Kim YK, So YK, Ryu JS, et al. Intracellular repro- gramming of expression, glycosylation, and function of a plant-derived anti- viral therapeutic monoclonal antibody. PLoS One. 2013;8:e68772. 12. van Dolleweerd CJ, Teh AY, Banyard AC, Both L, Lotter-Stark HC, Tsekoa T, et al. Engineering, expression in transgenic plants and characterisation of E559, a rabies virus-neutralising monoclonal antibody. J Infect Dis. 2014;210:200–8. 13. Hiatt AC, Cafferkey R, Bowdish K. Production of antibodies in transgenic plants. Nature. 1989;342:76–8. 14. Ma JK, Drossard J, Lewis D, Altmann F, Boyle J, Christou P, et al. Regula- tory approval and a first-in-human phase I clinical trial of a monoclonal anti- Laboratory techniques in rabies Fifth edition 176 Plant production of monoclonal antibodies Part 6. Production of biologicals body produced in transgenic tobacco plants. Plant Biotechnol J. 2015. PMID: 26147010. 15. De Jaeger G, Buys E, Eeckhout D, De Wilde C, Jacobs A, Kapila J, et al. High level accumulation of single-chain variable fragments in the cytosol of trans- genic Petunia hybrida. Eur J Biochem. 1999;259:426–34. 16. Vaquero C, Sack M, Chandler J, Drossard J, Schuster F, Monecke M, et al. Transient expression of a tumor-specific single-chain fragment and a chimeric antibody in tobacco leaves. Proc Natl Acad Sci U S A. 1999;96:11128–33. 17. Voinnet O, Rivas S, Mestre P, Baulcombe D. An enhanced transient expres- sion system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 2003;33:949–56. 18. Gelvin SB. Agobacterium-mediated plant transformation: the biology behind the “gene-Jockeying” tool. Microbiol Mol Biol Rev. 2003;67:16–37. 19. Gleba Y, Klimyuk V, Marillonnet S. Viral vectors for the expression of proteins in plants. Curr Opin Biotechnol. 2007;18:134–41. 20. Sainsbury F, Thuenemann EC, Lomonossoff GP. pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J. 2009;7:682–93. 21. Hiatt A, Pauly M, Whaley K, Qiu X, Kobinger G, Zeitlin L. The emergence of antibody therapies for Ebola. Hum Antibodies. 2015;23:49–56. 22. Phoolcharoen W, Prehaud C, van Dolleweerd CJ, Both L, da Costa A, Lafon M, et al. Enhanced transport of plant-produced rabies single-chain antibo- dy-RVG peptide fusion protein across an in cellulo blood-brain barrier device. Plant Biotechnol J. 2017 (https://core.ac.uk/download/pdf/82918929.pdf, accessed 1 October 2018). 23. Perea Arango I, Loza Rubio E, Rojas Anaya E, Olivera Flores T, Gonzalez de la Vara L, Gomez Lim MA. Expression of the rabies virus nucleoprotein in plants at high-levels and evaluation of immune responses in mice. Plant Cell Rep. 2008;27:677–85. 24. Yusibov V, Hooper DC, Spitsin S, Fleysh N, Kean RB, Mikheeva T, et al. Expression in plants and immunogenicity of plant virus-based experimental rabies vaccine. Vaccine. 2002;20:3155–64. 25. McGarvey PB, Hammond J, Dienelt MM, Hooper DC, Fu ZF, Dietzschold B, et al. Expression of the rabies virus glycoprotein in transgenic tomatoes. Bio-technology. 1995;13:1484–7. 26. Ashraf S, Singh PK, Yadav DK, Shahnawaz M, Mishra S, Sawant SV, et al. High level expression of surface glycoprotein of rabies virus in tobacco leaves and its immunoprotective activity in mice. J Biotechnol. 2005;119:1–14. 27. Nester EW, Gordon MP, Amasino RM, Yanofsky MF. Crown gall – a molecular and physiological analysis. Annu Rev Plant Phys. 1984;35:387–413. 28. Lacroix B, Citovsky V. The roles of bacterial and host plant factors in Agro- bacterium-mediated genetic transformation. Int J Dev Biol. 2013;57:467–81. Laboratory techniques in rabies Fifth edition 177 Plant production of monoclonal antibodies Part 6. Production of biologicals 29. Bourras S, Rouxel T, Meyer M. Agrobacterium tumefaciens gene transfer: how a plant pathogen hacks the nuclei of plant and nonplant organisms. Phytopa- thology. 2015;105:1288–301. 30. Sack M, Paetz A, Kunert R, Bomble M, Hesse F, Stiegler G, et al. Functional analysis of the broadly neutralizing human anti-HIV-1 antibody 2F5 produced in transgenic BY-2 suspension cultures. FASEB J. 2007;21:1655–64. 31. Gleba Y, Klimyuk V, Marillonnet S. Magnifection--a new platform for expres- sing recombinant vaccines in plants. Vaccine. 2005;23:2042–8. 32. Zischewski J, Sack M, Fischer R. Overcoming low yields of plant-made anti- bodies by a protein engineering approach. Biotechnol J. 2016;11:107–16. 33. Bialon M, Schellenberg L, Herzog N, Kraus S, Jorissen H, Fischer R, et al. Cloning murine antibody V-genes with non-degenerate primers and conver- sion to a recombinant antibody format. Monoclon Antib Immunodiagn Immu- nother. 2014;33:369–77. 34. Webster GR, Teh AY, Ma JK. Synthetic gene design – the rationale for codon optimization and implications for molecular pharming in plants. Biotechnol Bioeng. 2017;114:492–502. 35. Lee LY, Gelvin SB. T-DNA binary vectors and systems. Plant Physiol. 2008;146:325–32. 36. Kapila J, DeReycke R, Van Montagu M, Angenon G. An Agrobacte- rium-mediated transient gene expression system for intact leaves. Plant Science.122:101–8. 37. Bally J, Nakasugi K, Jia F, Jung H, Ho SY, Wong M, et al. The extremophile Nicotiana benthamiana has traded viral defence for early vigour. Nat Plants. 2015;1:15165. 38. Yang SJ, Carter SA, Cole AB, Cheng NH, Nelson RS. A natural variant of a host RNA-dependent RNA polymerase is associated with increased susceptibility to viruses by Nicotiana benthamiana. Proc Natl Acad Sci U S A. 2004;101:6297–302. 39. Houdelet M, Galinski A, Holland T, Wenzel K, Schillberg S, Buyel JF. Animal component-free Agrobacterium tumefaciens cultivation media for better GMP-compliance increases biomass yield and pharmaceutical protein expression in Nicotiana benthamiana. Biotechnol J. 2017;12:1600721 (https:// onlinelibrary.wiley.com/doi/epdf/10.1002/biot.201600721, accessed 1 October 2018). 40. Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, et al. Efficient agroinfiltration of plants for high-level transient expression of recombinant proteins. J Vis Exp. 2013;77:e50521. 41. Fujiuchi N, Matsuda R, Matoba N, Fujiwara K. Removal of bacterial suspen- sion water occupying the intercellular space of detached leaves after agroinfil- tration improves the yield of recombinant hemagglutinin in a Nicotiana bentha- miana transient gene expression system. Biotechnol Bioeng. 2016;113:901–6. Laboratory techniques in rabies Fifth edition 178 Plant production of monoclonal antibodies Part 6. Production of biologicals 42. Jin S, Song YN, Deng WY, Gordon MP, Nester EW. The regulatory VirA protein of Agrobacterium tumefaciens does not function at elevated temperatures. J Bacteriol. 1993;175:6830–5. 43. Hehle VK, Paul MJ, Drake PM, Ma JK, van Dolleweerd CJ. Antibody degrada- tion in tobacco plants: a predominantly apoplastic process. BMC Biotechnol. 2011;11:128. 44. Sack M, Rademacher T, Spiegel H, Boes A, Hellwig S, Drossard J, et al. From gene to harvest: insights into upstream process development for the GMP production of a monoclonal antibody in transgenic tobacco plants. Plant Biotechnol J. 2015;13:1094–105. 45. Tuse D, Ku N, Bendandi M, Becerra C, Collins R Jr, Langford N, et al. Clinical safety and immunogenicity of tumor-targeted, plant-made Id-KLH conjugate vaccines for follicular lymphoma. Biomed Res Int. 2015;2015:648143. 46. McCormick AA, Reddy S, Reinl SJ, Cameron TI, Czerwinkski DK, Vojdani F, et al. Plant-produced idiotype vaccines for the treatment of non-Hodgkin’s lymphoma: safety and immunogenicity in a phase I clinical study. Proc Natl Acad Sci U S A. 2008;105:10131–6. 47. Group PIW, Multi-National PIIST, Davey RT, Jr., Dodd L, Proschan MA, Neaton J, et al. A randomized, controlled trial of ZMapp for Ebola virus infection. N Engl J Med. 2016;375:1448–56. 48. Kusnadi AR, Nikolov ZL, Howard JA. Production of recombinant proteins in transgenic plants: Practical considerations. Biotechnol Bioeng. 1997;56:473– 84. 49. Wilken LR, Nikolov ZL. Recovery and purification of plant-made recombinant proteins. Biotechnol Adv. 2012;30:419–33. 50. Tuse D, Tu T, McDonald KA. Manufacturing economics of plant-made biolo- gics: case studies in therapeutic and industrial enzymes. Biomed Res Int. 2014;2014:256135. 51. Nandi S, Kwong AT, Holtz BR, Erwin RL, Marcel S, McDonald KA. Techno-eco- nomic analysis of a transient plant-based platform for monoclonal antibody production. MAbs. 2016;8:1456–66. 52. Petrides D, Carmichael D, Siletti C, Koulouris A. Biopharmaceutical process optimization with simulation and scheduling tools. Bioengineering (Basel). 2014;1:154–87. 53. Werner RG. Economic aspects of commercial manufacture of biopharmaceu- ticals. Journal of biotechnology. 2004;113:171–82. 54. Eroshkin AM, LeBlanc A, Weekes D, Post K, Li Z, Rajput A, et al. bNAber: database of broadly neutralizing HIV antibodies. Nucleic Acids Res. 2014;42(Database issue):D1133-9. 55. Stephenson KE, Barouch DH. Broadly neutralizing antibodies for HIV eradica- tion. Curr HIV/AIDS Rep. 2016;13:31–7. Laboratory techniques in rabies Fifth edition 179 Part 7. Potency determinations Part 7. Potency determinations Laboratory techniques in rabies Fifth edition 180 NIH test for potency testing of vaccines Part 7. Potency determinations Chapter 42 The NIH test for potency testing of vaccines Introduction The NIH test for potency was originally developed at the National Institutes of Health (Bethesda, MD, USA). The test measures the degree of protection conferred by inactivated rabies vaccines in immunized mice challenged with rabies virus (RABV). It is undertaken by vaccinating two groups of mice twice, 7 days apart, with dilutions of a reference vaccine and the vaccine being tested. Seven days after the last vaccination, the immunized mice and a control group of mice are challenged with the challenge virus standard (CVS) mouse-brain strain of fixed RABV. The mice are observed daily and the median effective dose (ED50) of the reference and test vaccines is determined based on the number of survivors. The relative potency of the test vaccine is then calculated by comparing the ED50 of the test vaccine with that of the reference vaccine. Methods Reagents • CVS stored frozen (at −80 °C or in liquid nitrogen) as a 20% mouse-brain suspension in a diluent containing a low percentage (2–5%) of heat-inactivated fetal calf serum (FCS), and distributed in aliquots of about 800 µL. • Reference vaccine Several reference vaccines are commercially available. For example, the Biolo- gical Reference Preparation (BRP) batch N°5, currently distributed by the Euro- pean Directorate for the Quality of Medicines (EDQM), is a freeze-dried vaccine derived from the Pitman Moore strain of RABV produced in Nil-2 cell line and inactivated with ß-propiolactone. This reference vaccine has an assigned titre of 10 International Units (IU) per vial (1). The sixth International Standard for Rabies Vaccine (07/162) is distributed by the National Institute for Biological Standards and Control (NIBSC, UK). This material was prepared from a bulk of Vero cell derived, Pitman Moore strain, produced by the same manufacturing process as that for the fifth International Standard for Rabies Vaccine. It has an assigned titre of 8 IU/vial (2). • Laboratories can prepare an internal reference vaccine provided it is calibrated against an International Standard (see above). • 3- and 5-week-old Swiss or NMRI (Naval Medical Research Institute) female mice, or equivalent • heat-inactivated FCS • phosphate buffered saline (PBS), pH 7.4 Laboratory techniques in rabies Fifth edition 181 NIH test for potency testing of vaccines Part 7. Potency determinations • injectable anaesthetics (tiletamine in combination with zolazepam as an example) or anesthetics for inhalation (isoflurane). Protocol Preparation of the working CVS 1. Thaw rapidly the content of an ampoule of frozen virus under cold running water and dilute in PBS supplemented with 2% heat-inactivated fetal calf serum (FCS) so as to obtain a suspension containing approximately 103 LD50/ mL. The dilution factor will be calculated according to the titre of the stock solution. 2. Anaesthetize 3-week-old female Swiss/NMRI mice (the number of mice will be adapted according to the amount of required CVS vials). 3. Inoculate the mice intracerebrally (Fig. 42.1) with 0.03 mL of the suspension containing 103 LD50/mL. 4. Observe the mice at least once daily to detect rabies clinical signs. Animal’s deaths occurring during the 4 days after the intracerebral inoculation are consi- dered nonspecific and cannot be attributed specifically to rabies. 5. Once paralyzed, euthanize the mice by acceptable standards (e.g. by cervical dislocation or CO2 asphyxia). 6. Collect the brains, freeze them immediately and store at −80 °C. 7. Once the collection is complete, thaw, weigh and reduce the harvested brains to pulp using a sterile pestle and mortar, a tissue grinder, a mixer or another appropriate device. This procedure should be carried out in a biosafety cabinet to prevent the release of the virus in an aerosol. Add a sufficient volume of PBS supplemented with 2% heat-inactivated FCS (plus antibiotics) to obtain a 20% suspension by weight. 8. Assign a batch number to the suspension, centrifuge at 3000 x g / +4 °C for 30 min and immediately distribute the supernatant into sterile ampoules. Store at −80 °C or in liquid nitrogen. Note: Each step in preparing the working CVS must be carried out promptly, and in an ice-water batch or equivalent, to ensure the survival of the maximum possible amount of virus. Fig. 42.1. Intracerebral injection into an anesthetized mouse B y co ur te sy o f A le xa nd re S er va t, A N S ES , M al zé vi lle , F ra nc e Laboratory techniques in rabies Fifth edition 182 NIH test for potency testing of vaccines Part 7. Potency determinations Determination of the LD50 of the working CVS Before use as a challenge virus, the median lethal dose (LD50) of each lot of the working CVS should be determined in 5-week-old mice as follows: Remove one ampoule of the pooled working CVS from storage at −80 °C and thaw rapidly under cold running water. Prepare serial 10-fold dilutions of the suspension in CVS diluent. Anaesthetize groups of 10 mice and inoculate them intracerebrally (Fig. 42.1) with each dilution of the working CVS, each mouse receiving 0.03 mL. Observe the mice for 14 days and record the number that die from rabies after the first 5 days and animals that are euthanized after evidence of stage 3 clinical signs (see Annex). Include any mice showing signs of rabies (e.g. paralysis, convulsions) on the 14th day. Calculate the LD50 of the working CVS using the Spearman–Kärber method or using an appropriate statistics software. A lot is generally considered satisfactory if the LD50 is between 10 −6 and 10−8 dilutions inclusive. The maximum variation from test to test in the titre obtained should not exceed one 10-fold dilution when the same lot of challenge virus is used. The lot of working CVS may be used for as long as full potency is maintained as shown by mouse titration. Immunization of mice A four serial 5-fold dilution range of test vaccines and reference vaccine are performed in PBS. The initial dilution generally corresponds to 1/5, but may be adapted depending on the potency of the test vaccine and the reference vaccine. Dilutions may be performed in 15 mL conical centrifuge tubes as follows: Dilution Volume of vaccine Volume of PBS 10−0.7 2 mL of neat vaccine 8 mL 10−1.4 2 mL of dilution 10−0.7 8 mL 10−2.1 2 mL of dilution 10−1.4 8 mL 10−2.8 2 mL of dilution 10−2.1 8 mL 1. Inject groups of sixteen 3-week-old female mice intraperitoneally (Fig. 42.2) with 0.5  mL of each dilution of the test vaccine and the reference vaccine. The mouse is manually restrained and is held in a supine position. The needle (23-gauge x 1”) and syringe (2.5 mL) are kept parallel to the vertebral column of the animal; the injection is made in the lower quadrant of the abdomen with an angle of about 10°. 2. Administer two doses of vaccine to each mouse one week apart. 3. Set aside enough mice for an adequate titration of the challenge virus to be made with at least 10 mice for each dilution of virus (a total of four dilutions, i.e. 40 mice). Laboratory techniques in rabies Fifth edition 183 NIH test for potency testing of vaccines Part 7. Potency determinations 4. Use a different needle and syringe to inoculate each group of mice. Where supplies are limited, use a single needle and syringe to inoculate the test vaccine and/or reference vaccine. In that case, mice receiving the most diluted vaccine should be inoculated first, followed by those receiving successively more concentrated vaccines. Mice receiving different vaccine concentrations should be housed separately. Challenge of control and test mice All mice are challenged intracerebrally (Fig. 42.1) 14 days after the first dose of vaccine as follows: 1. Take one ampoule of the pooled working CVS, put it on a bed of ice and thaw rapidly under cold running water. 2. Based on the previous titrations, dilute the CVS in PBS supplemented with 2% of heat-inactivated FCS to obtain the challenge dilution providing about 50 LD50 in 30 µL. From this challenge dilution, a three serial 10-fold dilution range is prepared to perform a titration of the virus as follows: Fig. 42.2. Intraperitoneal injection to lower quadrant of a mouse B y co ur te sy o f A le xa nd re S er va t, A N S ES , M al zé vi lle , F ra nc e Dilution Volume of vaccine Volume of PBS 10−0 Challenge dilution providing 50LD50/0.03 mL – 10−1 0.5 mL of dilution 10−0 4.5 mL 10−2 0.5 mL of dilution 10−1 4.5 mL 10−3 0.5 mL of dilution 10−2 4.5 mL All dilutions of CVS are held in an ice bath throughout the experiment. Laboratory techniques in rabies Fifth edition 184 NIH test for potency testing of vaccines Part 7. Potency determinations 3. Anaesthetize the mice to minimize or avoid the pain and distress associated with the intracranial inoculation procedure (following international regulations on animal experimentation). This anaesthesia has no adverse effect on the test results. 4. Challenge the immunized mice intracerebrally with 0.03 mL of the dilution containing 50 LD50 per 0.03 mL. Inoculate the control mice intracerebrally (syringe 1 mL, needle 26G / ½”) with 0.03 mL of each dilution of the challenge virus. It is preferable to use a different syringe for each dilution of the challenge virus; however, if only one syringe is used, the 10−3 dilution must be injected first, followed by the 10−2 dilution, the 10−1 dilution and then the 10−0 dilution. 5. Observe the mice daily for 14 days to detect the appearance of typical rabies clinical  signs. Generally shaky movements, trembling and convulsions (stage 3 of rabies  clinical signs) are suitable humane end-points instead of lethality, to reduce the  duration of animal suffering (3). Record animals that die from rabies and animals that are euthanized after evidence of stage 3 clinical signs (see Annex). Include mice showing rabies stage 3 clinical signs on the 14th day. Calculation of potency The NIH potency test is a titration method based on quantal or “all or none” responses. In such dilution assays, a comparison between the dose–response relationships of the reference vaccine and the test vaccine is necessary. Lineariza- tion of these dose–response curves may be obtained by different transformations, such as probit, angular or logit. Statistics software may be helpful to simplify the calculations. Potency and confidence limits can be calculated by comparing the ED50 of the reference vaccine with the ED50 of the test vaccine. When an in-depth statistical analysis is not possible (as described above), a volumetric method of calculation of potency should be used. This compares the 50% end-point dilution (vaccine dilution protecting 50% of mice) of the vaccine under test with that of the international standard (or equivalent national reference vaccine). The relative potency (RP) of the vaccine under test is determined by the formula: RP = Where TV = test vaccine RV = reference vaccine Dose = volume of a single vaccinal dose, as stated by the producer. For example, if the ED50 of the test vaccine is 1:90 and that of the reference vaccine is 1:70, the reciprocal values will be 90 and 70, respectively. If it is assumed that a single human dose of the test vaccine is 2 mL and that 1 mL of the reference vaccine represents a single dose for humans, then: RP = Laboratory techniques in rabies Fifth edition 185 NIH test for potency testing of vaccines Part 7. Potency determinations Minimum potency requirements The relative potency of rabies vaccines for veterinary use should be determined using a recognized rabies reference vaccine and the batch of rabies vaccine used in a valid vaccination challenge test in the target species. The test should be carried out at the end of the period of immunity claimed by the vaccine producer. The relative potency value obtained in the NIH test should become the minimum value for all subsequent batches of the vaccine. At its eighth meeting, the WHO Expert Committee on Rabies (4) suggested that inactivated veterinary vaccines with a potency of < 1.0 IU per dose, as measured by the NIH test, should not be licensed or released unless an adequately designed experiment has demonstrated a duration of immunity of at least 1 year in the species for which the vaccine is to be used. The Committee recommended that highly purified, modern rabies vaccines for human use should have a minimum potency of 2.5 IU per dose (5,6). Modified NIH test To comply with the 3Rs principle, which aims to replace or reduce animal use and refine experimental procedures, a modified NIH test, based on a single immu- nization instead of two, may be used as described in the European Pharmacopeia for rabies inactivated vaccines for veterinary use (7). For laboratories testing numerous batches of vaccine every year, and having a strong expertise and testing history, groups of 10 mice (instead of 16) may be used as well for the test vaccine and the reference vaccine (8). Single dilution test The single dilution test is a simplification of the NIH test. The aim of this test is to determine whether a rabies vaccine satisfies the minimum potency require- ment without assigning a precise value to it. The test provides qualitative results. It requires a homogeneous stock of challenge virus, well standardized methods of titration and laboratory animals of constant quality (consistent response to the vaccine and the challenge virus). This test is particularly useful for testing multiple batches of vaccine within a short time and for reducing the number of mice used in the NIH test. However, given its own lack of precision, the minimum requirement for vaccines tested by the single dilution test is higher than that for vaccines tested by the standard NIH test. Method Before performing the single dilution test, a laboratory must have determined the titre of the reference vaccine (sixth International Standard for Rabies Vaccine, Biological Reference Preparation batch N°5, or any national reference vaccine calibrated against an international standard) several times in order to determine its ED50. When the weighted mean of the ED50 of the reference vaccine has been calculated, the theoretical ED50 for a vaccine of the required potency can be deter- mined using the formula: D = Dm + log10 (n) – log10 (N)-log10 (v) Laboratory techniques in rabies Fifth edition 186 NIH test for potency testing of vaccines Part 7. Potency determinations Where: D = the minimum ED50 required for the vaccine under test (decimal logarithm of the inverse of the arithmetical dilution); Dm = the weighted mean of the ED50 obtained with the reference vaccine; N = the required potency of the vaccine under test (IU/mL); N = the required potency of the reference vaccine (IU/mL) – this information is provided in the insert supplied with the vaccine; and V = the volume (mL) of a single dose of the vaccine under test, as stated by the manufacturer. This dilution is then used for the vaccine under test. The standard NIH test protocol is followed using 10 mice vaccinated with the theoretical ED50 of the vaccine under test. To satisfy the minimum requirement, at least eight of the 10 vaccinated mice should survive after challenge. Discussion Potency tests of vaccines are quality control tests that provide manufacturers with information on the potency of their products before licensing. These tests are also widely used by regulatory authorities to ensure that marketed vaccines are sufficiently potent and effective. Many quality control tests for vaccines, notably the rabies vaccine potency test, are based on techniques described several decades ago and still rely on the use of laboratory animals. Nevertheless, the introduction of the 3Rs concept (9), and the growing concern about ethics and animal welfare, have convinced regulatory authorities to promote animal reduction and refinement of the NIH test: anaesthesia before injection of intracerebral virus, definition of humane end-points (10). Reduction of animal use in each dilution is now widely incorporated in guidelines and monographs and should be considered and applied by all laboratories carrying out the NIH test. Methods such as the single dilution test or the serological potency assay could also provide advances to go even further in the 3Rs approach. Laboratory techniques in rabies Fifth edition 187 NIH test for potency testing of vaccines Part 7. Potency determinations References 1. Daas A, Bruckner L, Milne C. EDQM biological reference preparation for rabies vaccine (inactivated) for veterinary use: collaborative study to establish batch no. 5. Pharmeur Bio Sci Notes. 2015;1:57–72. 2. WHO Expert Committee on Biological Standardization. Geneva: World Health Organization; 2008 (http://apps.who.int/iris/bitstream/handle/10665/70593/ WHO_BS_08.2087_eng.pdf, accessed 1 October 2018). 3. Bruckner L, Cussler K, Halder M, Barrat J, Castle P, Duchow K, et al. 3Rs approaches in the quality control of inactivated rabies vaccines. Atla. 2003;31:429–54. 4. WHO Expert Consultation on Rabies, 3rd report. Geneva: World Health Orga- nization; 2018 (WHO Technical Report Series, No. 1012; http://apps.who.int/ iris/bitstream/handle/10665/272364/9789241210218-eng.pdf, accessed 1 October 2018). 5. WHO Expert Committee on Biological Standardization, 37th report. Geneva: World Health Organization; 1987 (WHO Technical Report Series, No. 760; http://www.who.int/biologicals/publications/trs/en/, accessed 1 October 2018). 6. WHO Expert Committee on Biological Standardization, 31st report. Geneva: World Health Organization; 1981 (WHO Technical Report Series, No. 658; http://www.who.int/biologicals/publications/trs/en/, accessed 1 October 2018). 7. Rabies vaccine (inactivated) for veterinary use, monograph 0451. In: European Pharmacopoeia, 8th edition. Strasbourg: Council of Europe; 2013:1055–7. 8. Stockes W, McFarland R, Kulpa-Eddy J, Gatewood D, Levis R, Halder M, et al. Report on the international workshop on alternative methods for human and veterinary rabies vaccine testing: State of the science and planning the way forward. Biologicals, 2013;41:279–94. doi:10.1016/j.biologicals.2013.06.013. 9. Russell WMS, Burch RL. The principles of humane experimental technique. London: Methuen; 1959 [Reprinted by Universities Federations for Animal Welfare, 1992]. 10. Healy DM, Brookes SM, Banyard AC, Núñez A, Cosby SL, Fooks AR. Patho- biology of rabies virus and the European bat lyssaviruses in experimentally infected mice. Virus Res. 2013;172:46–53. Laboratory techniques in rabies Fifth edition 188 NIH test for potency testing of vaccines Part 7. Potency determinations Annex Progress of rabies virus infection in mice associated with stages of clinical signs Stage 1: ruffled fur and hunched back Stage 2: loss of alertness, slow and/or circular movements Stage 3: trembling and shaking movements, weight loss, convulsions Stage 4: paresis followed by signs of paralysis Stage 5: moribund animals, prostration Laboratory techniques in rabies Fifth edition 189 The serological potency assay Part 7. Potency determinations Chapter 43 The serological potency assay for batch potency testing of inactivated rabies Introduction The serological potency assay (SPA) uses groups of mice immunized with a prediluted test vaccine or the reference standard vaccine adjusted to the minimum potency of 1 International Unit (IU) per dose. Blood samples from all mice are taken 14 days after immunization and the amount of rabies virus (RABV)-neutrali- zing antibodies induced after vaccination is determined using a serum neutraliza- tion test. The vaccine complies if the antibody titres obtained with the test vaccine are greater than or equal to the antibody titres obtained for the reference vaccine. Laboratories willing to implement this alternative test are strongly encouraged to have a background in the mouse potency test and to conduct product-specific validations on rabies inactivated vaccines that they routinely control. This alter- native method offers significant progress for the batch potency testing of rabies vaccines by significantly decreasing the number of animals (20 vs 148 for the NIH test) for one test vaccine and by avoiding the pain and distress of the intracranial challenge along with the signs associated with a lethal RABV infection. Methods Reagents Reference vaccine Several reference vaccines are commercially available. The Biological Refe- rence Preparation (BRP) batch No. 5 is distributed by the European Directorate for the Quality of Medicines. It is a freeze-dried vaccine derived from the Pitman Moore strain of RABV produced in Nil-2 cell line and inactivated with ß-propiolactone. This reference vaccine has an assigned titre of 10 IU/vial (1). The sixth International Standard for Rabies Vaccine (07/162) is distributed by the National Institute for Biological Standards and Control (NIBSC), UK. This material was prepared from a bulk of Vero cell-derived, RABV Pitman Moore strain, produced by the same manufacturing process as the fifth International Standard, RAV. It has an assigned titre of 8 IU/vial (2). Laboratories can prepare an internal reference vaccine provided it is calibrated against an International Standard (see above). • Swiss/NMRI female mice, or equivalent, weighing 18–20 g • phosphate buffered saline (PBS), pH 7.4 • xylazine and ketamine-based anaesthetics Laboratory techniques in rabies Fifth edition 190 The serological potency assay Part 7. Potency determinations Protocol Immunization of mice For immunization of mice, the reference vaccine and the test vaccine are diluted as follows: 1. Prepare a 1 IU/mL suspension of the reference vaccine in PBS. 2. Test vaccines are diluted according to their minimum approved specifica- tion. Rabies vaccines with a minimum specification at 1 IU/mL are used neat. Vaccines with a minimum specification at 2 IU/mL or 3 IU/mL are diluted 1:2 and 1:3 respectively in PBS. 3. Inject groups of 8–10 female Swiss/NMRI mice, weighing 18–20 g, intraperi- toneally with 0.2 mL of each dilution of the test vaccines and the reference vaccine. Mice are manually restrained and are held in a supine position. The needle (23G x 1”) and syringe (2.5 mL) are kept parallel to the vertebral column of the animal and the injection is made in the lower left quadrant of the abdomen with an angle of about 10°. Blood sampling After 14 days, mice are anaesthetized using a combination of xylazine and ketamine. Blood is collected by heart puncture under thoracotomy to obtain a large amount a venous blood with certainty. 1. Restrain the mouse on its back on an operating board. 2. Cut the skin around the xiphoid cartilage to expose the muscular wall of the thorax and abdomen. 3. Incise the abdominal wall just below the xiphoid cartilage and cut the diaphragm and thoracic wall at both sides of the sternum. The thoracic wall is pulled upwards and gripped with forceps. 4. Prepare a 1 mL syringe with a needle (21–23 gauge), insert the needle into the right ventricle of the beating heart, and collect the blood slowly and conti- nuously by withdrawing the plunger. 5. Once bloods are collected from all mice, sera are extracted after centrifugation (2000 g, 15 min) and kept at −20 °C until determination of RABV neutralizing antibody. Determination of RABV neutralizing antibodies All sera from mice immunized with the reference vaccine and from mice immu- nized with test vaccine are tested individually for RABV neutralizing antibodies using a sero-neutralization assay such as the FAVN test (3, 4) or the RFFIT (5). Statistical analysis The SPA uses the one-sided limit test (the Wilcoxon–Mann–Whitney exact test) lying on the ranking of all titres obtained with mice immunized with the test vaccine and the reference vaccine. Calculations must be performed using appro- priate statistics software. Laboratory techniques in rabies Fifth edition 191 The serological potency assay Part 7. Potency determinations Validation of the SPA The assay is invalid if more than two non-responders (RABV neutralizing anti- body titre below the quantification limit) are observed in a group of 10 mice vacci- nated with the reference vaccine. A test vaccine complies with the SPA if the RABV neutralizing antibody titre is significantly higher (p ≤ 0.05) than the RABV neutralizing antibody titre obtained with the reference vaccine. Discussion The SPA was first included in the 8th edition of the European Pharmacopeia as an official alternative to the NIH test for the batch potency test of rabies inactivated vaccines for veterinary use (6). This test offers a real improvement in animal welfare by reducing significantly the number of animals used and decreasing the suffering entailed by the intracranial injection and the development of rabies clinical signs. The SPA for rabies vaccine batch potency testing, while not completely elimina- ting the use of experimental animals, contributes to the efforts to be made in the context of the 3Rs. Laboratories are strongly encouraged to switch from the NIH mouse challenge test to the SPA and to validate this test on each rabies vaccine that they routinely control for potency. References 1. Daas A, Bruckner L, Milne C. EDQM biological reference preparation for rabies vaccine (inactivated) for veterinary use: collaborative study to establish batch No. 5. Pharmeur Bio Sci Notes. 2015;1:57–2. 2. WHO Expert Committee on Biological Standardization. Report. Geneva: World Health Organization; 2008 (WHO/BS/08.2087; http://apps.who.int/iris/ bitstream/handle/10665/70593/WHO_BS_08.2087_eng.pdf;sequence=1, accessed 1 October 2018). 3. Servat A, Schereffer JL, Kempff S, Brogat V, Litaize E, Cliquet F. Validation and adoption of the FAVN test as an alternative method to replace the in-vivo potency tests of inactivated rabies vaccines for veterinary use. Altern Lab Anim. 2015;43:19–27. 4. Cliquet A, Aubert M, Sagné L. Development of a fluorescent antibody virus neutralisation test (FAVN test) for the quantification of rabies-neutralising anti- body. J Immunol Methods. 1998;212:79–87. 5. Krämer B, Bruckner L, Daas A, Milne C. Collaborative study for validation of a serological potency assay for rabies vaccine (inactivated) for veterinary use. Pharmeur Bio Sci Notes. 2010;2:37–55. 6. Rabies vaccine (inactivated) for veterinary use, monograph 0451. In: European Pharmacopoeia, 8th edition. Strasbourg: Council of Europe; 2013:1055–7. Laboratory techniques in rabies Fifth edition 192 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Chapter 44 In vitro tests for rabies vaccine potency testing Introduction For more than 50 years, the NIH test (1) has been used to evaluate rabies vaccine potency before batch release. The test involves immunizing groups of mice intraperitoneally with the vaccine to be tested and administering an intrace- rebral challenge 14 days later with the challenge virus standard (CVS) strain (see Chapter 42). Although still required to assess vaccine potency by WHO (2) and the European Pharmacopoeia (3), the NIH test has several drawbacks: results are highly variable (4); live rabies virus (RABV) is used and requires strict biosafety measures; and large numbers of animals are employed and the severity of the challenge raises ethical concerns (5). A less severe variation of this test has been developed: 2 weeks after intraperitoneal vaccination as above, mice are bled and RABV neutralizing antibodies (VNAs) are tested in an in vitro neutralization test (see Chapter 43). This test is already in use for veterinary vaccines (6, 7) and has been considered for human vaccines (8). However, it sacrifices a large number of laboratory mice. Today, both International (9) and European (10) recommendations encourage manufacturers and national control laboratories (Official Medicine Control Labora- tories; OMCLs) to implement the “3Rs strategy” for the “Replacement, Reduction and Refinement” of laboratory animal testing. European Directive 2010/63/EU (in force since 1 January 2013) related to the protection and welfare of animals has reinforced the rules for vaccine manufacturers and laboratories involved in quality control of rabies vaccines as well as in rabies research (11). Development, valida- tion and use of in vitro alternative approaches have now become a priority; they are not only ethically sound but can also reduce batch testing costs and shorten the time for results to hours instead of weeks (3). Several immunochemical methods, such as the antibody-binding-test (12, 13), the single radial immunodiffusion test (14) and the ELISA test (15–19) are recom- mended by the WHO Technical Report Series (2) and the European monograph (3) to quantify the antigen content in rabies vaccines. They are used by manufactu- rers to monitor the consistency of vaccine production and by the OMCL to assess the consistent formulation of batches of human vaccine (20), even if the NIH test is still retained for potency. At the surface of the RABV particle, the glycoprotein adopts a trimeric form (21–25). In rabies vaccine, this native trimeric form constitutes the major immu- nogen to induce VNAs (26), while the soluble or denatured glycoproteins are poorly immunogenic (27, 28). The single radial immunodiffusion test requires a pre-treat- ment which may alter the membrane-anchored trimers of the glycoprotein into soluble or denatured forms (14, 29). Hence, this test is less able to discriminate between immunogenic and non-immunogenic glycoproteins and thus less rele- Laboratory techniques in rabies Fifth edition 193 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations vant to appraise the immunogenicity of a vaccine lot. Conversely, the ELISA test is more sensitive (14), preserves the native structure of the glycoprotein, and is thus more appropriate to determine the content of the natively folded trimeric glyco- protein. Studies have demonstrated good concordance between the NIH test and the antigen content evaluated by ELISA in vaccines, concluding that ELISA methods were suitable for the in vitro potency test and advocating that such tests might partly replace or even supplement the NIH test (4, 18, 19, 30–33). The complete avoidance of animal use is an achievable objective, and the European Pharma- copoeia now recommends the use of validated serological or immunochemical assays as alternatives to the NIH test (3). Method The vaccine to be tested is incubated in a plate previously sensitized with anti-glycoprotein VNA, either polyclonal or monoclonal antibody. Bound antigens are subsequently identified by adding the same (or another) anti-glycoprotein anti- body labelled with peroxidase, which is revealed in the presence of substrate and chromogen. Comparison of absorbance measured for the tested vaccine and the reference vaccine allows the determination of the glycoprotein content. The assay is functional for both purified anti-glycoprotein polyclonal antibodies and mono- clonal antibodies concentrated with ammonium sulfate. The method to obtain and purify anti-glycoprotein polyclonal rabbit immunoglobulins G (IgG) or monoclonal mouse globulins has been extensively described in the previous edition of this manual (34), as has the method to conjugate antibodies with peroxidase (35). For the use of new reagents, such a defined and updated SOP may be available from commercial partners. The following protocol is based on an indirect ELISA sandwich immunocapture using a monoclonal antibody D1 clone (mAb-D1) which recognizes the antigenic sites III (aa 330 to 338) of the trimeric RABV glycoprotein (24, 36). This method was developed initially at the Institut Pasteur (18, 30) then optimized and validated by the Agence Nationale de Sécurité du Médicament et des produits de santé (ANSM) laboratory, i.e. the French OMCL (4, 33). The monoclonal antibody (MAb) D1 is used for both coating and detection, which allows only trimers of the glyco- protein to be to recognized, i.e. the immunogenic RABV antigen. However, the same method may be applied using different MAbs (e.g. Wistar Institute MAb 1112) recognizing different antigenic sites of the RABV glycoprotein (37). Protocol Microplate sensitization The microplate is sensitized by adding to each well 200 µL of an appropriate dilution of anti-glycoprotein purified polyclonal or semi-purified MAbs in carbo- nate buffer 50 mmol, pH=9.6. Different dilutions of antibody must be previously tested to determine the optimal concentration, as about 1 µg/well is generally required. Incubate the microplate for 3 h at 37 °C in a humidified atmosphere (or covered with a sealer sheet). Laboratory techniques in rabies Fifth edition 194 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 1. Aspirate carefully the well content, invert the microplate which is left drying on an adsorbant paper at laboratory temperature for 5 min. 2. Fill each well with 300 µL of test buffer: 0.3% bovine serum albumin (BSA), 5% sucrose dissolved in carbonate buffer 50 mmol, pH=9.6. 3. Incubate for 30 min at 37 °C. 4. Aspirate carefully the well content again, invert the plate which is left to dry on an adsorbant paper at laboratory temperature for 1 min. 5. The microplate can be immediately used or stored sealed at −20 °C until use. When the microplate is kept > 3 months, it must be tested before use. The assay 1. The sensitized plate is washed 5 times with PBS-Tween, pH7 (washing buffer). Between each washing, the microplate is inverted and dried for 1 min on adsorbant paper. 2. The first well 1A (or all wells of the line 1) receive(s) 200 µL of PBS-Tween-BSA, pH7 and serves as a blank control. 3. Distribute 200 µL of eight serial 2-fold dilutions in PBS-Tween-BSA, pH7 of the reference vaccine in duplicate in wells of the lines 2 and 3 of the microplate. The lowest dilution must have a content about 1 µg/mL of rabies virus glyco- protein. 4. Distribute 200 µL of serial 2-fold dilutions in PBS-Tween-BSA, pH7 of each vaccine sample to be tested in the remaining wells, each dilution in duplicate. 5. Cover the microplate with an adhesive film and incubate for 1 h at 37 °C. 6. Remove the film and aspirate carefully the content of each well. 7. Wash five times with PBS-Tween, pH7. 8. Distribute 200 µL of an appropriate dilution in PBS-Tween-BSA, pH7 of peroxi- dase-labelled antibodies in all wells. 9. Seal the microplate and incubate for 1 h at 37 °C. 10. Aspirate carefully the labelled antibodies, wash the microplate six times with PBS-Tween, pH7, invert and dry it for 1 min on adsorbant paper. 11. Distribute to each well 200 µL of substrate-chromogen solution. Seal the microplate and incubate in a dark at room temperature for 30 min. 12. A yellow–orange colour develops, and the reaction is stopped by adding in each well 50 µL of stopping solution (4 mol sulfuric acid). 13. Carefully wipe the bottom of the microplate and place it in a spectropho- tometer to determine the optical density at 492 nm of the negative control (blank), the reference vaccine and the tested vaccine.   Laboratory techniques in rabies Fifth edition 195 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Interpretation of the results The reference vaccine must have a well-known glycoprotein content (µg/mL); this can be determined either directly when using purified viral particles (deter- mination of total viral proteins then evaluation of the percentage of glycoprotein by SDS-polyacrylamide gel electrophoresis) or indirectly by ELISA when using a calibrated reference vaccine. This allows to design a reference curve showing the glycoprotein content in function of the optical density (OD), as seen in Fig. 44.1. The evaluation of glycoprotein content in the tested vaccine is expressed in µg/ mL by comparison to this reference curve. In the above example a vaccine diluted 1/32 which exhibits a mean OD for duplicate samples of 1.6 using MAb-D1 will content 32 x 500 ng/mL = 16 µg/mL of glycoprotein. As the reference vaccine has been previously tested for its activity expressed in international units (IU/mL), the comparison of the mean ODs allows the in vitro potency of the tested vaccine to be evaluated. The tested vaccine potency is expressed as glycoprotein content in equivalent international units (EIU/mL). Precautions • Vaccines or infected cell supernatants to be tested are often inactivated. Never- theless, samples are considered potentially infectious, and health and safety precautions must be observed as described in Chapter 3 on Biosafety. • All reagents must be adjusted to the laboratory temperature by waiting 10 min before use. • Before working, a plan for distribution and identification of samples must be established. Fig. 44.1. Reference curve showing the glycoprotein content in function of the optical density (492 nm) Laboratory techniques in rabies Fifth edition 196 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations • Reference antigen or vaccine and samples are diluted in tubes and not in the sensitized plate. • If crude infected cell supernatant is tested, a non-infected cell supernatant should be used to eliminate possible nonspecific reactions. • The quality of the results depends upon compliance with good laboratory prac- tices. The washings can be carefully carried out with an automatic washer or by distributing manually washing buffer and drying the plate after inverting it on an adsorbant paper after each washing. Discussion For more than 1003 batches of human rabies vaccine to be released in the market, the French OMCL (ANSM) has monitored the glycoprotein content using the ELISA method described above and the NIH test performed at the manufac- turer’s site (Fig. 44.2). Although no correlation has been demonstrated statistically between the two tests, mainly because of the high variability of the NIH test (hete- rogeneity in mice and challenge procedure (38), a concordance in the profile of results and the same pass or fail conclusions were obtained using in vitro and in vivo assays (4). This concordance is logical since the NIH test evaluates protec- tion of mice from an intracerebral challenge, i.e. the quantity of VNAs induced by vaccination, and the MAb D1 clone recognizes the native trimers of the glyco- protein that constitute the main RAVB immunogen (36, 39). The recognized epitope is located at the level of the antigenic site III which is not only immunodominant for the induction of VNAs but also involved in neurovirulence, pathogenicity (40–41) and receptor recognition (42). S ou rc e: re pr od uc ed w ith p er m is si on fr om re fe re nc e (4 ) IU, international units; IVRP, in vitro relative potency; NIH, National Institutes of Health Fig. 44.2. Comparison of the quantification of glycoprotein content by the ELISA method (blue line) and potency results by the NIH test (red line) for 1003 batches of human rabies vaccines Laboratory techniques in rabies Fifth edition 197 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations In summary, the in vitro ELISA method, which specifically quantifies a highly immunogenic epitope of correctly folded glycoprotein trimers, appears as efficient as the NIH test for measuring the capacity of a vaccine batch to induce VNAs that protect against a productive RABV infection. The glycoprotein quantification by ELISA thus mimics in vitro the capacity of rabies vaccine to induce humoral immu- nity. Additionally, it is able to discriminate sub-potent lots, in quality or in quantity, from potent ones (4). Before proposing that an in vitro ELISA assay measuring the immunogenic glycoprotein could replace the NIH test, it is desirable to organize an international collaborative study for its improvement and standardization. A workshop of the Interagency Coordinating Committee on the Validation of Alternative Methods (ICCVAM) entitled “International Workshop on Alternative Methods to Reduce, Refine, and Replace the Use of Animals in Vaccine Potency and Safety Testing” (Ames, September 2010) (43), concluded that the NIH test should be replaced by an alternative test showing agreement with the immune response and be able to discriminate between potent and sub-potent batches (4). During the following workshop of the European Partnership for Alternatives to Animal Testing (EPAA) in 2012 (44), it was decided that a standardized sandwich ELISA calibrated against the current international rabies reference standard would be an ideal alternative for rabies vaccine potency testing. An international colla- borative pre-validation study including both manufacturers and regulatory bodies further compared various ELISA designs used by manufacturers and their national control laboratories for batch release for their ability to discriminate sub-potent from potent batches from different vaccine brands (37). The most appropriate ELISA test remains to be formally validated under the umbrella of the European Directorate for the Quality of Medicines’ (EDQM) Biological Standardisation Programme. References 1. Seligmann EB. The NIH test for potency. In: Kaplan MM, Koprowski H editors. Laboratory techniques in rabies, 3rd edition. Geneva: World Health Organi- zation; 1973;279– 2. Recommendations for inactivated rabies vaccine for human use produced in cell substrates and embryonated eggs. In: WHO Technical Report Series, No. 941. Geneva: World Health Organization; 2007:83. 3. Rabies vaccine for human use prepared in cell cultures. European Pharma- copoeia; 04/2008:822. 4. Gibert R, Alberti M, Poirier B, Jallet C, Tordo N, Morgeaux S. A relevant in vitro ELISA test in alternative to the in vivo NIH test for human rabies vaccine batch release. Vaccine. 2013;31:6022–9. 5. Stokes W, McFarland R, Kulpa-Eddy J, Gatewood D, Levis R, Halder M, et al. Report on the international workshop on alternative methods for human and veterinary rabies vaccine testing: state of the science and planning the way forward. Biologicals. 2012;40:369–81. Laboratory techniques in rabies Fifth edition 198 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 6. Krämer B, Bruckner L, Daas A, Milne C. Collaborative study for validation of a serological potency assay for rabies vaccine (inactivated) for veterinary use. Pharmeur Bio Sci Notes. 2010;2:37–55. 7. Krämer B, Kamphuis E, Hanschmann KM, Milne C, Daas A, Duchow K. A multi-dose serological assay suitable to quantify the potency of inactivated rabies vaccines for veterinary use. Biologicals. 2013;41:400–6. 8. Fitzgerald EA, Gallagher M, Hunter WS, Seligmann EB Jr. Use of the antibody assay in immunized mice for the determination of rabies vaccine potency. Dev Biol Stand. 1978;40:183–6. 9. Milstien J, Grachev V, Padilla A, Griffiths E. WHO activities towards the three Rs in the development and control of biological products. In: Brown F, Cussler K, Hendriksen C, editors. Replacement, reduction and refinement of animal experiments in the development and control of biological products. Dev Biol Stand. 1996;31–9. 10. Behr-Gross ME, Spieser JM. Contributions of the European OMCL Network and Biological Standardisation Programme to Animal Welfare. Altex. 2006;23:21–8. 11. Directive 2010/63/EU of the European Parliament and the Council of 22 September 2010 on the protection of animals used for scientific purposes. Official Journal of European Union. 2010;L276:33–79. 12. Fitzgerald E, Green O, Seligmann E. Rabies vaccine potency testing: a comparison between the antibody-binding test and the NIH test. Symp Series Immunobiol Standard. 1974;21:300–7. 13. Barth R, Groβ-Albenhausen E, Jaeger O, Milcke L. The antibody-binding test, a useful method for quantitative determination of inactivated rabies virus antigen. J Biol Standard. 1981;9:81–9. 14. Ferguson M, Schild G. A single-radial-immunodiffusion technique for the assay of rabies glycoprotein antigen: application for the potency tests of vaccines against rabies. J Gen Virol. 1982; 59:197–201. 15. Atanasiu P, Perrin P, Delagneau JF. Use of an enzyme immunoassay with protein A for rabies antigen and antibody determination. Develop Biol Stan- dard. 1980;46:207–15. 16. van der Marel P, van Wezel A. Quantitative determination of rabies antigen by ELISA. Develop Biol Standard. 1981;50:267–75. 17. Adamovicz P, Aguillon F, David A, Le Fur R, Mazert MC, Perrin P, et al. The use of various immunochemical, biochemical and biological methods for the analysis of rabies virus production in tissue cultures. Develop Biol Standard. 1984;55:191–7. 18. Lafon M, Perrin P, Versmisse P, Sureau P. Use of monoclonal antibody for quantification of rabies vaccine glycoprotein by enzyme immunoassay. J Biol Standard. 1985;13:295–301. Laboratory techniques in rabies Fifth edition 199 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 19. Thraenhart O, Ramakrishnan K. Standardization of an enzyme immunoassay for the in vitro potency assay of inactivated tissue culture rabies vaccines: determination of the rabies virus glycoprotein with polyclonal antisera. J Biol Standard. 1989;17:291–309. 20. Guideline for rabies vaccine. In: Official Control Authority Batch Release of Rabies Vaccines. Strasbourg: Council of Europe; 2014 (PA/PH/OMCL (11) 173 DEF; https://www.edqm.eu/en/human-ocabr-guidelines, accessed 1 October 2018). 21. Whitt MA, Buonocore L, Prehaud C, Rose JK. Membrane fusion activity, oligomerization and assembly of the rabies virus glycoprotein. Virology. 1991;185:681–8. 22. Gaudin Y, Ruigrok RW, Tuffereau C, Knossow M, Flamand A. Rabies virus glycoprotein is a trimer. Virology. 1992;187:627–32. 23. Roche S, Gaudin Y. Characterization of the equilibrium between the native and fusion-inactive conformation of rabies virus glycoprotein indicates that the fusion complex is made of several trimers. Virology. 2002;297:128–35. 24. Desmézières E, Maillard AP, Gaudin Y, Tordo N, Perrin P. Differential stability and fusion activity of Lyssavirus glycoprotein trimers. Virus Res. 2003;91:181–7. 25. Koraka P, Bosch BJ, Cox M, Chubet R, Amerongen G, Lövgren-Bengtsson K, et al. A recombinant rabies vaccine expressing the trimeric form of the glycoprotein confers enhanced immunogenicity and protection in outbred mice. Vaccine. 2014;32:4644–50. 26. Wiktor T, Gyorgy E, Schlumberger D, Sokol F, Koprowski H. Antigenic proper- ties of rabies virus components. J Immunol. 1973;110:269–76. 27. Gamoh K, Senda M, Itoh O, Muramatsu M, Hirayama N, Koike R, et al. Use of ELISA for in vitro potency test of rabies vaccines for animal use. Biologicals. 1996;24:95–101. 28. Dietzschold B, Wiktor T, Wunner W, Varrichio A. Chemical and immunological analysis of the rabies soluble glycoprotein. Virology; 1983:124:330–7. 29. Ferguson M, Seagroatt V, Schild G. A collaborative study on the use of single radial immunodiffusion for the assay of rabies virus glycoprotein. Develop Biol Standard. 1984;12:283–94. 30. Perrin P, Morgeaux S, Sureau P. In vitro rabies vaccine potency appraisal by ELISA: advantages of the immunocapture method with a neutralizing anti-glycoprotein monoclonal antibody. Biologicals. 1990;18:321–30. 31. Rooijakkers EJ, Uittenbogaard JP, Groen J, Osterhaus AD. Rabies vaccine potency control: comparison of ELISA systems for antigenicity testing. J Virol Methods. 1996;58:111–19. 32. Rooijakkers EJ, Uittenbogaard JP, Groen J, van Herwijnen J, Osterhaus AD. Development and evaluation of alternative testing methods for the in vivo NIH potency test used for the quality control of inactivated rabies vaccines. In: Brown F, Cussler K, Hendriksen C, editors. Replacement, reduction and Laboratory techniques in rabies Fifth edition 200 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations refinement of animal experiments in the development and control of biolo- gical products. Dev Biol Stand. 1996:137–45. 33. Fournier-Caruana J, Poirier B, Haond G, Jallet C, Fuchs F, Tordo N, et al. Inactivated rabies vaccine control and release: use of an ELISA method. Biologicals. 2003;31:9–16. 34. Lafon M. Techniques for the production, screening and characterisation of monoclonal antibodies. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organi- zation; 1996:133–44. 35. Perrin P. Techniques for the preparation of rabies conjugates. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:433–44. 36. Sissoëff L, Mousli M, England P, Tuffereau C. Stable trimerization of recombi- nant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol. 2005;86:2543–52. 37. Morgeaux S, Poirier B, Ragan Cl, Wilkinson D, Arabin U, Guinet-Morlot F, et al. Replacement of in vivo human rabies vaccine potency testing by in vitro glycoprotein quantification using ELISA: results of an international collabora- tive study. Vaccine. 2017;35:966–71. 38. Barth R, Diderrich G, Weinmann E. NIH test, a problematic method for testing potency of inactivated rabies vaccine. Vaccine. 1988:369–77. 39. Jallet C, Jacob Y, Balhoul C, Drings A, Desmézères E, Tordo N, et al. Chimeric lyssavirus glycoproteins with increased immunological potential. J Virol. 1999;73:225–33. 40. Dietzschold B, Wunner W, Wiktor T, Lopes A, Lafon M, Smith C, et al. Charac- terization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc Natl Acad Sci USA. 1983;80:70–4. 41. Seif L, Coulon P, Rollin P, Flamand A. Rabies virulence: effect on pathoge- nicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J Virol. 1985;53:926–34. 42. Lafon M. Rabies virus receptors. J Neurovirol. 2005;11:82–87. doi:10.1080/13550280590900427. 43. Kulpa-Eddy J, Srinivas G, Halder M, Brown K. Alternative methods to reduce, refine, and replace the use of animals in vaccine potency and safety testing: state of the science and future directions. 14–16 September 2010, Bethesda (MD), USA. Procedia Vaccinol. 2011;5:106–19. doi:10.1016/j. provac.2011.10.007. 44. De Mattia F, Hendriksen C, Buchheit K-H, Chapsal J-M, Halder M, Lambrigts, et al. The Vaccines Consistency Approach Project: an EPAA initiative. Phar- meur Bio Sci Notes. 2015:30–56. Laboratory techniques in rabies Fifth edition 201 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Annex Buffers and reagents Coating (carbonate) buffer Sodium bicarbonate 50 mmol • NaHCO3 4.20 g • Distilled water up to 1000 mL Sodium carbonate 50 mmol • Na2CO3,10H2O 14.30 g • Distilled water up to 1000 mL Carbonate buffer 50 mmol pH=9.6 Add to the sodium bicarbonate 50 mmol, the sodium carbonate 50 mmol until the desired pH is reached. Prepare fresh as required. Other buffer • Bovine serum albumin (BSA) 0.3 g • Sucrose 5 g dissolved in 100 mL of carbonate buffer, 50 mmol pH 9.6 Phosphate buffered saline (PBS) pH=7 concentrated 10 times (PBS 10X) • NaCl 80.00 g          • KCl 2.00 g • Na2PO4,12H2O                  11.33 g            • KH2PO4 2.00 g • Distilled water up to 1000 mL Adjust pH=7 with 4N NaOH Washing buffer: PBS-Tween pH=7                                        • PBS 10X 100.0 mL • Tween 20 0.5 mL • Distilled water up to 1000 mL PBS-Tween-BSA pH=7 • PBS 10X 10.00 mL • Tween 20 0.05 mL • BSA (Fraction V) 0.50 g • Distilled water up to 100 mL Laboratory techniques in rabies Fifth edition 202 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Citrate buffer pH 5.6 for peroxidase substrate • Tri-sodium citrate, 2H2O (Na3C6H5O7, 2H20) 11.67 g • Citric acid, 1H20 2.17 g • Hydrogen peroxide 30% (110 vol) 1.00 mL • Distilled water up to 1000 mL Substrate–chromogen solution Ortho-phenylene diamine 50 mg Citrate buffer pH 5.6 25 mL Stopping solution: 4 N sulfuric acid Dilution must be carried out in an ice bath • Cooled distilled water 80.00 mL • H2SO4, 36N 10.00 mL Equipment • Class II Biosafety Safety Cabinet when use of non-inactivated infected super- natant is used • Laboratory fume hood for preparation of sulfuric acid solution • Appropriate virucidal solution • Classical laboratory equipment: refrigerated centrifuge, (multichannel) micro- pipettes • 96-well MaxiSorp flat bottom plates in clear polystyrene for immunological assays (ELISA) • Shaker/incubator for plates used at 37 °C Microplate washer • Microplate reader with multichannel absorbance reading (wavelength 492 nm) ISBN: 978-92-4-151530-6

Edited by Charles E. Rupprecht LYSSA LLC Atlanta, Georgia, USA Anthony R. Fooks Animal and Plant Health Agency Addlestone, Surrey, United Kingdom Bernadette Abela-Ridder Department of Control of Neglected Tropical Diseases World Health Organization Geneva, Switzerland Laboratory techniques in rabies Fifth edition Volume 2 Laboratory techniques in rabies Fifth edition Volume 2 Edited by Charles E. Rupprecht LYSSA LLC Atlanta, Georgia, USA Anthony R. Fooks Animal and Plant Health Agency Addlestone, Surrey, United Kingdom Bernadette Abela-Ridder Department of Control of Neglected Tropical Diseases World Health Organization Geneva, Switzerland Laboratory techniques in rabies, fifth edition. Volume 2/Charles E Rupprecht, Anthony R Fooks, Bernadette Abela-Rid- der, editors. ISBN 978-92-4-151530-6 © World Health Organization 2019 Some rights reserved. This work is available under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 IGO licence (CC BY-NC-SA 3.0 IGO; https://creativecommons.org/licenses/by-nc-sa/3.0/igo). Under the terms of this licence, you may copy, redistribute and adapt the work for non-commercial purposes, provided the work is appropriately cited, as indicated below. In any use of this work, there should be no suggestion that WHO endorses any specific organization, products or services. The use of the WHO logo is not permitted. If you adapt the work, then you must license your work under the same or equivalent Creative Commons licence. If you create a trans- lation of this work, you should add the following disclaimer along with the suggested citation: “This translation was not created by the World Health Organization (WHO). WHO is not responsible for the content or accuracy of this translation. The original English edition shall be the binding and authentic edition”. Any mediation relating to disputes arising under the licence shall be conducted in accordance with the mediation rules of the World Intellectual Property Organization. Suggested citation. Rupprecht CE, Fooks AR, Abela-Ridder B, editors. Laboratory techniques in rabies, fifth edition. Volume 2. Geneva: World Health Organization; 2018. Licence: CC BY-NC-SA 3.0 IGO. Cataloguing-in-Publication (CIP) data. CIP data are available at http://apps.who.int/iris. Sales, rights and licensing. To purchase WHO publications, see http://apps.who.int/bookorders. To submit requests for commercial use and queries on rights and licensing, see http://www.who.int/about/licensing. Third-party materials. If you wish to reuse material from this work that is attributed to a third party, such as tables, fig- ures or images, it is your responsibility to determine whether permission is needed for that reuse and to obtain permis- sion from the copyright holder. The risk of claims resulting from infringement of any third-party-owned component in the work rests solely with the user. General disclaimers. The designations employed and the presentation of the material in this publication do not imply the expression of any opinion whatsoever on the part of WHO concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted and dashed lines on maps represent approximate border lines for which there may not yet be full agreement. The mention of specific companies or of certain manufacturers’ products does not imply that they are endorsed or rec- ommended by WHO in preference to others of a similar nature that are not mentioned. Errors and omissions excepted, the names of proprietary products are distinguished by initial capital letters. All reasonable precautions have been taken by WHO to verify the information contained in this publication. However, the published material is being distributed without warranty of any kind, either expressed or implied. The responsibility for the interpretation and use of the material lies with the reader. In no event shall WHO be liable for damages arising from its use. The named editors alone are responsible for the views expressed in this publication. Contents Foreword .............................................................................................................................................................. iv Preface .............................................................................................................................................................. v List of abbreviations and acronyms used in this manual .............................................................................................. vi Part 5. Demonstration of viral nucleic acids and sequences Chapter 27. Conventional pan-lyssavirus reverse transcriptase polymerase chain reaction ................................... 1 Chapter 28. Rabies real-time reverse transcriptase polymerase chain reaction ...................................................... 17 Chapter 29. Sanger sequencing of lyssaviruses ...................................................................................................... 35 Chapter 30. The FTA sampling method for collecting, storing brain material and identification of lyssaviruses ..... 44 Chapter 31. Application of next generation sequencing to rabies virus and other lyssaviruses .............................. 49 Chapter 32. Reverse transcriptase loop-mediated isothermal amplification system for the detection of rabies virus ....................................................................................................................................... 62 Chapter 33. Detection of lyssavirus nucleic acids by in situ hybridization .............................................................. 71 Chapter 34. Rapid diagnosis and genetic typing of rabies virus and other lyssaviruses using SYBR Green RT-PCR and pyrosequencing assays .............................................................................. 80 Part 6. Production of biologicals Chapter 35. Regulatory perspectives on the design of human rabies biologicals ................................................... 94 Chapter 36. Regulatory issues in the development of animal biologicals for rabies................................................ 107 Chapter 37. Preparation of fluorescent antibody conjugate for the direct fluorescent antibody test ...................... 112 Chapter 38. Anti-rabies monoclonal antibody production using mammalian expression systems ......................... 128 Chapter 39. Generation of anti-rabies single domain antibodies by display technologies ...................................... 137 Chapter 40. Production of monospecific polyclonal rabies virus antibodies in birds .............................................. 150 Chapter 41. Plant production of monoclonal antibodies for rabies ......................................................................... 160 Part 7. Potency determinations Chapter 42. The NIH test for potency testing of vaccines ....................................................................................... 180 Chapter 43. The serological potency assay for batch potency testing of inactivated rabies .................................. 189 Chapter 44. In vitro tests for rabies vaccine potency testing ................................................................................... 192 Laboratory techniques in rabies Fifth edition iv Laboratory techniques in rabies Foreword For more than 5000 years, humans have lived in fear of a bite from a rabid animal, so much so that the first written account of rabies, in the 23rd century BC, set the penalty for an owner’s dog biting another individual at “two-thirds of a mine of silver”, or about a half-day’s work. Today, our focus is more on preventing rabies and advocating for its elimination, rather than imposing penalties, and our understanding of the virus has greatly improved since the 23rd century BC. The Food and Agriculture Organization of the United Nations (FAO), the World Organisation for Animal Health (OIE) and the World Health Organization (WHO) have prioritized action against rabies and, together with Member countries, have set a goal of zero rabies deaths by 2030. Diagnostics are crucial in attaining this goal. New laboratory techniques and advancements in science have yielded better diagnostic techniques and control strategies to aid the more than 3 billion people, mainly children, in Asia and Africa who are threatened by the virus every day. Rabies is a preventable disease, yet despite the availability of efficacious and affordable vaccines, more than 60 000 people worldwide die agonizing deaths every year from the disease. No diagnostic tests are available to detect the rabies virus before the onset of clinical disease, and further research on diagnostic techniques in the field of rabies is therefore paramount. The impact of suitable laboratory capacity on surveillance and elimination of the disease worldwide is evident. The OIE’s Manual of diagnostic tests and vaccines for terrestrial animals provides internationally agreed standards for the production and control of vali- dated veterinary diagnostic methods and vaccines for use in animals. The fourth edition of WHO’s Laboratory techniques in rabies has been a guiding reference for many rabies laboratories. The first edition (1954) stated that “rabies research is far from static” and, since its publication more than 60 years ago, OIE and WHO have worked to evaluate subsequent advancements in laboratory techniques in rabies. This fifth edition provides insight into validated methods recommended for use in diagnostic laboratories, but it also includes research. While not currently applicable to all settings, these research methods may stimulate the development of improved techniques for diagnosis of rabies in the future. Improved diagnostics will strengthen surveillance of the disease, leading to enhanced control of rabies where it is most needed. Laboratory techniques in rabies Fifth edition v Laboratory techniques in rabies Preface Rabies has an enormous impact on both agriculture and conservation biology, but its greatest burden is undeniably on public health. As such, routine methods for rapid risk assessment after human exposures to rabies as well as applications for labora- tory-based surveillance, production of biologicals and management of this infectious disease are critical. Given its mandate to improve human health and control disease among its Member States, WHO has led the production of this fifth edition of Laboratory techniques in rabies. During the more than 60 years that have elapsed since the first edition was published, methods of viral diagnosis, characterization of pathogens and production of biologicals have advanced. At that time, only a single etiological agent was recognized as causing rabies. Detection of Negri bodies was the standard for diagnosis. Nerve tissue-based vaccines were the norm. Combination use of vaccines and rabies immunoglobulins in human prophylaxis was not standard. Global elimination of canine rabies was merely a dream. Rabies in wildlife was managed via population reduction. All of that has changed for the better. In the ensuing decades, further advancements in detection, prevention and control of lyssaviruses have been monitored by regular meetings of WHO experts, international research groups and countries in which rabies is endemic. The second edition of the manual was published in 1966, the third in 1973 and the fourth in 1996. The late Martin Kaplan and Hilary Koprowski were instrumental in editing the previous editions, as was input on the fourth edition by François-Xavier Meslin, now retired from WHO. Initial plans for preparation of this edition were made in 2016 and its contents were discussed at the WHO Expert meeting on rabies (Bangkok, Thailand) and modified in response. This fifth edition of Laboratory techniques in rabies contains 44 detailed chapters written by more than 85 authors from Africa, the Americas and Eurasia. The text was peer reviewed by Dr Matthias Schnell, Head of the WHO Collaborating Centre for Neurovirology; Professor Thiravat Hemachudha, Head of the WHO Collaborating Center for Research and Training on Viral Zoonoses; and Dr Asefa Deressa, Team Leader of Zoonoses Research at the Ethiopian Public Health Institute. The manual focuses on the basic methods for detection of lyssavirus antigens, antibodies and nucleic acids and the relevance of their use under different operating conditions, from the basic to the advanced. The chapters on older, less sensitive techniques used to detect Negri bodies have been removed, as have those chapters on methods of vaccine production given the progress made in the commercial use of tissue culture products in human and veterinary medicine. Recommendations for the preparations of antibodies by homolo- gous or heterologous production have been replaced by newer methods in an effort to promote a next generation of less expensive and more readily available immunoglobu- lins in the future. Other basic chapters have been retained and updated and more than a dozen added. Each of the protocols described are prescriptive and should be followed point by point in the laboratory. We gratefully acknowledge the collaboration of the many eminent scholars who contributed to the current volume, and look forward to the publication of the next edition as continued advances in the field are made. Laboratory techniques in rabies Fifth edition vi Abbreviations 3Rs “Replacement, Reduction and Refinement” of laboratory animal testing AALAS American Association for Laboratory Animal Science Ab antibody ABLV Australian bat lyssavirus ACD acid citrate dextrose ACIP Advisory Committee on Immunization Practices ACS American Chemical Society AEC 3-Amino-9-ethylcarbazole Ag antigen ANSM Agence Nationale de Sécurité du Médicament et des produits de santé AMA African Medicines Agency AP alkaline phosphatase APS ammonium persulphate ARAV Aravan virus ATCC American Type Culture Collection AVMA American Veterinary Medical Association BBLV Bokeloh bat lyssavirus BCIP 5-bromo-4-chloro-3-indolyl-phosphate BEEM better equipment for electron microscopy BHK baby hamster kidney bnAbs broadly neutralizing antibodies bp base pair BP British Pharmacopeia BPL β-propiolactone BRP Biological Reference Preparation BSA bovine serum albumin BSC biosafety cabinet BSL biosafety level CCID cell culture infectious dose CDC United States Centers for Disease Control and Prevention cDNA complementary deoxyribonucleic acid CER chicken embryo-related CFIA Canadian Food Inspection Agency List of abbreviations and acronyms used in this manual Laboratory techniques in rabies Fifth edition vii Abbreviations CHAPS 3-(3-cholamidopropyl) dimethylammonium 1-propanesulfonate CHO Chinese Hamster Ovary cells CIE counter immunoelectrophoresis CLRW clinical laboratory reagent water CNS central nervous system CPE cytopathic effect CSF cerebrospinal fluid Ct Cycle threshold CVS challenge virus standard strain ddNTP dideoxynucleotide DDSA dodecenyl succinic anhydride dNTP deoxynucleosidetriphosphate DEAE diethylaminoethyl Defra Department for Environment, Food and Rural Affairs DEPC diethylpyrocarbonate DFAT direct fluorescent antibody test DH20 distilled water DIG digoxigenin DMEM10 Dulbecco’s minimum essential medium with 10% fetal calf serum DMP30 tris dimethylaminomethyl phenol DMSO dimethyl sulfoxide DNA deoxyribonucleic acid dNTP deoxy-nucleotide-tri phosphate DPX mixture of distyrene (a polystyrene), a plasticizer (tricresyl phos- phate) and xylene DRIT direct rapid immunohistochemistry test dsDNA double stranded DNA DSMZ German Collection of Microorganisms and Cell Cultures DTT dithiothreitol DUVV Duvenhage virus EBLV-1 European bat lyssavirus, type 1 EBLV-2 European bat lyssavirus, type 2 ED50 50% end-point EDQM European Directorate for the Quality of Medicines EDTA ethylenediaminetetraacetic acid EIU equivalent international units ELISA enzyme-linked immunosorbent assay EM electron microscopy EMEM Eagle’s minimum essential medium EPAA European Partnership for Alternatives to Animal Testing ERA Evelyn Rokitniki Abelseth strain ERIG equine rabies immunoglobulin Laboratory techniques in rabies Fifth edition viii Abbreviations ESI electrospray ionization EtBr ethidium bromide EVAg European Virus Archive Global Fabs antigen-binding fragments FACS fluorescence-activated cell sorting FAVN fluorescent antibody virus neutralization test FBS fetal bovine serum FCA Freund’s Complete Adjuvant FCS fetal calf serum FFID fluorescent focus infectious dose FFPE formalin-fixed, paraffin-embedded FIA Freund’s Incomplete Adjuvant FIMT fluorescence inhibition microtest FISH fluorescent in situ hybridization FITC fluorescein isothiocyanate FPLC fast protein liquid chromatography FRET Fluorescence Resonance Energy Transfer FTA Flinders Technology Associates G glycoprotein GBLV Gannoruwa bat lyssavirus GFP green fluorescent protein GM genetically modified GMEM Glasgow Minimum Essential Medium GMP Good Manufacturing Practices gRNA genomic RNA HBO mercury luminance unforced cooling lamp HDCV human diploid cell vaccine H&E hematoxylin and eosin HEK human embryonic kidney HEP high egg passage strain HEPES hydroxyethyl piperazine ethane sulfonic acid HIV human immunodeficiency virus hn hemi-nested HPLC high-performance liquid chromatography HRIG human rabies immunoglobulin HRP horse radish peroxidase IAA iodoacetamide IACUC Institutional Animal Care and Use Program IBCMP integrated bite case management program IC (i.c.) intracerebral ICCVAM Interagency Coordinating Committee on the Validation of Alternative Methods Laboratory techniques in rabies Fifth edition ix Abbreviations ICH International Council for Harmonisation of Technical Require- ments for Pharmaceuticals for Human Use ICTV Inter national Committee on Taxonomy of Viruses IEF isoelectric focusing IFA indirect fluorescent antibody test IgG immunoglobulin G IgY immunoglobulin Y IMAC immobilized metal affinity chromatography IPTG Isopropyl-ß-D-1-thiogalactopyranoside ISH in situ hybridization IIA immunoperoxidase inhibition assay ICTV International Committee on the Taxonomy of Viruses IHC immunohistochemistry IFA indirect fluorescent antibody IIF indirect immunofluorescence IKOV Ikoma lyssavirus i.m. intramuscular i.p. intraperitoneal IPC in-process control IRIT indirect rapid immunohistochemistry test IRKV Irkut virus IS indicator serum ISH in situ hybridization IU international unit KHUV Khujand virus L " large " protein (i.e. the viral RNA-dependent polymerase) lacZ structural gene for ß-galactosidase LAMP loop-mediated isothermal amplification LB Luria-Bertani broth LBV Lagos bat virus LC liquid chromatography LD50 50% lethal dose LED light-emitting diode LEP low egg passage strain LFA lateral flow assay LFD lateral flow devices LIMC low and middle-income countries LLEBV Lleida bat lyssavirus M matrix protein MAb monoclonal antibody MALDI matrix-assisted laser desorption/ionization MCIE modified CIE Laboratory techniques in rabies Fifth edition x Abbreviations MEM modified Eagle’s medium MES 2-(N-morpholino) ethanesulfonic acid buffer MIT mouse inoculation test MLV murine leukaemia virus MNA murine neuroblastoma cell MNT mouse neutralization test MOI multiplicity of infection MOKV Mokola virus mRNA messenger RNA MS mass spectrometry MW molecular weight M/Z mass to charge ratio N nucleoprotein NA numerical aperture NAA nucleic acid amplification nAb neutralizing antibody nAChR nicotinic acetylcholine receptor NASBA nucleic acid sequence based amplification NBT nitro blue tetrazolium NC negative control NC nucleocapsid NCBI National Center for Biotechnology Information NDDR National Donor Referral Registry NGS next generation sequencing NIBSC National Institute for Biological Standards and Control NIH National Institutes of Health (USA) NMDA N-Methyl-D-aspartic acid NMRI Naval Medical Research Institute NS negative serum NSS non-specific staining NTC no template control OCT optimal cutting temperature OD optical density OMCL Official Medicine Control Laboratories OIE World Organisation for Animal Health ORF open reading frame P phosphoprotein PAHO Pan American Health Organization PAGE polyacrylamide gel electrophoresis PBL peripheral blood lymphocytes PBS phosphate buffered saline PC positive control Laboratory techniques in rabies Fifth edition xi Abbreviations PCEC purified chick embryo cell vaccine PCR polymerase chain reaction PEG polyethylene glycol PEI polyethyleneimine PEP post-exposure prophylaxis Ph Eur European Pharmacopeia pI isoelectric point PNA pseudotype neutralization assay PPE personal protective equipment PPHS passive public health surveillance PMF peptide mass fingerprinting PT proficiency test or testing PTFE polytetrafluoroethylene PTV pseudotyped viruses PV Pasteur virus PVRV purified vero cell rabies vaccine QA quality assurance QC quality control RABV rabies virus RER rough endoplasmic reticulum RF rheumatoid factors RFFIT rapid fluorescent focus inhibition test rG-F recombinant G truncated protein RIDT rapid immunochromatographic diagnostic test RITM Research Institute of Tropical Medicine RLU relative light unit RIG rabies immunoglobulin rN recombinant nucleoprotein RNA ribonucleic acid RNP ribonucleoprotein rP recombinant P protein RP relative potency RPMI Roswell Park Memorial Institute medium rRNA ribosomal RNA RS reference serum RTCIT rabies tissue culture infection test RT-LAMP reverse transcriptase loop-mediated isothermal amplification RT-PCR reverse transcriptase polymerase chain reaction RVNA rabies virus neutralizing antibodies SAD Street Alabama Dufferin strain scFv single-chain antibody fragment SD standard deviation Laboratory techniques in rabies Fifth edition xii Abbreviations SDS sodium dodecyl sulfate SE-HPLC size exclusion high-pressure liquid chromatography SFIMT simplified fluorescence inhibition microtest SHIBV Shimoni bat virus SMB suckling mouse brain SNP single nucleotide polymorphism SPA serological potency assay SPRI solid phase reversible immobilization [beads] SRIG standard rabies immunoglobulin SSC saline-sodium citrate ssRNA single stranded RNA SYBR Synergy Brand Taq thermostable DNA polymerase via bacterium (Thermus aquaticus) TBS tris-buffered saline T-DNA transfer DNA TC tissue culture TCID tissue culture infectious dose Thyb probe hybridization temperature TPBS Tween phosphate buffered saline TBE tris borate EDTA buffer TE tris EDTA buffer TEA triethanolamine TEM transmission electron microscopy TEMED N,N,N’,N’-tetramethylenediamine TLR3 Toll-like receptor-3 TOF time-of-flight TRIS tris(Hydroxymethyl)aminomethane TS samples such as sera or plasma to be tested TST Tris-buffered saline and Tween 20 USP United States Pharmacopeia UTR untranslated region UV ultraviolet VEP viral envelope protein VH heavy-chain variable regions VHH variable llama-derived heavy-chain antibody fragments VL light chain variable regions VNA virus-neutralizing antibody WCBV West Caucasian bat virus WHO World Health Organization WRS street rabies virus WTA whole-transcription amplification YM yeast minimal Laboratory techniques in rabies Fifth edition Part 5. Demonstration of viral nucleic acids and sequences Part 5. Demonstration of viral nucleic acids and sequences Laboratory techniques in rabies Fifth edition 1 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Introduction Next to techniques aimed at the detection of lyssavirus antigens, such as the direct fluorescent antibody test (DFAT; see Chapter 11), the direct rapid immuno- histochemistry test (DRIT; see Chapter 12), the rapid immunochromatographic test (RIDT; see Chapter 17), the rabies tissue culture infection test (RTCIT; see Chapter 9) and the mouse inoculation test (MIT; see Chapter 8) (1–5), methods based on the detection of lyssavirus nucleic acids are becoming more widely accepted for the diagnosis of rabies in quality-assured laboratories (6–8). Among such molecular techniques the polymerase chain reaction (PCR), developed in the 1980s (9) and first used for rabies diagnosis and typing in 1991 (10–11), has revolutionized diagnosis not only of rabies but also of many viral, bacterial, para- sitological and fungal pathogens. PCR is an in vitro laboratory technique used to detect, among others, target DNA sequences of infectious agents in tissues, as well as in secretions or excre- tions of infected animals and humans. It involves exponential amplification of the target using a thermostable DNA polymerase (Taq polymerase) using short oligo- nucleotide sequences called “primers” to select the portion of the genome to be amplified. Specific alternating temperature profiles of the sample are applied to help a DNA replication enzyme rapidly copy the target DNA sequence. Depen- ding on the interval between selected forward and reverse primers, PCR products (amplicons) of different sizes can afterwards be made visible by agarose gel electrophoresis. The use of PCR in lyssavirus diagnostics benefits also from the downstream application of Sanger sequencing to type the lyssavirus amplified in confirmed cases. Lyssaviruses are negative stranded RNA viruses (12). Therefore, before PCR amplification, the RNA is first reverse transcribed into complementary DNA (cDNA) using reverse transcription (RT), resulting in a variant of PCR referred to as reverse transcriptase polymerase chain reaction (RT-PCR). The amplification of lyssavirus RNA using RT-PCR can be achieved as either a one-step or a two-step reaction. While in the first approach, the entire reaction from cDNA synthesis to PCR ampli- fication takes place in a single tube, in the latter the reverse transcription reaction and PCR amplification are performed in separate tubes. There are advantages to both approaches. The one-step approach reduces the number of manipulations required, thereby reducing costs and risk of cross-contamination, whereas the two-step approach generates cDNA in the first step, which can then be available for parallel testing. The latter is particularly useful if only limited quantities of RNA are available and screening for multiple pathogens is required. Chapter 27 Conventional pan-lyssavirus reverse transcriptase polymerase chain reaction Laboratory techniques in rabies Fifth edition 2 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Various conventional gel-based RT-PCR protocols for the diagnostic detec- tion of rabies virus (RABV) and the generic detection of lyssaviruses have been published targeting the lyssavirus genes or intergenic regions resulting in ampli- cons of various sizes (6, 7). The sensitivity of gel-based RT-PCR amplification can be increased by second-round RT-PCR using internal annealing sites of either one (hemi-nested-PCR) or two (nested-PCR) primers or by using specific hybrid- izing probes in PCR-ELISA (8, 13–14). Since primers were selected from conserved regions of the genome, most assays amplify parts of the nucleoprotein (N) and polymerase (L) genes of lyssaviruses as earlier proposed (15, 16). Conventional lyssavirus species-specific or generic RT-PCRs can be used both for diagnostic purposes and for characterization of lyssaviruses (15). Preparatory work and procedures Samples and controls Diagnostic specimens subjected to testing by RT-PCR may include brain tissue (for diagnosis of human and animal rabies) and additionally skin biopsies, saliva and cerebrospinal fluid (CSF) for human rabies diagnosis. Particular care must be taken for the optimum selection, collection, shipment and storage of such biolog- ical specimens since they can impact the test results. The use of validated positive (PC) and negative (NC) controls or in-process controls is required and should be subjected to the same procedures as test samples. PCR NC (sometimes referred to as “no template control” or “NTC”) could either be water or uninfected brain material and confirms the absence of contamination during the PCR process. PCR PC from a known lyssavirus-positive brain tissue confirms that the PCR has worked in the event of the diagnostic samples being negative. Anomalous control results indicate a test failure possibly due to incorrect formulation of the reagents or a failure of equipment. Preferably, laboratory strains or non-autochthonous PCs (that do not occur in the region) should be used, so that sequence analysis can be used to rule out cross-contamination of the PC into the test samples. The PC must be used at a concentration 1 log higher than the known limit of detection of the PCR assay. Using very high levels of PC would prevent laboratories from detecting fluctuations/trends within the assay that could prevent lower viral loads from being detected, and will increase the risk of cross-contamination. Every new batch of PC must be tested and confirmed as fit for purpose. For example, labo- ratories could test a 10-fold serial dilution series of each new stock of PC RNA (ranging from 100 ng/µL to 1 fg/µL, 10–1–10–7) and calibrate the working concen- tration of RNA accordingly. RNA extraction Obtaining high-quality nucleic acid from the sample is the first and most impor- tant step for any molecular assay. Proper handling (e.g. on ice and using gloves) and use of RNase-free materials will prevent the introduction of RNase and eliminate degradation of RNA. Viral RNA from diagnostic specimens such as brain tissue, skin biopsies, saliva and CSF can be extracted by using commercial column- based extraction kits (e.g. RNeasy Mini Kit) or guanidinium isothiocyanate-phe- nol-chloroform-based extraction methods (e.g. TRIzol), following the manufac- Laboratory techniques in rabies Fifth edition 3 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences turer’s recommendations. An alternative approach employs paramagnetic beads with a nucleic acid binding surface that are used to bind RNA following lysis. Beads with bound RNA are captured on magnets and the supernatant containing cell debris and other contaminants is removed with washes. When using in-house or commercial nucleic acid extraction reagents, safety and sensitivity should be assessed locally. For skin biopsies, a preliminary step of lysis using proteinase-K is required before extraction (for example incubation, after dissociation with sterile scissors, at 37 °C for 3 h under gentle agitation in 180 µL of ALT tissue lysis buffer and 20 µL of proteinase K) (17). It is recommended to include a validation of the extraction step for each sample, based on the parallel detection of endogenous control, such as RNA from housekeeping gene (e.g. 18S ribosomal RNA or ß-actin), in one-step (running in parallel a specific RT-PCR assay) or two-step approach (see following point). The housekeeping PCR can be used to confirm the presence of RNA in samples derived from tissue with low cellular content. This validation provides confidence that a lyssavirus negative result by RT-PCR is a true negative and not the result of a failure of RNA extraction or a failure in the extraction process (18). In addition, host material can be analysed for species confirmation or co-evolutionary studies (e.g. mitochondrial cytochrome B analysis). An NC (water or non-infected tissue) must be included during the extraction step. However, the use of PC is not recommended during extraction, especially when endogenous controls are used, and to avoid any cross-contamination during this initial step. After extraction, store RNA samples at below −70 ºC until use. Because of the high sensitivity of any RT-PCR, great care must be taken to ensure that any contamination is excluded. Record all test details onto a worksheet to ensure traceability. Obtained RNA may be quantified if required. Dilution of RNA can be performed, if necessary and according to the assay which will be used. For the highly sensitive pan-lyssavirus N gene RT-PCR detailed below, the extracted RNA is diluted 1:10 before being quantified (e.g. by NanoDrop). The original RNA is then diluted to 1μg/μL. For the L gene protocol described below, dilution of RNA is not required, although a final quantity of 1.5 μg per reaction is preferable. Reverse transcription of viral RNA If a two-step RT-PCR is applied, synthesis of cDNA from the extracted viral RNA is required. In contrast to targeted RT using specific lyssavirus-derived primers, the cDNA generated using random hexamers can be used in various virus or host related downstream applications (Table 27.1). The cDNA can be stored at −20 ºC until required. This facilitates greater flexibility to detect a range of viral path- ogens and also enables detection of host housekeeping genes (18S ribosomal RNA or ß-actin, etc) to be employed to check the efficiency of the RNA extraction. A combination of specific lyssavirus RT primer (e.g. JW12) and random hexamers may also be used to reverse transcribe the RNA. Laboratory techniques in rabies Fifth edition 4 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Thermal cycler Commercial companies offer a complete range of thermal cyclers (also called PCR machines or DNA amplifiers) that meet the requirements of all applications. Some thermal cyclers provide multiple blocks in one housing unit (dual or three- block thermal cyclers), allowing several different PCR reactions to be carried out simultaneously. Heated lids prevent condensation of water from the reaction mixtures. Although the difference in performance of contemporary well-main- tained thermal cyclers is generally limited, a validation is recommended when changing the type of thermal cycler. In a rabies diagnostic laboratory, thermal cyclers should be calibrated and regularly serviced similar to other critical equip- ment such as pipettes for which accuracy/precision should also be qualified and routinely checked. In addition, storage equipment (refrigerators and freezers) must be monitored to detect out of range temperature levels and lapses in temperature that may affect sample or reagent quality. Calibration, servicing and temperature monitoring are mandatory if the test is accredited to ISO17025 standard. RT-PCR methodology This procedure describes the generic amplification of lyssavirus RNA or cDNA for both diagnostic and research purposes, using two examples of hemi-nested RT-PCR (hnRT-PCR). The first assay targets the N gene and is modified from a published protocol (13). The universal primers JW12 (forward) and JW6UNI (reverse) of the pan-lyssavirus RT-PCR detect a 606 base pair (bp) region of the N gene from all ICTV (Inter- national Committee on Taxonomy of Virusus) recognized and novel lyssavirus species in the first round PCR. The reverse primers JW10UNI, which lie within the sequence of the first round PCR product, are used in conjunction with the first- round primer JW12 in the second round of the hnRT-PCR (Fig. 27.1, Table 27.1). Molecular grade water needs to be added to a final volume of 50 µL. Primer Direction Sequence (5’- 3’) Positiona Details JW12 F ATGTAACACCYCTACAATG 55–73 7.5 pmol/µL (first round) 3.5 pmol/µL (second round) JW6 UNI R ARTTVGCRCACATYTTRTG 660–641 7.5 pmol/µL (first round) JW 10 UNI R GTCATYARWGTRTGRTGYTC 636–617 3.5 pmol/µL (second round) a Position according to the reference Pasteur virus genome (M13125) F, forward; R, reverse; RT-PCR, reverse transcriptase polymerase chain reaction Table 27.1. Primers used in the N gene hemi-nested pan-lyssavirus RT-PCR Laboratory techniques in rabies Fifth edition 5 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences The second assay targets a conserved region among block III of the L gene (16) and has been previously validated for the postmortem and antemortem diag- nosis of human rabies on one of the largest cohorts of rabid patients (17). The first round is performed using the primers PVO5m (forward) and PVO9 (reverse), which amplify a 319 bp amplicon, whereas the second round uses the same forward primer (PVO5m) and the reverse primer PVO8, leading to a final amplification of a 249 pb region (Table 27.2). As previously indicated, it is strongly recommended to perform a parallel assay for the detection of the partial ß-actin mRNA in each sample (amplicon of 488 bp), to assess the quality of the RNA template and to validate the extraction process, using primers b-Taq1 and b-Taq2 (Table 27.2 (19)). Fig. 27.1. Schematic diagram of the lyssavirus genome and the region targeted by the N gene pan-lyssavirus hemi-nested RT-PCR primers (see Table 27.1) Target Primer Direction Sequence (5’- 3’) Position Quantity per reaction L gene PVO5m F ATGACAGACAAYYTGAACAA 7170a 10 pmol (first and second round) L gene PVO9 R TGACCATTCCARCARGTNG 7489a 10 pmol (first round) L gene PVO8 R GGTCTGATCTRTCWGARYAATA 7419a 10 pmol (second round) ß-actin b-Taq1 F TCACCCACACTGTGCCCATCTACGA 2206b 10 pmol ß-actin b-Taq2 R CAGCGGAACCGCTCATTGCCAATGG 2500b 10 pmol a Position according to the reference Pasteur virus genome (M13125) b Position according to the human ß-actin gene (E00829) F, forward; R, reverse; RT-PCR, reverse transcriptase polymerase chain reaction Table 27.2. Primers used in the hemi-nested pan-lyssavirus RT-PCR targeted L gene and the endogenous control ß-actin mRNA Laboratory techniques in rabies Fifth edition 6 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences For PCR, different “ready to use” commercial kits are available, although reagents can also be purchased separately. For this chapter the kits and methods detailed below have been validated, although in-house validation should be completed before using the assay on diagnostic samples. Alternative reagents and kits are available and can be used after appropriate validation to ensure optimal sensitivity and specificity. Sequence analysis should be used to further confirm the specificity of the PCR products. Preferably, a four-room system, e.g. clean room (master mix), template room (addition of RNA template), PCR room (thermal cycling) and amplicon room (gel electrophoresis), should be used to avoid cross-contamination. 1. N gene hnRT-PCR First round RT-PCR (JW6UNI/JW12) In the clean room 1. Wipe bench or surface of PCR cabinet/workstation with an appropriate disin- fectant prior to use. If available, switch on the ultraviolet (UV) light for 10 min. Obtain the required test reagents from the –20 °C freezer. Ensure the enzyme mix is kept on ice. The remaining reagents can be thawed at room temperature. 2. Put the required number of 0.2 mL tubes in a rack and label the tubes clearly with sample identification and denote this is the first-round reaction by labelling (e.g. with “6/12”). Label the PCR negative (e.g. as “NC”) or “NTC” (no template control) and the PCR positive control (e.g. as “PC”) or “CVS”, challenge virus strain (i.e. CVS RNA that is known to be positive). 3. Prepare a JW6UNI/JW12 reaction master mix using the One Step RT-PCR kit (Qiagen; Catalogue number 210212) (Table 27.2). Keep all reagents on ice, thaw and vortex before using. An NC (without template RNA) and a PC must be included in every test run. Allow for pipetting variation by preparing a sufficient volume of master mix at least one reaction greater than required. 4. Vortex the prepared master mix thoroughly, centrifuge and dispense 49 µL into each of the 0.2 ml tubes. Close the lids. 5. Transfer the sealed tubes to the ice/cool block in the template room on a dispos- able tray. Once a tray has been removed it must not be returned to the clean room without decontamination using an appropriate disinfectant. In the template room – addition of template 1. Wipe bench top with an appropriate disinfectant prior to use. 2. Thaw samples and control RNA (PC and NC) on ice. 3. Add 1 µL of test RNA (e.g. at concentration of 1 µg/µL for TRIzol extracted samples) below the surface of its allocated master mix tube and mix gently. Discard the tip directly into a pot containing cleaning agent (e.g. Decon90) after use to minimize cross-contamination. Repeat this process until all samples and controls have been added to their allocated tubes. 4. Press the lids down by hand and seal firmly. Laboratory techniques in rabies Fifth edition 7 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 5. Transfer the sealed tubes to the PCR machine and cycle as detailed (Table  27.3). In-house validation of cycling parameters is essential to ensure optimisation for local PCR machines. Reagent Volume per reaction (µL) Molecular grade water 29.0 5× buffer 10.0 dNTPs (10 mmol) 2.0 JW12 (7.5 pmol/µL) 3.0 JW6UNI (7.5 pmol/µL) 3.0 One-step RT-PCR enzyme mix 2.0 Total 49 RT-PCR, reverse transcriptase polymerase chain reaction Table 27.3. First-round JW6UNI/JW12 reagent master mix (using [Qiagen] One Step RT-PCR kit) Second-round RT-PCR (JW10UNI/JW12) Where no amplicon is generated on the first-round reaction, a second-round, hemi-nested reaction should be performed. This will provide further confidence in a negative result. The second-round assay may also be employed to increase the specificity of the assay. In the clean room 1. Wipe the bench with an appropriate disinfectant prior to use, then prepare the PCR workstation by opening the doors and wipin the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate cleaning agent), suitable pipette and tips within the station and close the doors. If available, switch on the UV light for 10 min. 2. Obtain the required reagents from the –20°C freezer and thaw at room temper- ature. 3. Put the required number of 0.2 mL tubes in a rack and label the tubes clearly with sample identification and denote that this is the second-round reaction by labelling (e.g. “10/12”). Label the PCR negative as “NC2” or “NTC2”. This addi- tional NC must be included in every second round PCR experiment to confirm the master mix is not contaminated. 4. Prepare a JW10UNI/JW12 reaction master mix using the HotStarTaq kit [Qiagen] as detailed [see catalogue number 203443] as detailed (Table 27.4). 5. Thaw and vortex all reagents before using. Allow for pipetting variation by preparing a volume of master mix at least one reaction greater than required. Laboratory techniques in rabies Fifth edition 8 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 6. Vortex the prepared master mix thoroughly, centrifuge and dispense 49 µL into each of the 0.2 mL tubes. Seal the tubes. 7. Transfer the sealed tubes to the template room on a disposable tray. Once a tray has been removed it must not be returned to the clean room without decontamination using an appropriate disinfectant. Temperature Time Cycles 50 °C 30 min 1 95 °C 15 min 1 94 °C 30 s 45 45 °C 45 s 50 °C 15 s 72 °C 1 min 72 °C 7 min 1 4 °C ∞ n/a RT-PCR, reverse transcriptase polymerase chain reaction Table 27.4. Hemi-nested RT-PCR first round cycling parameters In the template room – addition of template 1. To reduce cross-contamination, the template may be added within a PCR workstation. 2. To prepare, open the doors of the PCR workstation and wipe the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate cleaning agent, suitable pipette and tips within the station and close the doors. Switch on the UV light for 10 min. 3. Add 1 µL of first-round PCR product below the surface of the prepared second round master mix to minimize aerosols, then mix gently. Discard the tip directly into an appropriate cleaning agent after use. Ensure the lid of the PCR tube is sealed firmly. Repeat this step until all first-round PCR products and the second-round NTC have been added to its allocated second-round master mix tube. Change gloves regularly and at suitable points to avoid cross-contami- nation. 4. If using the PCR workstation, after removing the samples from the cabinet, empty the ice, remove the disinfectant pot, then switch on the UV light for 10 min. Record the required detail in the relevant PCR workstation workbook. Laboratory techniques in rabies Fifth edition 9 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 5. Cycle on the PCR machine using the following second round cycling param- eters (Table 27.5). In-house validation of cycling parameters is essential to ensure optimization for local PCR machines. Note: Batch master mixes can be prepared so that ready-made mixes are avai- lable for hnRT-PCR reactions. These batches can be quality controlled when prepared, allowing for better quality assurance and standardization. This is the routine way of preparing master mixes for diagnostic purposes. These master mixes are stable for at least 1 year when stored appropriately at −20 ˚C. Reagent Volume per reaction (µL) Molecular grade water 22.0 HotStarTaq master mix (2×) 25.0 JW12 (3.5 pmol/µL) 1.0 JW10UNI (3.5 pmol/µL) 1.0 Total 49 Table 27.5. Second-round JW10UNI/JW12 master mix (using [Qiagen] HotStarTaq kit) Analyses of RT-PCR products by electrophoresis on agarose gels Nucleic acids are negatively charged and can be separated on the basis of size in an agarose gel under the influence of an electric current. Historically, ethidium bromide (EtBr) has been used to stain nucleic acids in agarose gels and detection under UV light. More recently, the safer SYBR-based options have been preferred over the use of the carcinogen EtBr. • Prepare a 1% agarose gel. Add Et Br (final concentration 0.01%) or alterna- tively 5 µL of SYBR Safe solution [Life Technologies Ltd] per 100 mL of gel. • Pour gel into the cast, select a suitably-sized well former (comb), according to the volume of sample being loaded and the number of wells required, and place into the cast before the gel sets. Leave the gel to solidify for at least 30 min. • DNA size markers (1 kb or 100 bp ladder) are diluted in TE or TBE buffer and 50 μL aliquots are stored in a −20 °C freezer. These DNA size markers must be mixed with loading buffer prior to loading. Generally, 5 μL of ladder is used. • To enable loading of a PCR product (DNA sample) it must be mixed with a suit- able volume of gel loading buffer, e.g. blue/orange 6x. For diagnostic purposes, 5 µL of PCR product and 1 µL of loading dye is generally used per sample. • Load the samples and DNA marker into the wells and separate the samples for approximately 45 min–1 h (120 volts). • Remove the gel and allow excess buffer to drain off. Place the gel in a tray and carry over to the UV transilluminator. • A positive PCR result is observed in the form of a bright band of the expected size of 606 bp (first round) and 582 bp (second round). Laboratory techniques in rabies Fifth edition 10 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 2. L gene hnRT-PCR As the overall process for this technique remains mostly similar to the N gene-based hnRT-PCR previously described and to the general considerations requested when performing PCR (20), only specific parameters inherent to this technique will be described in this section, as well as major variations or modifi- cation steps, such as the reverse transcription of this two-step technique. In each series, positive (positive RNA) and negative controls (negative RNA and/or RNase- DNase free water) should be included. Reverse transcription step A total of 6 μL of extracted RNA is used for cDNA synthesis and add to the first mix reaction described in Table 27.6. A pre-incubation of RNA template with pd(N)6 random primers is performed for 10 min at 65 °C in a heat-block, following with an incubation for 90 min at 42 °C in a heat-block after addition of the second mix solution (Table 27.6). Temperature Time Cycles 95 °C 15 min 1 94 °C 30 s 35 45 °C 10 s 50 °C 15 s 72 °C 1 min 72 °C 7 min 1 4 °C ∞ n/a RT-PCR, reverse transcriptase polymerase chain reaction Table 27.6. Hemi-nested RT-PCR second-round cycling parameters Mix preparations and cycling parameters This technique is relatively simple because the mix preparation is similar for both rounds of PCR used for lyssaviruses detection as well as for the PCR dedi- cated to the detection of the endogenous control ß-actin mRNA (with the excep- tion of the primers used) (Table 27.7). In addition, cycling parameters are also identical for all these PCR (Tables 27.8–9). Similarly to each step of the process, positive (positive RNA) and negative (negative cDNA and/or RNase–DNase-free water) should be included in each series and each round of PCR. Revelation of the amplification products after PCR is done by electrophoresis on agarose gels as previously described. Laboratory techniques in rabies Fifth edition 11 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Step Reagent Volume per reaction (µL) Mix 1: pre-incubation (10 minutes at 65°C) pd(N)6 random primers (200 µg/mL) [Roche Diagnostics] 2 RNase-DNase free water 2 RNA template 6 Total 10 Mix 2: incubation (90 minutes at 42 °C) 5X first-strand buffer (Invitrogen, provided with the reverse transcriptase) 6 0.1 mol DTT (Invitrogen, provided with the reverse transcriptase) 2 dNTP mix (10 mmol) [Eurobio] 2 RNasin (40U/µL) [Promega] 2 Superscript II RT (200 U/μL) (Invitrogen) 1 RNase-DNase free water 7 Total 20 Final volume 30 Table 27.7. Reverse transcription mix for the L gene-based hnRT-PCR Reagent Volume per reaction (µL) 10X PCR buffer II (provided with the Taq polymerase) 5 MgCl2 (25 mmol) (provided with the Taq polymerase) 2.5 dNTP Mix (10 mmol) (provided with the Taq polymerase) 1 Forward primera (10 μmol) 1 Reverse primera (10 μmol) 1 AmpliTaq DNA Polymeraseb (5 U/μL) [Applied Biosystems] 0.4 RNase–DNase-free water 37.1 Total 48 Table 27.8. L gene-based hnRT-PCR mix preparations a The primers used are PVO5m (forward)/POV9 (reverse) and PVO5m (forward)/PVO8 (reverse) for the first and the second rounds of PCR for lyssavirus detection, respectively, and b-taq 1/b-taq2 for -actin mRNA detection. b The enzyme can also be replaced by BioTaq DNA Polymerase [Bioline], after adjusting the volume of enzyme to 0.2 µL and the volume of MgCl2 to 1.25 µL. Laboratory techniques in rabies Fifth edition 12 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences Discussion Various lyssavirus species-specific and generic RT-PCRs have their merit for the specific purpose they were developed (6–8). This chapter describes two examples of conventional gel-based pan-lyssavirus hemi-nested RT-PCR assays with primers that target the N gene or L gene. The N gene Hn RT-PCR is one of the most widely used and has been validated to detect all recognized and putative lyssavirus species known to exist to-date at an annealing temperature of 45 ºC  (13, 21–23). Any alteration of annealing temperature may cause detection of the rare phylogroup 2 or 3 lyssaviruses to be impaired (24). Furthermore, this generic gel-based RT-PCR (13) gave the most accurate results in an international ring trial compared to other published conventional lyssavirus PCRs included in the study (25). Both assays have successfully detected all RABV isolates and other lyssavirus species tested in the framework of animal rabies diagnosis activity in a national and WHO collaborating centre for rabies, haven proven efficacy for ante-mortem and post mortem human rabies diagnosis and have performed well in successive international proficiency tests (6, 8, 26). Despite the highest level of sensitivity and their ever increasing important role in many countries, the use of molecular assays, including RT-PCR, for routine post- mortem diagnosis of lyssaviruses is currently not recommended if brain tissue is available, especially for animal rabies (27, 28). Without standardization, very strin- gent quality control and sufficient experience and expertise such tests run the risk of high levels of false positive or false negative results (29). Nevertheless, if strict quality control procedures are applied those techniques can be used for epidemiological surveys in wildlife. In such a case, however, a positive RT-PCR result preferably requires a positive result in one of the routine diagnostic tests (DFAT, RTCIT) if it is to be officially declared to the OIE, particu- larly in a previously “rabies-free” region or host. Cycling step Temperature Time Number of cycles Initial denaturation 94 °C 3 minutes 1 Amplification 94 °C 30 seconds 3556 °C 45 seconds 72 °C 40 seconds Final elongation 72 °C 3 minutes 1 Pending 16 °C ∞ n/a Table 27.9. L gene-based hnRT-PCR cycling parameters Laboratory techniques in rabies Fifth edition 13 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences However, RT-PCR is commonly applied for postmortem and in particular ante- mortem diagnosis of human rabies (6, 8, 28). However, negative results do not rule out infection, especially for excretions (virus intermittently shed) or for atypical or paralytic forms of rabies for which the sensitivity remains lower than for the clas- sical encephalitic form (28). In the event of routine diagnostic tests (DFAT, RTCIT) being inapplicable or inappropriate, RT-PCR may be used for diagnostic purposes. In particular, when the quality of the material submitted is suboptimal, RT-PCR has been shown to superior to the conventional assays (30). In confirmed cases, RT-PCR is useful as an additional diagnostic tool for virus characterization to determine the source of infection and molecular phylogeny (29). However, only sufficiently validated RT-PCR in terms of sensitivity (genome copies), specificity, repeatability and robustness should be applied. Considering ongoing and future developments, the quality of commercial column-based RNA extraction and RT-PCR kits should be frequently checked to allow for highest sensitivity of the gel-based RT-PCR, and verification of the ability of detection of any new lyssavirus species should be recommended, if possible. Quality control procedures should include strict precautions to avoid carryover contaminations as described (20) and to verify the intrinsic performance of the assay. In this way, participation to international proficiency tests is highly recom- mended. However, hemi- and nested RT-PCRs are especially prone to the risk of carryover or cross-contamination. To ensure confidence in positive diagnostic results, subsequent analysis by Sanger sequencing is recommended. There- fore, and whenever possible, it is also advisable to employ RT-qPCR for routine screening of samples, which considerably reduces the risks of cross contamina- tion. Laboratory techniques in rabies Fifth edition 14 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences References 1. Dean DJ, Abelseth MK, Athanasiu P. The fluorescence antibody test In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:88–93. 2. Koprowski H. The mouse inoculation test. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:80–6. 3. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emerg Infect Dis. 2006;12:310–3. 4. Kang B, Oh J, Lee C, Park BK, Park Y, Hong K, et al. Evaluation of a rapid immunodiagnostic test kit for rabies virus. J Virol Methods. 2007;145:30–6. 5. Webster WA, Casey GA. Virus isolation in neuroblastoma cell culture. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:93–104. 6. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. 7. Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, et al. Rabies – epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51. 8. Dacheux L, Wacharapluesadee S, Hemachudha T, Meslin FX, Buchy P, Reynes JM, et al. More accurate insight into the incidence of human rabies in developing countries through validated laboratory techniques. PLoS Negl Trop Dis. 2010;4:e765. 9. Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol. 1986;51 Pt 1:263-–3. PMID:3472723. 10. Smith JS, Fishbein DB, Rupprecht CE, Clark K. Unexplained rabies in three immigrants in the United States. A virologic investigation. NEJM. 1991;324:205-11. 11. Sacramento D, Bourhy H, Tordo N. PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol Cell Probes. 1991;5:229–40. PMID:1714538. 12. Dietzgen RG, Calisher CH, Kurath G, Kuzmin IV, Rodriguez LL, Stone DM. Family Rhabdoviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, editors. Virus taxonomy : classification and nomenclature of viruses - Ninth Report of the International Committee on Taxonomy of Viruses. San Diego: Elsevier; 2012:686–713. 13. Heaton PR, Johnstone P, McElhinney LM, Cowley R, O’Sullivan E, Whitby JE. Heminested PCR assay for detection of six genotypes of rabies and rabies- related viruses. J Clin Microbiol. 1997;35:2762–6. PMID:9350729. Laboratory techniques in rabies Fifth edition 15 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 14. Heaton PR, McElhinney LM, Lowings JP. Detection and identification of rabies and rabies-related viruses using rapid-cycle PCR. J Virol Methods. 1999;81:63–9. 15. Tordo N, Sacramento D, Bourhy H. The polymerase chain reaction (PCR) technique for diagnosis, typing and epidemiological studies. In: Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:157–70. 16. Bourhy H, Cowley JA, Larrous F, Holmes EC, Walker PJ. Phylogenetic relationships among rhabdoviruses inferred using the L polymerase gene. J Gen Virol. 2005;86(Pt 10):2849–58. 17. Dacheux L, Reynes JM, Buchy P, Sivuth O, Diop BM, Rousset D, et al. A reliable diagnosis of human rabies based on analysis of skin biopsy specimens. Clin Infect Dis. 2008;47:1410–7. 18. Smith J, McElhinney LM, Heaton PR, Black EM, Lowings JP. Assessment of template quality by the incorporation of an internal control into a RT-PCR for the detection of rabies and rabies-related viruses. J Virol Methods. 2000;84:107–15. PMID:10680960. 19. du Breuil RM, Patel JM, Mendelow BV. Quantitation of beta-actin-specific mRNA transcripts using xeno-competitive PCR. PCR Methods Appl. 1993;3:57– 9. 20. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature. 1989;339:237– 8. doi:10.1038/339237a0. 21. Johnson N, Selden D, Parsons G, Fooks AR. European bat lyssavirus type 2 in a bat found in Lancashire. Vet Rec. 2002;151:455–6. 22. Müller T, Johnson N, Freuling CM, Fooks AR, Selhorst T, Vos A. Epidemiology of bat rabies in Germany. Arch Virol. 2007;152:273–88. 23. Freuling CM, Beer M, Conraths FJ, Finke S, Hoffmann B, Keller B, et al. Novel lyssavirus in Natterer’s Bat, Germany. Emerg Infect Dis. 2011;17(8):1519–22. doi:10.3201/eid1708.110201. 24. Marston DA, Horton DL, Ngeleja C, Hampson K, McElhinney LM, Banyard AC, et al. Ikoma Lyssavirus, Highly Divergent Novel Lyssavirus in an African Civet. Emerg Infect Dis. 2012;18(4):664–7. doi:10.3201/eid1804.111553. 25. Fischer M, Wernike K, Freuling CM, Müller T, Aylan O, Brochier B, et al. A step forward in molecular diagnostics of lyssaviruses – results of a ring trial among European laboratories. PLoS ONE. 2013;8:e58372. doi:10.1371/journal. pone.0058372. 26. Robardet E, Picard-Meyer E, Andrieu S, Servat A, Cliquet F. International interlaboratory trials on rabies diagnosis: an overview of results and variation in reference diagnosis techniques (fluorescent antibody test, rabies tissue culture infection test, mouse inoculation test) and molecular biology techniques. J Virol Methods. 2011;177:15–25. doi:10.1016/j.jviromet.2011.06.004. Laboratory techniques in rabies Fifth edition 16 Pan-lyssavirus reverse transcriptase polymerase chain reaction Part 5. Demonstration of viral nucleic acids and sequences 27. WHO Expert Consultation on Rabies, first report. Geneva: World Health Organization; 2005 (WHO Technical Report Series, No. 931 (https://www.who. int/rabies/trs931_%2006_05.pdf). 28. WHO Expert Consultation on Rabies, second report. Geneva: World Health Organization; 2013 (WHO Technical Report Series, No. 982 (https://apps.who. int/iris/bitstream/handle/10665/85346/9789240690943_eng.pdf). 29. Rabies. In: OIE Manual of diagnostic tests and vaccines for terrestrial animals, 6th edition. Paris: World Organisation for Animal Health (OIE); 2013:307–8. 30. McElhinney LM, Marston DA, Brookes SM, Fooks AR. Effects of carcase decomposition on rabies virus infectivity and detection. J Virol Methods. 2014;207:110–3. Laboratory techniques in rabies Fifth edition 17 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Chapter 28 Rabies real-time reverse transcriptase polymerase chain reaction Introduction Nucleic acid-based detection of rabies viruses (and other lyssaviruses) is now routinely employed in diagnostic laboratories. Validated assays including conven- tional (gel-based) reverse transcriptase polymerase chain reaction (RT-PCR; see Chapter 27) and real-time RT-PCR have long been established in quality-assured settings. In contrast to conventional RT-PCR, the real-time assay combines the amplification and detection within a closed tube system; thus, real-time PCR plat- forms offer a more rapid and reliable indication of the presence of lyssavirus RNA in suspect samples. The thermal cyclers detect the fluorescence emitted by the exponentially increasing amplicon (PCR product). Two approaches to detect the amplicons are commonly employed, the choice of which will depend upon the requirements of the diagnostic or surveillance system. One approach is to add a DNA intercalating dye (fluorochrome) to the reaction mix. Intercalating fluorochromes (such as SYBR Green or ResoLight) bind to double-stranded (ds) DNA during PCR. Bound fluorochromes emit fluores- cence which is detectable by the thermal cycler at each cycle, thus allowing DNA concentrations to be quantified. Because such dyes may also bind to nonspecific PCR products, a melting curve analysis must be undertaken at the end of the programme to confirm the specificity of the test result. The second approach utilizes hydrolysis probes (such as TaqMan probes). These probes make use of the Fluorescence Resonance Energy Transfer (FRET) whereby a quencher molecule at the 3’-end of the specifically designed oligo- nucleotide probe quenches the fluorescence emitted by the fluorophore cova- lently attached to the 5’-end. As long as the fluorophore and the quencher are in proximity, quenching inhibits any fluorescence signals which would otherwise be excited by the thermal cycler’s light source. When the probe binds to its target region during amplification, the exonuclease activity of the polymerase leads to the dissociation of fluorophore and quencher, allowing the resulting fluorescence to be emitted and measured. Several quenchers and fluorophores are available and should be selected based on the thermal cycler’s specifications. Although the probe system is inherently more specific than intercalating dyes, designing a probe which can detect all lyssaviruses within the small amplicon can be challen- ging. In comparison with conventional PCR assays, both approaches to real-time PCR are closed tube systems, thus reducing the possibility of cross-contamina- tion and false–positive results. The real-time PCR assays are usually more rapid due to the smaller amplicon sizes and eliminate the need for gel electrophoresis confirmation or subsequent rounds of amplification. When test samples are run alongside a serial dilution of positive control RNA, the amount of viral RNA present Laboratory techniques in rabies Fifth edition 18 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences in a sample can be quantitated. The probe-based assays also enable multiple target detection and virus typing, if using specific and appropriate probes coupled to different fluorophores. Many real-time RT-PCR assays have been reported for lyssavirus detection, some of which were selectively developed for the individual virus strain or virus lineage (1), while others were developed to detect a wider range of rabies strains and/or lyssavirus species (2–6). All published assays will have limitations as regards their diagnostic range due to the restricted field samples available when validating the assays. Therefore, it is essential to consider the lyssavirus lineages and strains in each region when establishing this methodology. Indeed, emerging or novel virus strains may render the highly specific probe-based assays ineffec- tive (7–9). The choice of the SYBR Green versus the probe RT-PCR will depend on the intended application. For a laboratory conducting surveillance on brain material and expecting high numbers of negative samples, the use of the cheaper SYBR Green real-time PCR would be recommended. The SYBR Green approach would also be optimal when conducting scanning surveillance where novel or divergent lyssaviruses may be present which would otherwise be undetected by restricted probe-based assays. Whereas the more specific and sensitive probe- based assays may be preferable in a laboratory, conducting lyssavirus diagnosis on suspect samples which are expected to have a restricted lyssavirus species range and contain low viral loads may require rapid typing. This chapter describes two pan-lyssavirus real-time RT-PCR assays. The first approach is the SYBR Green assay, a well-established and broadly applicable quantitative real-time PCR which employs SYBR Green and the pan-lyssavirus nucleoprotein (N) gene primers, JW12 and N165-146. These primers were first designed and validated for a differential TaqMan-based assay, then subsequently utilized in a SYBR Green assay (2, 10). The second real-time PCR assay is the multi- plex probe based LN34 assay, which uses a combination of degenerate primers and probes to achieve high sensitivity and specificity (4). Both assays have been shown to detect a wide range of RABV variants and other lyssaviruses (2, 4, 10, 11) and both have been successfully applied for both antemortem and postmortem diagnosis. Methods Viral RNA extraction Extract the RNA following the instructions given in Chapter 27 on conven- tional gel-based PCRs and store RNA samples at −80 °C until use. As previously covered for conventional PCR and due to the high sensitivity of the real-time PCR, great care must be taken to ensure that any cross-contamination is excluded. Validation of the extraction step may be performed by using exogenous controls (e.g. synthetic eGFP RNA) spiked directly into each sample during the early phase (i.e. after addition of TRIzol) or by detecting host nucleic acid via a housekeeping assay (Table 28.1). Laboratory techniques in rabies Fifth edition 19 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences   P C R a ss ay P rim er /P ro be S eq ue nc e (5 ’- 3’ ) P os iti on a R ef er en ce SYBR® Green pan- lyssavirus N -g en e P C R JW 12 AT G TA A C A C C Y C TA C A AT G 55 -7 3 Th is c ha pt er ; ( 10 ) N 16 5- 14 6 G C A G G G TA Y TT R TA C TC AT A 16 5- 14 6 L- ge ne P C R P an -L ys sa -7 53 1F TT C TT C G C TY TR AT G TC W TG G A A 70 74 -7 09 6 (1 5) P an -L ys sa -7 74 9R AT G R TT G TT C C A C TT Y TC AT A R TC 72 92 -7 26 9 N -g en e P C R R V- Q -R T- P A C G C TT A A C A A C M A R AY C 1- 18 (1 4) R V- N P -Q -F or w ar d C A A G AT G TG TG C YA AY TG G A G 64 4- 66 3 R V- N P -Q -R ev er se A G C C C TG G TT C G A A C AT TC T 88 1- 90 0 L- ge ne P C R Ta q5 lo ng fo rw ar d TA TG A G A A AT G G A A C A AY C AY C A 72 72 –7 29 4 (5 ) Ta q1 6r ev lo ng re ve rs e G AT TT TT G A A A G A A C TC AT G K G TY C 73 66 –7 39 0 Pan-lyssavirus probe-based assays LN 34 c P ro be L N 34 b FA M -A A +C +A C C Y +C +T +A C A +A +T G G A -B H Q 1 59 - 7 5 Th is c ha pt er ; ( 4) P ro be L N 34 la go b FA M -A A + C + A C TA + C + T +A C A + A + TG G A -B H Q 1 59 - 7 5 P rim er fo rw ar d1 A C G C TT A A C A A C C A G AT C A A A G A A 1 - 24 P rim er fo rw ar d2 A C G C TT A A C A A C A A A AT C A D A G A A G 1 - 25 P rim er re ve rs e C M G G G TA Y TT R TA Y TC AT AY TG R TC 14 0 - 16 4 R 13 M P JW 12 AT G TA A C A C C Y C TA C A AT G 55 -7 3 (2 ) m od ifi ed N 16 5- 14 6 G C A G G G TA Y TT R TA C TC AT A 16 5- 14 6 Ly sG T1 -F A M FA M -A C A A G AT TG TA TT C A A A G TC A AT A AT C A G -B H Q 1 81 -1 09 Ly sG T5 -H EX H EX -A A C A R G G TT G TT TT YA A G G TC C AT A A -B H Q 1 80 -1 05 Ly sG T6 -C y5 C y5 -A C A R A AT TG TC TT C A A R G TC C AT A AT C A G -B H Q 3 81 -1 09 B B LV -1 TE X TE X- C TC TG A C A A G AT TG TC TT C A A A G TC -B H Q 2 76 -1 01 Lyssavirus-specific probe-based assays R 14 M P R A B V R V- N -1 96 -F G AT C C TG AT G AY G TA TG TT C C TA 26 6- 28 8 (8 ) R V- N -2 83 -R R G AT TC C G TA G C TR G TC C A 35 3- 33 5 R ab G T1 -B -F A M FA M -C A G C A AT G C A G TT Y TT TG A G G G G A C -B H Q 1 29 7- 32 1 R 14 M P E B LV -1 EB LV 1- 35 3F G C TC A A A C R G G A G G TC A A G A 43 1- 45 0 (1 5) EB LV 1- 44 0R A G A C A R A G A A G A A G TC C W A C C A 51 0- 48 9 EB LV 1- 39 2H EX H EX -A C C C TA C R A C A C C TG A A C AT G C AT C T- B H Q 1 46 2- 48 7 R 14 M P E B LV -2 EB LV 2- 42 F R G TG TC TG TA A A R C C A G A A G 11 2- 13 1 (1 6) m od ifi ed EB LV 2- 17 3R G A C A G A AT R G A C TT AT A A G C TC T 24 3- 22 1 EB LV 2 N P ro be C y5 -T C G G A A A A A A C C C A G C AT A A C C C T- B H Q 2 17 5- 19 8 R 14 M P B B LV B B LV -2 F C C TT G G TR A A C AT TC A G A G A A C G 39 0- 41 2 (1 7) m od ifi ed B B LV -2 R G G C C A C A G TT G G AT C C C TT G 47 5- 45 6 B B LV -2 TE X_ as TE X- TC C TC C G G TC A A G G C C C A R TT G C C -B H Q 2 42 2- 44 5 Ta bl e 28 .1 . P C R a ss ay s an d th ei r r el at iv e pr im er a nd p ro be p os iti on s Laboratory techniques in rabies Fifth edition 20 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences P an -R A B V Ta q3 lo ng P rim er fo rw ar d AT G A G A A G TG G A AY A AY C AT C A 72 73 –7 29 4 (5 ) Ta q1 7r ev lo ng P rim er re ve rs e G AT C TG TC TG A AT A AT A G AY C C A R G 73 90 –7 41 4 R A B V4 P ro be FA M -A A C A C Y TG AT C B A G K A C A G A R A AY A C AT C -T A M R A 73 14 –7 34 2 R A B V5 P ro be FA M -A G R G TG TT TT C YA G R A C W C AY G A G TT TT TY C A -T A M R A 73 53 –7 38 4 Internal controls eG FP EG FP 1- F G A C C A C TA C C A G C A G A A C A C (5 , 1 8) EG FP 2- R G A A C TC C A G C A G G A C C AT G EG FP -P ro be 1 FA M -A G C A C C C A G TC C G C C C TG A G C A -B H Q 1 ß- ac tin S Y B R ® G re en pr im er s B at R at in tr on ic C G A -T G A -A G A -T C A -A G A -T C A -T TG Th is c ha pt er ; ( 2, 1 0) B at R at re ve rs e A A G -C AT -T TG -C G G -T G G -A C ß- ac tin A C T- 10 05 -F C A G C A C A AT G A A G AT C A A G AT C AT C (1 9) A C T- 11 35 -R C G G A C TC AT C G TA C TC C TG C TT A C T- 10 81 -H EX H EX -T C G C TG TC C A C C TT C C A G C A G AT G T- B H Q 1 ß- ac tin ß- ac tin p ro be (H EX )- TC C A C C TT C C A G C A G AT G TG G AT C A -( B H Q 1) Th is c ha pt er ; ( 4) ß- ac tin fo rw ar d C G AT G A A G AT C A A G AT C AT TG C ß- ac tin re ve rs e A A G C AT TT G C G G TG G A C a T he p rim er a nd p ro be p os iti on s ar e gi ve n re la tiv e to th e Ly ss av iru s fu ll ge no m e. b LN A -m od ifi ed b as es a re in di ca te d by a p lu s pr ec ed in g th e ba se in th e se qu en ce (e .g . + A , + G , + C , + T) . c T he p an -ly ss av iru s LN 34 a ss ay h as a m ix ed p ro be o f P ro be L N 34 a nd P ro be L N 34 la go in a ra tio o f 2 :1 re sp ec tiv el y; th e fo rw ar d pr im er is a 1 :1 m ix tu re o f P rim er fo rw ar d1 a nd P rim er fo rw ar d. Lyssavirus-specific probe-based assays (continued) Ta bl e 38 .1 . co nt in ue d Laboratory techniques in rabies Fifth edition 21 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Pan-lyssavirus real-time RT-PCRs Materials and equipment • Several thermal cyclers are available that allow real-time detection of fluores- cence. The difference in cycler performance when using established manufac- turers is generally limited; nevertheless, assays must be validated or optimized when moved to a new thermal cycler. Test reagents should be optimized for the individual thermal cyclers of different companies. For example, the CFX96 quantitative PCR system (Bio-Rad Laboratories Inc., Hercules, USA) should be used with the respective Bio-Rad 96-well PCR plates. For real-time RT-PCR, numerous test kits are commercially available. In the protocols below, two kits have been validated but others can also be used after appropriate validation. When developing and/or establishing real-time RT-PCR assays in the labora- tory, test parameters must be validated locally. For example, the limit of detec- tion must be identified by evaluating the sensitivity of the assay using a 10-fold serial dilution series of stock RNA (e.g. 1 µg/µL over a range of 1 µg–1 pg for viral RNA stocks extracted from positive brain). Additionally, the specificity of the assay must be confirmed using an appropriate and locally relevant panel of positive and negative samples. • MicroAmp reaction plate base (or equivalent plate/strip/tube holder) • 96-well PCR plates, non-skirted or strips of 8 or 12 PCR-tubes suitable for the chosen real-time machine • optically clear flat cap strips (strips of 8 or 12 lids) or optical adhesive covers, applicator and compression pad • range of pipettes and nuclease-free barrier tips, capable of dispensing 0.5–1000 μL • Eppendorf tubes or bijous of relevant size for preparation of the master mix • ice buckets and ice or equivalent method of keeping reagents cool during setup • vortex mixer • bench-top micro-centrifuge • molecular biology reagent grade water • appropriate cleansing agent to minimize cross-contamination • permanent marker pen • gloves and a laboratory coat must be worn at all times. Preparation of master mix The master mix contains all the components for the reverse transcription (if  required) and amplification. Sufficient master mix should be prepared to be able to analyse all the samples plus no template control(s) and positive control(s). Master mixes can be made up fresh for the test to be run or in batches; if locally validated, they can be frozen for up to one year in suitably sized aliquots. Laboratory techniques in rabies Fifth edition 22 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Test specimens RNA extracted from postmortem brain tissue (optimally brainstem and/or cere- bellum) of the animal or human being tested for the presence of lyssaviruses. RNA from human antemortem specimens (including serial saliva specimens, skin biopsies, hair follicles, cerebrospinal fluid, urine and serum) may also be tested. All test samples should be run at least in duplicate (ideally triplicate), and multiple internal controls (see below) for each of the primer/probe sets should be included in each run. All controls must be included alongside test samples in every test run to ensure the test is performing within expected parameters. Internal controls Positive controls. Each newly prepared batch of positive control RNA must be validated and calibrated to ensure it is consistently within the expected cycle threshold (Ct) range. The expected range will be defined by the laboratory accor- ding to the technique employed and will be used to confirm the validity of each test run. Working aliquots must be prepared to prevent multiple freeze–thaw cycles from stock batches, stored at −80 °C and should not be used if the Ct value is out of range. Negative controls. Molecular-grade water and/or negative RNA sample are added to the master mix (no template control) to confirm that the reagents are free from contaminants. Additional controls. The efficacy of nucleic acid extraction and/or functiona- lity of amplification can be tested using heterologous internal control systems or endogenous housekeeping genes (Table 28.1). The use of endogenous housekee- ping genes or the direct spiking of internal controls into the suspect samples ensures that all steps (extraction, reverse transcription and amplification) are analysed under the same conditions and in the same matrix as the lyssavirus screening. Spiking of exogenous internal control could also overcome the lack of detection of endogenous housekeeping genes in some biological samples due to low level of cells, such as in CSF (in the context of antemortem rabies diagnosis in humans). Protocol 1. Wear clean gloves (not previously worn when handling extracted RNA or PCR products) when setting up assays. 2. Change or decontaminate gloves whenever you suspect they are contami- nated. 3. Keep reagent tubes and reactions capped as much as possible. 4. Before setting up assays and after handling extracted RNA or PCR products, clean equipment and laboratory benches with one of the acceptable surface decontaminants listed under reagents. Use aerosol barrier (filter) pipette tips. Laboratory techniques in rabies Fifth edition 23 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Summary of outcomes and overall result Test result Internal control Overall result Negative Negative Invalid: repeat extraction and/or testing Negative Positive Negative result reported Positive Positive Positive result reporteda Positive Negative Repeat and/or run on a gela a If confirmed positive, follow up may be advised with additional tests and/or sequencing (see Chapter 29 on Sanger sequencing and Chapter 31 on next generation sequencing). The SYBR Green assay The procedure detailed here is an example that uses the same primers as the differential TaqMan assay described previously (2). The use of a universal SYBR Green one-step RT-PCR kit for the detection of lyssavirus species from clinical specimens has been demonstrated to be both highly sensitive and specific for lyssavirus RNA. Furthermore, by using SYBR Green as the detection system it is able to detect all lyssaviruses (including highly divergent WCBV, IKOV and LLEBV) based on the pan-lyssavirus primer specificity. This method includes a separate RT-PCR assay containing SYBR Green for amplification of the internal housekee- ping control, ß-actin, used as a template control for RNA extraction. Using a universal SYBR Green one-step RT-PCR kit, cDNA synthesis and PCR amplification are carried out in a single tube. SYBR Green, a cyanine dye, binds to dsDNA during the amplification and the resulting DNA-dye complex absorbs blue light and emits green light. As the target amplicon accumulates with increasing PCR cycles, increasing dye is bound and gives greater levels of fluorescence. SYBR Green assays have two major phases: amplification and dissociation. The amplification phase corresponds to the PCR portion of the assay, and results in the generation of dsDNA. In the dissociation phase, the dsDNA product is melted into single-stranded DNA by a stepwise increase in temperature, with fluorescence data being collected at each temperature step. This dissociation phase gives an indication of the amplicon size. The likelihood of false–positive reactions in quality-assured laboratories is negligible. Specific reagents and biologicals • Lyssavirus-specific primers (HPLC purified) diluted to 20 µmol: – JW12 RT/PCR primer 5’-ATG-TAA-CAC-CYC-TAC-AAT-G-3’ – N165-146 PCR primer 5’-GCA-GGG-TAY-TTR-TAC-TCA-TA-3’ • Multispecies ß-actin primers (HPLC purified) diluted to 20 µmol: – BatRat ß-actin intronic primer 5’-CGA-TGA-AGA-TCA-AGA-TCA-TTG-3’ – BatRat ß-actin reverse primer 5’-AAG-CAT-TTG-CGG-TGG-AC-3’ • Bio-Rad iTaq™ Universal SYBR® Green One-Step RT-PCR Kit (catalogue number 172-5150/1) Laboratory techniques in rabies Fifth edition 24 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Test procedure In the clean room or UV cabinet 1. Wipe the bench with an appropriate disinfectant before use, then prepare the PCR workstation by opening the doors and wiping the cabinet surface with an appropriate disinfectant (to remove residual nucleic acids). Place an ice bucket (small), discard pot (containing an appropriate disinfectant), suitable pipette and tips within the station and close the doors. Switch on UV light for 10 min. 2. Obtain the required reagents from the –20 °C freezer. Ensure the enzyme mix is kept on ice; the remaining reagents can be thawed at room temperature. 3. Put the required number of 0.2 mL strips into an appropriate holder (or a 96-well plate if there are multiple samples). 4. Prepare a reaction master mix as below and keep all reagents on ice. Allow for pipetting variation by preparing at least an extra two reaction mixes (e.g. if you are running five reactions in total, prepare master mix for seven reactions). Reagent μL/reaction Molecular-grade water 7.55 2× universal SYBR Green reaction mix 10 JW12 (Forward) [20 μmol] 0.6 N165-146 (Reverse) [20 μmol] 0.6 iTaq RT enzyme mix 0.25 Total per reaction 19 5. Prepare a reaction master mix for the ß-actin mRNA which assesses the quality of the extracted RNA. The SYBR Green assay for ß-actin must be positive to have confidence that RNA was isolated from the starting material. Reagent μL/reaction Molecular-grade water 7.55 2× Universal SYBR Green reaction mix 10 BatRatAct intronic (Forward) [20 μmol] 0.6 BatRatAct reverse (Reverse) [20 μmol] 0.6 iTaq RT enzyme mix 0.25 Total per reaction 19 Vortex the prepared master mixes and aliquot 19 μL into each of the relevant wells of a 96-well plate, 8-well or 12-well strips (according to the plate set up sheet). In the template room or UV cabinet – addition of template 1. Wipe the bench with an appropriate cleanser prior to use, then prepare the PCR workstation by opening the doors and wiping the cabinet surface with an appropriate disinfectant. Place an ice bucket (small), discard pot (containing an appropriate disinfectant), suitable pipette and tips within the station and close the doors. Switch on UV light for 10 min. 2. Thaw samples and control RNA on ice. Laboratory techniques in rabies Fifth edition 25 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences 3. Add 1µL of test RNA (where possible, at a concentration of 1 µg/µL for TRIzol extracted tissue samples) below the surface of its allocated master mix tube and mix gently. Discard the tip directly into disinfectant after use. Repeat this process until all samples and controls have been added to their allocated tubes. 4. Press the lids down by hand and seal firmly. Number the strip lids according to your plate layout for orientation. 5. Transfer the PCR plate or strips to the real-time machine for thermal cycling. Setting up the real-time thermal cycler (this may vary depending on the machine used) 1. Load the plate or strips into the machine ensuring that they are orientated correctly. Check that all the lids are firmly sealed, and then close the machine’s plate cover and door. 2. Ensure that “SYBR” is selected as mode of the detection. 3. Label the wells with sample information (e.g. specimen number). 4. Label the positive and negative controls. 5. Set up the thermal profile as follows: Stage Cycles Temperature Time Data collection Reverse transcription 1 50 oC 10 min RT inactivation/initial denaturation 1 95 oC 5 min Amplification 40 95 oC 60 oC 10 s 30 s End-point Dissociation curve analysis 1 95 oC 55 oC 55–95 oC 1 min 1 min 10 s All points 6. Start the reaction. Save the appropriately labelled run in the relevant folder as necessary. Analysis of results 1. Once the run has finished, highlight the wells for which you want to collect data for analysis. 2. The amplification plot screen shows a plot of cycles versus fluorescence for an individual collection point on which data have been gathered. Positive samples will have exponential ramps followed by plateau and a Ct value, which should be interpreted alongside the positive and negative controls. Negative samples will have a flat amplification plot and no Ct values. The Ct value is calculated automatically by the software on completion of the run. 3. The lower the Ct value, the more amplicon produced (i.e. the level of fluores- Laboratory techniques in rabies Fifth edition 26 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences cence crossed the threshold earlier in the run) and therefore the more viral RNA (i.e. the assay is semi-quantitative). 4. As SYBR Green binds to any dsDNA, a thorough analysis of the dissociation curve must be performed to determine the specificity of the PCR products and monitor the presence of primer-dimers or contaminants that might be contribu- ting to the fluorescent signal. 5. Generally, populations with a temperature of ≥ 80 °C correspond to the larger PCR products and can usually be assigned as specific DNA products. These dissociation curves usually produce a narrow well-defined peak which can be compared to the positive control. DNA products displaying melting tempera- tures of < 75 °C corresponding to non-specific DNA products. 6. The melting temperature will peak for RABV amplicons around 79 °C. The melting temperature for ß-actin is around 86 °C. Any positive sample will have a melting temperature peak the same temperature as the positive control. Any samples with different melting temperatures are not considered positive. 7. In case of an inconclusive assay, an agarose gel can be run to confirm the presence or absence of an amplicon the same size as the positive control (approximate size 100 bp). The LN34 assay The multiplex probe-based LN34 assay is a real-time RT-PCR assay which uses a combination of degenerate primers and probes to achieve superior coverage of the lyssavirus genus while maintaining sensitivity and specificity (4). The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the N gene coding sequence of the lyssavirus genome to main- tain assay robustness. The probe sequences overlap with the highly conserved JW12 sequences and are further modified by locked nucleotides to increase their melting temperature and meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay is able to eliminate the nonspecific amplifications from the nonspecific binding of the degenerated primers and/or primer dimers and allow a standardized diagnostic interpretation based on the Ct values. The diagnostic algorithm of the LN34 assay reduces the uncertainties in rabies testing and makes the adaptation of LN34 assay easier once a laboratory has the capacity for real- time PCR. The LN34 assay has the built-in artificial positive control which can be used to monitor the quality of the assay in a laboratory and to compare diagnostic results directly among different laboratories and different regions. It produces a 165 bp amplicon which can be sequenced for a rapid genetic typing of a posi- tive result. In the near future, the LN34 assay and the host RNA ß-actin assay could be combined into a single tube, two-colour test to further reduce costs and diagnostic errors. Specific reagents and biologicals • Reagents (light sensitive: store in the dark at −20 °C) – LN34 assay primer and probe set (Table 28.1) – ß-actin assay primer and probe set (Table 28.1) Laboratory techniques in rabies Fifth edition 27 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences • Reagents (non-light sensitive) – Ag-Path ID One-Step RT-PCR Kit [Life Technologies, Catalogue no. 4387391] – Store at −20 °C; refer to manufacturer’s instructions for expiration infor- mation. Test procedure Each RNA sample must be run in triplicate and be tested using the LN34 assay and a ß-actin control assay. Three no template control wells and three known posi- tives for each of the primer or probe sets should be included in each run. Reac- tion assay mixtures (master mixes) containing all components except templates should be made as cocktails and dispensed into the 96-well reaction plate, 8-well strips or 12-well strips. Extracted RNA or water should then be added to test and control reactions, respectively. 1. Prepare separate master mixes for LN34 and ß-actin assays using the table below. Reagent μL/reaction Water 6.5 2× RT buffer 12.5 25×RT-PCR enzyme mix 1 Forward primer [10 μmol] 1 Reverse primer [10 μmol] 1 Probe [5 μmol] 1 RNA 2 Total per reaction 23 2. Load 23 μL of master mix into the assigned wells in an appropriate plate or tubes for your real-time PCR instrument. 3. Set up the NTC reactions by pipetting 2 μL of PCR-grade water into all the NTC wells. 4. Briefly vortex and centrifuge the tubes containing the RNA samples. 5. Set up the extracted RNA sample reactions. a. Pipette 2 μL of the first sample into all the wells labelled for that sample. b. If sample volume is < 2 μL, add PCR-grade water to the reaction tube to bring the total reaction volume up to 25 μL. 6. Repeat step 2 for the remaining samples and the positive controls. 7. After the addition of the last sample or control, peel off the protective covering of the optical adhesive cover and place it over the wells, being sure to cover all the wells. 8. Ensure bubbles are removed by tapping the plate or by centrifuging the plate at 500 × g for 1 min at room temperature. Place sealed tubes or plate into a real-time PCR instrument that can detect FAM and VIC. Set to the conditions below or optimize to local real-time PCR machine as follows: Laboratory techniques in rabies Fifth edition 28 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences ViiA7 – Standard mode Cycles Temperature Time Data collection Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 1 s 20 s End-point ABI7500 – Standard mode Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 15 s 30 s End-point ABI7500 Fast/FastDX – Fast mode Reverse transcription 1 50 oC 30 min RT inactivation/initial denaturation 1 95 oC 10 min Amplification 45 95 oC 56 oC 3 s 30 s End-point Laboratory techniques in rabies Fifth edition 29 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Interpretation of results 1. Allow the instrument to analyse the results automatically; any manual threshold or baseline adjustments need to be recorded and explained. 2. Record DFAT results (antigen intensity and distribution) as well as Ct values for the ß-actin and LN34 assays for each sample and control, as follows: Brain sample result guidance Assay Ct value Result Action required ß-actin Earlier than 33 Positive No action required; 99.2% of 2248 samples tested in a preliminary cohort exhibited an average ß-actin Ct value < 33. 33–45 Inconclusive Possible inhibition or insufficient sample. Repeat or additional testing required. Not detected Fail Insufficient sample or failed extraction. Re- peat or additional testing required. LN34 Earlier than 35 Positive No action required; 99.6% of 678 FAT-pos- itive samples tested in a preliminary cohort exhibited LN34 Ct value < 35. 35–45 Inconclusive Repeat or additional testing required. Share the tissue with National Reference Laborato- ry for confirmatory testing. Not detected Negative or Inconclusive Negative if ß-actin ≤ 33 and > 0. Inconclu- sive if ß-actin is > 33 or 0. 3. A RABV-positive sample extracted from properly collected and stored brain tissue is expected to have a Ct value less than 35 cycles for the LN34 assay. Samples that amplify after 35 cycles with the LN34 assay with ß-actin Ct values < 20 may indicate potential problems with the assay, sample, or extraction, particularly sample contamination if positive rabies samples were processed on the same day. 4. A synthetic LN34 positive control RNA template (107 bases) can be generated using an in vitro T7 transcription kit for normalization purposes (oLPC-ra- bies3-4: GCA CAG GGT ACT TGT ACT CAT ACT GAT CTG AAT CCA TTG TAG AGG TGT TAG AGC ACG ACA GGT TTC CCG ACT GGA TCT TTC TTT GAT CTG GTT AAG CGT TCG CCC TAT AGT GAG TCG TAT TAC A) (4). 5. The LN34 Ct value of the positive control should be between 25 and 28. A tripli- cate set up is recommended. If the positive control sample does not produce growth curves that cross the threshold line, invalidate the run and repeat the assay with stricter adherence to the guidelines outlined above. 6. For test samples, if only one of the three triplicates amplifies, the result is consi- dered invalid. Two of the three replicates should amplify with a Ct value earlier than 35 for LN34 or 33 for ß-actin for a valid positive result for RNA extracted from brain tissue. Repeat extraction or testing may be indicated. 7. LN34 sample Ct values should not be considered independent of their ß-actin results. All clinical specimens should exhibit ß-actin curves that cross the Laboratory techniques in rabies Fifth edition 30 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences threshold line, thus indicating the presence of host RNA. ß-actin Ct values determine the quality, suitability and potential inhibition of the sample being tested. Some samples may fail to exhibit ß-actin growth curves due to low concentration in the original clinical specimen. Failure to detect ß-actin in any clinical sample may indicate: – improper extraction of RNA from clinical materials resulting in loss of RNA or carryover of PCR inhibitors from clinical specimens; – improper assay set up and execution; – inadequate clinical sample; and/or – reagent or equipment malfunction. 8. A Ct value of 33–45 in the ß-actin assay may indicate PCR inhibition. Where LN34 is negative and ß-actin Ct is between 33 and 45, dilute samples 10-fold and repeat. 9. Samples where less than one half of replicates exhibited Ct values > 39 and the reminder of the replicates showed no amplification can be considered negative for LN34. 10. The NTC reactions for LN34 and ß-actin probe or primer sets should not exhibit amplification curves that cross the threshold line. If either of these NTC reactions exhibit amplification curves that cross the threshold line, specimen contamination may be indicated. Invalidate the run and repeat the assay with stricter adherence to the guidelines outlined above. 11. This assay does not differentiate between lyssaviruses. Discussion Real-time RT-PCR has become a standard confirmatory technique for the post- mortem diagnosis of rabies in humans and animals in many quality-assured rabies reference laboratories. This technique, and other validated molecular methods, are increasingly relied upon as the first line approach for the antemortem diagnosis of human rabies, as DFAT and RTCIT are often inappropriate. Initial concerns regar- ding molecular assays, including cross-contamination and false–positive results, seem to have been largely resolved by following various preventive measures and quality control systems. Indeed, in a ring-trial in Europe, the performance of real-time PCR gave more concordant results than virus isolation in cell culture (12). A recent pilot programme involving 15 laboratories from the USA, Canada, Europe, Philippines, Chile, Haiti, Georgia and India tested approximately 3000 suspected animal samples using both LN34 assay and DFAT testing and detected more than 1000 positive samples successfully. Compared with the DFAT testing, the LN34 assay produced no false–negative results, one possible false–positive result with a Ct value near the cut-off value and reduced more than 80% of inde- terminate results from DFAT testing. Based on the adapted diagnostic algorithm, the LN34 assay achieved 99.31% diagnostic specificity and 99.87% diagnostic sensitivity. Similarly, the JW12/N165 based SYBR Green RT-PCR assay has been validated using hundreds of clinical specimens (human and animal) and was successfully used by 56% of laboratories participating in the real-time RT-PCR Laboratory techniques in rabies Fifth edition 31 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences annual (EURL) coordinated proficiency ring-trials (2013–2015), demonstrating 100% concordance with the DFAT and hnRT-PCR results including non-RABV lyssavirus samples. The two methods described in this chapter are examples of pan-lyssavirus diagnostic real-time RT-PCRs validated for diagnosis of both human and animal rabies. Other established and well-validated assays, both SYBR and probe-based, have been reported, mainly targeting the relatively conserved nucleoprotein or polymerase genes (some examples are shown in Table 28.1) and offer possibilities for laboratories to select, optimize and introduce this technique depending on their specific needs. In settings where the diversity of lyssaviruses is either variable or unknown and for surveillance schemes (such as preliminary bat surveillance) when novel virus variants or even novel lyssavirus species may be discovered, pan lyssavirus assays are highly recommended as RABV-specific based assays may yield false–negative results. In large-scale surveillance schemes which are likely to yield significant numbers of negative samples, the probe-based assays may be prohibitively expensive relative to the less expensive SYBR® Green assays at this time, but an expan- sion of production may reduce the costs of probe-based assays considerably. To increase specificity, the melting curve analysis represents an essential parameter to avoid a false–positive result due to the formation of primer dimers. In addition, sequencing of the amplicon can give further confirmation. The highly specific probe-based assays offer advantages over the SYBR Green assay when circulating virus variants are known or where rapid lyssavirus typing is desired (2). However, a combination of the two approaches is often employed in reference laboratories. For example, a dual combined approach employing two L-gene based real time assays (a pan-RABV probe-based assay and a pan-lys- savirus SYBR Green assay) has recently been established and validated using a large cohort of animal and human rabies infected material (5); see Table 28.1 for primer/probe details. For the samples with a low level of RABV RNA, such as antemortem samples or samples stored or transported under suboptimal conditions and that cannot be diagnosed by other methods, the real-time RT-PCR assay is especially useful due to its superior sensitivity (4). However, as for other molecular techniques, addi- tional care is required when applying the real-time RT-PCR for the antemortem diagnosis of human rabies compared with postmortem diagnosis on brain tissue. Indeed, the viral load is often much lower in antemortem specimens, potentially below the threshold of detection of the technique, especially when the viral strain is genetically distant from the designed probes or primers. Testing multiple or serial samples and combining different molecular techniques can be useful for such antemortem diagnosis (see Overview of antemortem and postmortem tests for diagnosis of human rabies in Chapter 5). The real-time RT-PCR assay is able to test samples stored in the RNA stabilization buffers, or spotted on FTA cards and nitrocellulose membrane of lateral flow devices (see relevant chapter on the rapid immunochromatographic diagnostic test in this manual) (13), which reduce the burden of sample collection, transportation and storage for rabies diagnostics and surveillance. This is particularly important in rural areas or developing coun- tries which often have limited resources and lack experienced laboratorians. Laboratory techniques in rabies Fifth edition 32 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences Relative quantitation is possible using either SYBR Green or probe-based assays to estimate comparative viral loads in clinical specimens (2, 4, 14). Many primer (and probe) sets have been published (some of which are outlined in Table 28.1) which can be modified and validated locally, to establish an optimal technique for their own particular needs. When established, laboratories should regularly check the performance of their assays by using internal controls and by taking part in national and/or international ring-trials. Because all assays should be fit-for-pur- pose in the individual laboratory, it is not advisable to recommend one specific assay. Rather, if laboratories want to use real time RT-PCR as a confirmatory test, additional to DFAT, they need to show congruent results when testing a panel of RABVs adapted to their epidemiological setting or other lyssaviruses that repre- sents the global diversity. While positive real-time RT-PCR results may result in prompt action concerning the provision of post-exposure prophylaxis (PEP), where possible they should be followed up using classical virological techniques, i.e. DFAT or virus isolation, to allow for future characterization and support case notification to OIE and WHO. Laboratory techniques in rabies Fifth edition 33 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences References 1. Panning M, Baumgarte S, Pfefferle S, Maier T, Martens A, Drosten C. Compa- rative analysis of rabies virus reverse transcription-PCR and virus isolation using samples from a patient infected with rabies virus. J Clin Microbiol. 2010;48:2960–2. doi:10.1128/JCM.00728-10. 2. Wakeley PR, Johnson N, McElhinney LM, Marston D, Sawyer J, Fooks AR. Development of a real-time, TaqMan reverse transcription-PCR assay for detection and differentiation of lyssavirus genotypes 1, 5, and 6. J Clin Microbiol. 2005;43:2786–92. doi:10.1128/JCM.43.6.2786-2792.2005. 3. Faye M, Dacheux L, Weidmann M, Diop SA, Loucoubar C, Bourhy H, et al. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus. J Virol Methods. 2017;243:120–30. doi:10.1016/j. jviromet.2016.12.019. 4. Wadhwa A, Wilkins K, Gao J, Condori Condori RE, Gigante CM, Zhao H, et al. A pan-Lyssavirus Taqman real-time RT-PCR assay for the detection of highly variable rabies virus and other lyssaviruses. PLoS Negl Trop Dis. 2017;11:e0005258. doi:10.1371/journal.pntd.0005258. 5. Dacheux L, Larrous F, Lavenir R, Lepelletier A, Faouzi A, Troupin C, et al. Dual combined real-time reverse transcription polymerase chain reaction assay for the diagnosis of Lyssavirus infection. PLoS Negl Trop Dis. 2016;10:e0004812. doi:10.1371/journal.pntd.0004812. 6. Nadin-Davis SA, Sheen M, Wandeler AI. Development of real-time reverse transcriptase polymerase chain reaction methods for human rabies diagnosis. J Med Virol. 2009;81:1484–97. doi:10.1002/jmv.21547. 7. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 8. Hoffmann B, Freuling CM, Wakeley PR, Rasmussen TB, Leech S, Fooks AR, et al. Improved safety for molecular diagnosis of classical rabies viruses by use of a TaqMan real-time reverse transcription-PCR “double check” strategy. J Clin Microbiol. 2010;48:3970-8. doi:10.1128/JCM.00612-10. 9. Coertse J, Weyer J, Nel LH, Markotter W. Improved PCR methods for detec- tion of African rabies and rabies-related lyssaviruses. J Clin Microbiol. 2010;48:3949-55. doi:10.1128/JCM.01256-10. 10. Hayman DT, Banyard AC, Wakeley PR, Harkess G, Marston D, Wood JL, et al. A universal real-time assay for the detection of Lyssaviruses. J Virol Methods. 2011;177:87–93. doi:10.1016/j.jviromet.2011.07.002. 11. Marston DA, Horton DL, Ngeleja C, Hampson K, McElhinney LM, Banyard AC, et al. Ikoma lyssavirus, highly divergent novel lyssavirus in an african civet1. Emerg Infect Dis. 2012;18:664–7. doi:10.3201/eid1804.111553. Laboratory techniques in rabies Fifth edition 34 Rabies real-time reverse transcriptase PCR Part 5. Demonstration of viral nucleic acids and sequences 12. Robardet E, Picard-Meyer E, Andrieu S, Servat A, Cliquet F. International interlaboratory trials on rabies diagnosis: an overview of results and variation in reference diagnosis techniques (fluorescent antibody test, rabies tissue culture infection test, mouse inoculation test) and molecular biology tech- niques. J Virol Methods. 2011;177:15–25. doi:10.1016/j.jviromet.2011.06.004. 13. Lechenne M, Naissengar K, Lepelletier A, Alfaroukh IO, Bourhy H, Zinsstag J, et al. Validation of a rapid rabies diagnostic tool for field surveillance in developing countries. PLoS Negl Trop Dis. 2016;10:e0005010. 14. Wang L, Liu Y, Zhang S, Wang Y, Zhao J, Miao F, et al. A SYBR-Green I quantitative real-time reverse transcription-PCR assay for rabies viruses with different virulence. Virologica Sinica. 2014;29:131–2. doi:10.1007/s12250- 014-3378-1. 15. Fischer M, Freuling CM, Muller T, Wegelt A, Kooi EA, Rasmussen TB, et al. Molecular double-check strategy for the identification and characterization of European Lyssaviruses. J Virol Methods. 2014;203:23–32. doi:10.1016/j. jviromet.2014.03.014. 16. Schatz J, Ohlendorf B, Busse P, Pelz G, Dolch D, Teubner J, et al. Twenty years of active bat rabies surveillance in Germany: a detailed analysis and future perspectives. Epidemiol Infect. 2014;142:1155–66. doi:10.1017/ S0950268813002185. 17. Freuling CM, Abendroth B, Beer M, Fischer M, Hanke D, Hoffmann B, et al. Molecular diagnostics for the detection of Bokeloh bat lyssavirus in a bat from Bavaria, Germany. Virus Res. 2013;177:201–4. doi:10.1016/j. virusres.2013.07.021. 18. Hoffmann B, Depner K, Schirrmeier H, Beer M. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detec- tion system for pestiviruses. J Virol Methods. 2006;136:200–9. doi:10.1016/j. jviromet.2006.05.020. 19. Toussaint JF, Sailleau C, Breard E, Zientara S, De Clercq K. Blue- tongue virus detection by two real-time RT-qPCRs targeting two different genomic segments. J Virol Methods. 2007;140:115–23. doi:10.1016/j. jviromet.2006.11.007. Laboratory techniques in rabies Fifth edition 35 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences Chapter 29 Sanger sequencing of lyssaviruses Introduction Sanger dideoxy terminator sequencing was developed by Fred Sanger and colleagues in 1977 (1). The method is based on the selective incorporation of chain-terminating dideoxynucleotides (ddNTPs) by DNA polymerase during in vitro DNA replication. Sanger sequencing has become the most widely used sequencing method during the past three decades. For large-scale, automated genome analyses, it has more recently been replaced by next-generation sequen- cing methods. However, the Sanger method remains in widespread use, parti- cularly when partial genome characterization is sufficient for virus typing or for smaller-scale genome projects. The Sanger method is also the optimal approach for obtaining long contiguous DNA sequence reads (> 500 nucleotides). Since reverse transcriptase polymerase chain reaction (RT-PCR) was first used to amplify lyssavirus RNA in the early 1990s, a wide array of molecular-based diagnostic assays has been established (2,3). Sanger sequencing enables the rapid, reliable and relatively inexpensive virus typing of lyssavirus PCR products or amplicons compared with conventional monoclonal antibody typing (4). Within just a few years, the genetic typing of lyssaviruses became routine, quickly followed by an explosion of published molecular epidemiological and phyloge- netic studies. A specific genomic region has not been prescribed or standardized for lyssavirus molecular typing; however, a considerable amount of data has been published for partial and complete nucleoprotein gene sequences and this region has been shown to be sufficiently discriminatory for virus typing and evolutionary studies (5–8). Complete genome sequences have been obtained for a number of lyssa- viruses via Sanger sequencing of overlapping cloned PCR products or long-dis- tance PCR products, sometimes referred to as “walking the genome” (9–12). The multiple primer sets employed are often available from the authors on request or are supplied as supplementary data (12). Sanger sequencing, also referred to as dideoxy sequencing or chain termi- nation, is based on the use of fluorescently labelled ddNTPs in addition to the deoxynucleosidetriphosphates (dNTPs) found in DNA. Modern day automated sequencing employs an approach called “dye-terminator sequencing”. Each of the chain terminator ddNTPs is labelled with a different fluorescent dye, each of which emit light at different wavelengths. The four labelled ddNTPs (ddATP, ddGTP, ddCTP, or ddTTP) are added with the four normal dNTPs and the DNA polymerase. Before the DNA can be sequenced, it is heat denatured into single strands. Next, a primer is annealed to one of the template strands. The primer is specifically constructed so that its 3’ end is located next to the DNA sequence of interest. Following rounds of template DNA extension from the bound primer Laboratory techniques in rabies Fifth edition 36 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences (sequencing reaction), the resulting DNA fragments all start from the same primer site but are terminated by the incorporation of the ddNTP at different sites along the template sequence, thus generating fragments of different sizes that can be separated by gel electrophoresis. Unincorporated dye terminators must be completely removed before the samples can be analysed by electrophoresis. Excess dye terminators in sequencing reactions obscure data in the early part of the sequence and can interfere with the base calling software. Hence prior to loading the sequence reactions onto the automated sequencers, they are purified to remove excess ddNTPs. Automated DNA sequencers perform capillary elec- trophoresis for size separation and detection. They record the incorporation of the labelled ddNTPs as fluorescent peak trace chromatograms. Methods The following describes the protocols followed when using the ABI 3130xl, 16  capillary and ABI3730, 48 capillary Genetic Analyser instruments. Other machines and reagents are also available for Sanger sequencing. The ABI3730 and ABI3130 Genetic Analysers are fully automated capillary sequencers. They are capable of determining the nucleotide sequence of any given DNA sample and can also be used to estimate the sizes of DNA fragments that have been prepared with ABI dye-labelled reagents. The ABI 3130xl, 16 capil- lary Genetic Analyser can run 2 x 96 well plates; the ABI 3730, 48 capillary Genetic Analyser can run up to 16 96 well plates. Both machines can utilize capillary arrays of different lengths depending on what samples are being processed. Each set of samples, containing labelled DNA fragments, is automatically denatured and then separated by capillary electrophoresis. The replaceable medium (polymer) is automatically replaced in the capillaries after each separa- tion. Detection is facilitated by laser-induced fluorescence in four spectral chan- nels. The four-channel raw data sets generated by each of the capillaries are auto- matically processed to produce high-quality base sequences or fragment lists after separation. Preparing PCR amplicons for the ABI genetic analysers After a PCR product is generated from a lyssavirus-positive sample it needs to be purified then sequenced using florescence-based terminator cycle sequen- cing. The following describes the protocol to be followed when using the ABI Big Dye Terminator ready reaction kit. The kit works by providing a ready mix which contains the enzyme, dNTPs, magnesium chloride, buffer and dye terminators (ddNTPs) all at the appropriate quantities. Purified amplicon DNA and one primer are added to the mix and cycled to obtain dye terminated products which can be precipitated and analysed on the ABI genetic analysers. • Sequencing must be performed in both the reverse and forward direction (i.e. using 3’ and 5’ directed primers) so consensus (complementary) sequence can be obtained. Laboratory techniques in rabies Fifth edition 37 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences • Sequencing in each direction should be performed, at least, in duplicate prior to publication of the sequence to reduce the likelihood of errors. • If cloned PCR products are sequenced, ensure at least five independent clones are sequenced and use the consensus sequence for publication to ensure minor variants are not used as the representative sequence. Purifying the PCR product After visualizing the PCR product by agarose gel electrophoresis, the remaining PCR product should be purified prior to sequencing. A number of commercial kits are available for the purification of PCR products (e.g. QiaQuick PCR Purifi- cation kit [Qiagen]). If the PCR product band appears weak on the gel, it can be loaded and extracted directly from the gel using a commercially available kit (e.g. MinElute gel extraction kit [Qiagen]) which will enable the product to be eluted in as little as 10µL elution buffer and thereby increase the concentration. For large- scale purification (96-well plates), automated purification may be preferable (e.g. HTS PCR 96-well purification system [Millipore Multiscreen] or AMPure clean up system [Beckman Coulter Agencourt]). Ensure fresh tips are used between samples to avoid cross-contamination. 1. Elute purified PCR product from column in 10–50µL elution buffer depending on the amount of product and column used. 2. Quantify the DNA concentration using spectrometers (e.g. plate readers [Nano- Drop or POLARstar Galaxy]). BigDye terminator cycle sequencing reactions On ice, add the purified amplicon DNA (approximately 50–100 ng – usually 5μL) to the appropriate wells on a 96-well plate. If plasmid DNA is being used, pre-heat the DNA at 96 °C for 1 min and keep on ice. If many primers are being used for sequencing (forward, reverse, etc.), make a master mix without the primer and add primers to appropriate wells at this stage. See below as an example for calculating the amount of DNA to be added. PCR products: (PCR product length/100) x 2) / DNA conc (ng/μL) Plasmids: 100/DNA concentration (ng/μL) 1. Make a master mix using the volumes shown below. The amount of water can be amended to allow for variation in the amount of DNA product added, ensu- ring final volume is 20 μL. The primer employed will depend on the template sequence to be analysed (examples given below). Laboratory techniques in rabies Fifth edition 38 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences Sequencing mix volume added per reaction DNA 5.0 μL Molecular-grade water 6.0 μL BigDye sequencing mix 4.0 μL Buffer 4.0 μL Primer (3.2pmol/μL) 1.0 μL Total volume 20.0 μL Examples of primers (often the primers used for amplification) Gene Forward primer Reverse primer Nucleoprotein, 1st round JW12 JW6UNI Nucleoprotein, 2nd round JW12 JW10UNI Glycoprotein GP01 (GT1) GP02 (GT1) Plasmid PCR II M13–20 M13 2. Cover the plate with a foil-sealing lid and centrifuge briefly to collect liquid at the bottom of the wells if necessary. 3. Transfer the plate to a PCR machine and run on the suitable ABI sequencing programme; these can be modified to suit primers if necessary (see below). Cycling conditions Big Dye sequencing reactions 96 °C 10 s 50 °C 5 s x 25 60 °C 4 min 4 °C hold Ethanol precipitation of sequencing reactions The purification of the sequencing reactions facilitates the removal of unincor- porated labelled ddNTPs which would interfere with base calling. Once cycling is complete, remove the plate from the PCR machine and clean up the sequencing products. It is recommended that the ethanol/EDTA/NaOAc clean-up method is used. While ethanol/EDTA can be used, the smallest PCR fragments may not be precipitated. Note: Isopropanol precipitation is NOT recommended. 1. Add 2 μL 125 mmol EDTA to each well. 2. Add 2 μL 3 mol sodium acetate to each well. 3. Add 50 µL of 100% ethanol to each well. 4. Seal plate, vortex briefly and leave for 15 min at room temperature. 5. Centrifuge the plate at 3000 r/min for 45 min. 6. Invert plate over sink and shake three times to remove supernatant. 7. Rinse each well with 70 µL 70% ethanol. Laboratory techniques in rabies Fifth edition 39 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences 8. Centrifuge the plate at 3000 r/min for 15 min. 9. Invert plate over sink and shake three times to remove supernatant. 10. Keeping the plate inverted, place it on a piece of paper towel and centrifuge upside down for 15–30 s at 300 r/min. 11. Air dry for 15–10 min. 12. Seal and label the 96-well plate. Preparing 96-well sample plate(s) for the genetic analysers Spin samples down if necessary, remove sealing film. Loading 96-well sample plate(s) The Genetic Analysers have a safety feature which means that no movement will occur inside the machine when the door is open. The machines will not work and the buttons on the front of the machines will not function unless the door is properly closed. For the 3130xl. Press the button on the front of the machine labelled “TRAY”. Once the tray has stopped moving you can open the door. Inside, the machine has two positions for holding plates. Position A is on the left and position B is on the right. The plate assembly will only fit in one way with column 1 furthest away from the door due to a notch in the base plate of the plate assembly. Place the plate assembly into position. Close the door and wait to see the green light appear on the front of the machine, which indicates it is properly loaded. For the 3730. Open the stacker drawer of the Genetic Analyser, then open the In Stack door. Place the plate assemblies into the stacker with the plate(s) orientated so that the notched corner of the plate assembly is at the rear right corner of the stacker. Up to 16 plates can be placed in the “In Stack”. Close the In Stack door and then the stacker draw. Note: The In Stack is at the front of the stacker drawer with the “Out Stack” at the rear. Plates to be run are taken from the bottom of the stack and will then be at the top of the Out Stack once they have been run. Checking run reagents Check the polymer and buffers are within expiry dates. Check there is sufficient volume of polymer in the bottle for the run. Check for bubbles in the tubes (and small tank above) leading from the POP-7. If bubbles are present, an error could occur and your run will stop. To check for bubbles, switch on the light and look inside. Remember to turn off light once checked. Starting the run on the 3130xl In the Data collection program on the PC, select from the left-hand list 3130xl/ Run Scheduler in Plate View. Files which show “Processed” next to them are completed runs. Files which show “Pending” next to them are ready to be run. Laboratory techniques in rabies Fifth edition 40 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences When you locate your file, it should be Pending. You will see on the right of the screen two rectangles representing the two plate positions inside the machine. The colour of the rectangles means: Grey – no plate(s) in holder. Yellow – unlinked plate(s) in holder. Green – linked plate(s) in holder. Click once on the position that relates to your plate, position A (left) or position B (right). It should turn green. The Plate Record will now have A or B to the left of the name indicating the plate position that it is linked to. To start the run, click on the green arrow at the top left-hand corner of the window. A dialog box will appear telling you that you are about to start processing your plate. Click OK. Once the run is finished, check that the run has proceeded correctly and analysed sequence data are available. Starting the run on the 3730 In the Data collection program on the PC, select from the left-hand list 3730/ Run Scheduler in Plate View. Find the Plate Record file for the plate to be run first and highlight the file. Click on Add – this will add it to the list in the Input Stack dialog box with Status as Pending. Keep Adding plate records in the same order as the order they will be run, until all those to be run are in the In Stack dialog box. Plates can be added or removed during instrument operation. Click on Done to close the Add Plates to In Stack dialog box. Note: The Plate Record at the bottom of the list in the In Stack dialog box is marked “1” and will be run first, etc. If the sequencer is running, nothing further needs doing. If the sequencer is not running: to start your run, click on the green arrow at the top left hand corner of the window. A dialog box will appear telling you that you are about to start proces- sing your plate. Click OK. Once the run is finished, check that the run has proceeded correctly and analysed sequence data are available. Analysing output data The raw data will be generated in different formats depending on the sequencer used, but in general you would expect to obtain a chromatogram or trace from which you can derive the sequence (.seq or .fas file). From an ABI sequencer you would expect “.ab1” or “.abi” file formats (Fig. 29.1) whereas from a Beckman Laboratory techniques in rabies Fifth edition 41 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences sequencer you may expect a “.scf” file format. A number of software packages exist for analysing the data and generating consensus sequences from the replicate forward and reverse outputs (e.g. SeqMan in DNASTAR Lasergene). If the sequences are of good quality they will form a contiguous sequence (called a contig for short). The forward and reverse conti- guous sequences are aligned to generate consensus sequences (Fig. 29.1). If the consensus sequence saved is more than the required length it can be trimmed to the correct length by opening in a sequence editing programme (e.g. SeqMan or EditSeq in Lasergene 10 or MEGA www.megasoftware.net). Discussion Sanger sequencing is still beneficial to rabies diagnostic laboratories for confirming PCR-positive material, for determining the source of an outbreak or for understanding the molecular evolution of emerging viruses. Sequencing PCR products can now be achieved relatively inexpensively; the average sequencing run costs less than US $8. However, sequencing from PCR products may be error prone, particularly B y co ur te sy o f t he A ni m al a nd P la nt H ea lth A ge nc y, A dd le st on e, S ur re y, U ni te d K in dg om Fig. 29.1. Sanger sequencing of overlapping long-distance PCR amplicons (forward and reverse) facilitate genome sequencing via “Walking the genome”. The four ABI traces of four overlapping PCR products (RV2479, 1993 EBLV-2 M. daubentonii from Switzerland) yield contiguous sequences which are superimposed (aligned) to generate a consensus sequence (top frame) determined using the Seqman Programme (DNASTAR Lasergene 10) Laboratory techniques in rabies Fifth edition 42 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences when PCR products are first cloned to improve yield or study viral heterogeneity. Hence, the material from which the genome sequence is derived must be reported when publishing viral genomes. In addition to single nucleotide polymorphisms (SNPs) which may occur naturally following passage of the virus in vitro or in vivo, errors or biases can be introduced into the generated sequences during the PCR or cloning processes (13). Multiple sequence anomalies have already been demonstrated between institutes due to differences in sequencing approaches or sample handling (14). Next-generation sequencing will highlight similar sequen- cing anomalies in published data and has the potential to indicate the presence and prevalence of viral heterogeneity (quasispecies) in the original infected mate- rial. Viral sequences which represent only a minor proportion of the viral pool may be amplified during PCR, cloning or passage and therefore be misrepresented as the consensus sequence by Sanger sequencing. PCR sequence biases may be reduced by performing replicate sequencing reactions from replicate PCR reac- tions rather than relying on a single PCR test. Where possible, viral sequences should be derived from the original host rather than using multiple in vitro or in vivo passaged material. All viral sequences must be published, particularly if included in a peer reviewed journal (e.g. NCBI Nucleotide http://www.ncbi.nlm.nih.gov/nucleotide/). For future submissions, we strongly recommend using the most recent version of the standardized sequence submission software, Sequin, obtained from the NCBI website (www.ncbi.nlm.nih.gov/projects/Sequin/), which will harmonize sequence submissions and encourage submitting laboratories to include all essential data, including collection date, virus species, host species and country of isolation. References 1. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 1977;74:5463–7. PMID:271968. 2. Sacramento D, Bourhy H, Tordo N. PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol Cell Probes. 1991;5:229–40. PMID:1714538. 3. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoS Negl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 4. Johnson N, Letshwenyo M, Baipoledi EK, Thobokwe G, Fooks AR. Mole- cular epidemiology of rabies in Botswana: a comparison between antibody typing and nucleotide sequence phylogeny. Vet Microbiol. 2004;101:31–8. doi:10.1016/j.vetmic.2004.03.007. 5. Smith JS, Orciari LA, Yager PA, Seidel HD, Warner CK. Epidemiologic and historical relationships among 87 rabies virus isolates as determined by limited sequence analysis. J Infect Dis. 1992;166:296–307. PMID:1634801. Laboratory techniques in rabies Fifth edition 43 Sanger sequencing of lyssaviruses Part 5. Demonstration of viral nucleic acids and sequences 6. Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Viro- logy. 1993;194:70–81. doi:10.1006/viro.1993.1236. 7. McElhinney LM, Marston DA, Freuling CM, Cragg W, Stankov S, Lalosevic D, et al. Molecular diversity and evolutionary history of rabies virus strains circulating in the Balkans. J Gen Virol. 2011;92:2171–80. doi:10.1099/ vir.0.032748-0. 8. Johnson N, McElhinney LM, Smith J, Lowings P, Fooks AR. Phylogenetic comparison of the genus Lyssavirus using distal coding sequences of the glycoprotein and nucleoprotein genes. Arch Virol. 2002;147:2111–23. 9. Tordo N, Poch O, Ermine A, Keith G, Rougeon F. Walking along the rabies genome: is the large G-L intergenic region a remnant gene? Proc Natl Acad Sci U S A. 1986;83:3914–8. PMID:3459163. 10. Tordo N, Poch O, Ermine A, Keith G, Rougeon F. Completion of the rabies virus genome sequence determination: highly conserved domains among the L (polymerase) proteins of unsegmented negative-strand RNA viruses. Viro- logy. 1988;165:565–76. 11. Marston DA, McElhinney LM, Johnson N, Müller T, Conzelmann KK, Tordo N, et al. Comparative analysis of the full genome sequence of European bat lyssa- virus type 1 and type 2 with other lyssaviruses and evidence for a conserved transcription termination and polyadenylation motif in the G-L 3’ non-trans- lated region. J Gen Virol. 2007;88:1302–14. doi:10.1099/vir.0.82692-0. 12. Delmas O, Holmes EC, Talbi C, Larrous F, Dacheux L, Bouchier C, et al. Genomic diversity and evolution of the lyssaviruses. PloS One. 2008;3:e2057. doi:10.1371/journal.pone.0002057. 13. Marston DA, McElhinney LM, Ellis RJ, Horton DL, Wise EL, Leech SL, et al. Next generation sequencing of viral RNA genomes. BMC Genomics. 2013;14:444. doi:10.1186/1471-2164-14-444. 14. McElhinney LM, Marston DA, Leech S, Freuling CM, van der Poel WH, Eche- varria J, et al. Molecular epidemiology of bat lyssaviruses in Europe. Zoo Publ Health. 2013;60:35–45. doi:10.1111/zph.12003. Laboratory techniques in rabies Fifth edition 44 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Chapter 30 The FTA sampling method for collecting, storing brain material and identification of lyssaviruses Introduction The Flinders Technology Associates (FTA) cards or FTA® (e.g. FTA Gene Guard System) is a commercial paper-based system designed to fix and store nucleic acids – DNA and RNA – directly on contact from fresh tissues pressed into the pre-treated paper. The cards that are impregnated with a chaotropic agent under a patented chemical formula lyse cell membranes and denature proteins on contact. Infectious pathogens on contact with such cards are rendered inactive, allowing a shipment of samples at ambient temperature through normal mail routes (1–3). The ability of the FTA paper to inactivate the infectivity of lyssaviruses when stored on the paper for 2 h at room temperature has been demonstrated previously (4). Cell inoculation tests were undertaken to assess the inactivation of rabies virus (RABV) in the FTA Guard System by testing elutes from the filter paper on neuroblastoma cells. Negative results of the cell culture inoculation test performed on 50 µL of elutes from the paper confirmed the inactivation of five tested lyssavirus species, placed onto the paper and treated after drying for 2 h at room temperature. FTA cards have been demonstrated to preserve nucleic acids within the fibre matrix, allowing molecular characterization of RABV isolates (4, 5). The protocol for sampling, storage and shipment of rabies suspect brain samples impregnated on FTA cards is described. Methods Reagents • indicating FTA card [GE HealthCare Life Sciences] • dessicant pack (silica gel) • sterile PBS 1x, pH 7.3 • RNase-free water • 0.2 mL PCR tubes and sterile tubes (15 mL, 2 mL, 1.5 mL) • pipettes and sterile tips Laboratory techniques in rabies Fifth edition 45 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Protocol Precautions must be taken to avoid cross-contamination and false–positive results by strictly following the typical routine precautions in PCR protocols in this manual. Always wear laboratory clothing when handling biological samples and FTA cards and regularly change gloves to avoid contamination of samples. Preparation of FTA stabilized suspect samples 1. Homogenize 1 g of suspect brain tissue in 5 mL of PBS 1x in a 15 mL sterile conical centrifuge tube. 2. Centrifuge for 15 min at 2000 x g. 3. Remove 40 µL of clarified supernatant for its application on the FTA card. 4. Lift the cover of the card (Fig. 30.1) to expose the white sample areas. 5. Drop 40 µL of clarified supernatant evenly onto the spot, within the sample area, in a concentric circular motion. 6. Dry the card impregnated with the sample at room temperature for 2 h. 7. When the card is completely dry, put the impregnated FTA card within a sealable protective pouch with desiccant packs to adsorb moisture. 8. Store the impregnated cards in a cool dry environment at −20 °C until use. 9. As the cards inactivate infectious pathogens and as samples containing nucleic acids are not covered by the regulations on the transport of dangerous goods, the cards can be shipped at ambient temperature through normal mail routes. Preparation of an FTA disc for RNA extraction 1. Cut half of the dried spot with a scalpel, then cut it with sterile scissors into little pieces of 2 mm x 2 mm. 2. Place the little pieces in a 2 mL DNase or RNase-free tube. 3. Add 500 µL of PBS 1x. Vortex thoroughly for 10 s. 4. Incubate for 2 h at 4 °C. 5. Centrifuge for 3 min at 20 000 x g. 6. Remove the eluate by pipetting and transfer it to a new DNase or RNase-free tube; store the tube at 4 °C until RNA extraction, as described in the manual, depending upon the specific test. A representative agarose gel of the amplicons (1520-bp) produced by nested RT-PCR using two RABV isolates with, respectively, rabies primers JW12 and PVN8 followed by M13-JW12 and M13-PVN8bis, is shown in Fig. 30.2. Laboratory techniques in rabies Fifth edition 46 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences B y co ur te sy o f A N S ES , M al zé vi lle , F ra nc e Fig. 30.1. Sample Whatman FTA® cards FTA, Flinders Technology Associates B y co ur te sy o f A N S ES , M al zé vi lle , F ra nc e Fig. 30.2. Example of the amplification of the full nucleoprotein gene from two FTA® stabilized rabies virus samples; the RT-PCR was performed on 5 µL of viral RNA with primers JW12 and PVN8 followed by a second round of amplification with M13-JW12 and M13-PVN8bis, giving an amplicon of 1520-bp bp, base pair; RT-PCR, reverse transcriptase polymerase chain reaction Laboratory techniques in rabies Fifth edition 47 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences Discussion The chemical reagents impregnated in the FTA cards inactivate most pathogens and nucleases. The ability of the cards to inactivate the infectivity of RABV when stored on the paper for 2 h at room temperature has been demonstrated, as described (4). These cards have been demonstrated to preserve RABV RNA within the fibre matrix by conventional RT-PCR (6–8). Specimens for rabies diagnosis should be shipped within the UN3373 classi- fication (category B) with triple packaging to avoid any exposure hazards; for the RABV culture, category A transport practices should be applied (UN2814 classifi- cation). To achieve reliable diagnostic results, the specimen should be preserved by freezing during transport to the laboratory for rabies diagnosis. The result of RABV inactivation is that the stabilized FTA sample is no longer infectious and, subsequently, it can be shipped through normal mail routes for research studies. The advantages of FTA sampling have been demonstrated for the mole- cular characterization of RABV-infected samples with the amplification of partial nucleoprotein gene by conventional RT-PCR (4, 6, 8) as well as for the detection of numerous other infectious viruses, including Newcastle disease virus (3), infec- tious bronchitis virus (9, 10) or avian influenza virus (11). Laboratory techniques in rabies Fifth edition 48 FTA sampling method Part 5. Demonstration of viral nucleic acids and sequences References 1. Whatman. FTATM Nucleic Acid Collection, Storage and Purification. http://www. whatman.com/FTANucleicAcidCollectionStorageandPurification.aspx 2013. 2. Abdelwhab EM, Luschow D, Harder TC, Hafez HM. The use of FTA® filter papers for diagnosis of avian influenza virus. J Virol Methods. 2011;174:120–2. doi:10.1016/j.jviromet.2011.03.017. 3. Perozo F, Villegas P, Estevez C, Alvarado I, Purvis LB. Use of FTA filter paper for the molecular detection of Newcastle disease virus. Avian Pathol. 2006;35:93–8. doi:10.1080/03079450600597410. 4. Picard-Meyer E, Barrat J, Cliquet F. Use of filter paper (FTA) technology for sampling, recovery and molecular characterisation of rabies viruses. J Virol Methods. 2007;140:174–82. PMID:17157394. 5. Goharriz H, Marston DA, Sharifzoda F, Ellis RJ, Horton DL, Khakimov T, et al. First complete genomic sequence of a rabies virus from the Republic of Tajikistan obtained directly from a Flinders Technology Associates Card. Genome announcements. 2017;5:e00515-17 . doi:10.1128/genomeA.00515- 17. 6. Zeynalova S, Shikhiyev M, Aliyeva T, Ismayilova R, Wise E, Abdullayev R, et al. Epidemiological characteristics of human and animal rabies in Azerbaijan. Zoonoses Public Health. 2015;62:111–8. doi:10.1111/zph.12119. 7. Traore A, Picard-Meyer E, Mauti S, Biarnais M, Balmer O, Samake K, et al. Molecular characterization of canine rabies virus, Mali, 2006–2013. Emerg Infect Dis. 2016;22(5):866–70. doi:10.3201/eid2205.150470. 8. Nadin-Davis SA, Sheen M, Wandeler AI. Recent emergence of the Arctic rabies virus lineage. Virus Res. 2012;163:352–62. doi:10.1016/j. virusres.2011.10.026. 9. Moscoso H, Alvarado I, Hofacre CL. Molecular analysis of infectious bursal disease virus from bursal tissues collected on FTA filter paper. Avian Dis. 2006;50:391–6. PMID:17039839. 10. Ganapathy K, Ball C, Forrester A. Genotypes of infectious bronchitis viruses circulating in the Middle East between 2009 and 2014. Virus Res. 2015;210:198–204. doi:10.1016/j.virusres.2015.07.019. 11. Keeler SP, Ferro PJ, Brown JD, Fang X, El-Attrache J, Poulson R, et al. Use of FTA sampling cards for molecular detection of avian influenza virus in wild birds. Avian Dis. 2012;56:200–7. doi: 10.1637/9862-072611-Reg.1. Laboratory techniques in rabies Fifth edition 49 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Chapter 31 Application of next generation sequencing to rabies virus and other lyssaviruses Introduction Next generation sequencing (NGS) has revolutionized the ability to determine nucleic acid sequence by offering the unprecedented capacity to parallelize the sequencing reaction, allowing the generation of thousands-to-many-millions of short sequence fragments 70–800 base pairs (bp) in length (so-called “reads”), each reflecting individual input molecules. In contrast to the Sanger-based method, NGS instruments conduct sequencing and detection simultaneously, without the need for cloning steps or electrophoresis, the base interrogation being performed cyclically and in parallel. Since the advent of NGS, different platform formats have been developed, based on various approaches which have been extensively described elsewhere (1–5). Briefly, two different main categories exist: short-read and long-read sequen- cing. Short-read sequencing includes two main strategies, namely sequen- cing by ligation (for example ABI SOLiD-Life Technologies) and sequencing by synthesis (for example Illumina, Ion Torrent [Life Technologies] and Roche 454 [Roche Diagnostics]) platforms; the latter is no longer commercially available. This short-read sequencing category requires a clonal amplification step of the library to be able to obtain sufficient signal intensity for detection. The long-read category, which does not require any amplification steps, mainly corresponds to single-molecule sequencing platforms (i.e. Helicos [Helicos Biosciences], which is no longer commercially available, PacBio [Pacific Biosciences] and MinION/ GridION systems [Oxford Nanopore]). Similar to Sanger sequencing in its time, NGS methods have revolutionized biological research in various fields, including virology, and their impact is evident in the areas of genome sequencing, evolution, ecology, discovery and transcripto- mics (6). Application of these approaches is emerging in the field of lyssaviruses, and appears promising. Indeed, NGS enables researchers to obtain full-length genome sequences of rabies virus (RABV) or other lyssaviruses with low time and high cost effectiveness. This represents a major improvement at the level of the molecular characterization of each individual viral strain previously detected by reference diagnosis methods, including new lyssavirus species, but also to reach the highest level of resolution and robustness for any (spatiotemporal) phyloge- netic analysis, compared with those traditionally performed on a limited region of the virus genome. The massive number of sequence reads obtained for an individual isolate also offers the opportunity to investigate the viral intrinsic diver- sity (viral heterogeneity) previously hidden behind the consensus sequence (7). As this is a rapidly developing field, it is important to keep in mind that multiple variations of protocols to obtain full-length genome sequences of RABV or other lyssaviruses exist and that NGS methodologies are continuously evolving. Laboratory techniques in rabies Fifth edition 50 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences This chapter describes the main steps required to obtain genome sequences by NGS from sample preparation to bioinformatics analysis, illustrated with examples of protocols or methodologies which have been demonstrated to be effective for lyssaviruses. The Illumina-based sequencing remains the most widely used NGS sequen- cing approach in the area of virology, including in the rabies field. Consequently, this chapter will mostly focus on this methodology, although most of the sections can be transposable to other sequencing platforms. Methodology Preparation of samples The preparation of samples is a key step influencing the quality of the genome sequence which will be generated after NGS analysis. This section proposes diffe- rent protocols that are independent of whether specific or unspecific amplification is subsequently performed. These protocols can be applied to clinical samples such as human and animal brain tissues, human saliva or skin biopsies, or from viruses propagated in cell lines. They can also be applied to inactivated viral RNA material such as FTA cards or LFD strips. Protocol based on specific amplicon amplification This protocol is based on the use of primers which overlap and cover nearly the full-length genome of RABV (or other lyssavirus) isolates (8). The choice and the design of the primers as well as the number of primer pairs necessary will vary according to the isolates to be sequenced. Generally, six primer pairs are suffi- cient to cover the nearly complete genome (except the extremities), with amplicon lengths ranging from approximately 1500 to 2500 bp (base pairs). The primers can be degenerated to cover as much as possible the genetic diversity within the respective lyssavirus species, or within the corresponding specific phylogenetic clades or lineages. This approach is most effective when highly related viruses are being analysed, for example analysis of a rabies virus incursion or of viruses from the same geographical area, as the need for primer optimization will be less likely (9). RNA extraction The RNA extraction step is based on the use of TRIzol, following the manufac- turer’s recommendations (also presented in Chapter 27 on conventional RT-PCR). For skin biopsies, a preliminary step of lysis using proteinase-K is required before extraction. Extracted RNA are resuspended in 50 µL of RNase–DNase-free water for all samples. Laboratory techniques in rabies Fifth edition 51 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Generation of cDNA Step Reagent Volume per reaction (µL) Mix 1: pre-incubation (10 min at 70 °C), then place on ice at least 5 min before adding mix 2 pd(N)6 random primers (200 µg/mL) [Roche Diagnostics] 2 RNase–DNase-free water 2 RNA template 6 Total 10 Mix 2: incubation (10 min at 25 °C then 90 min at 50–55 °C followed by 5 min at 95 °C) 5X first-strand buffer 6 0.1 M DTT 2 dNTP mix (10 mmol) [Eurobio] 2 RNasin (40 U/µL) [Promega] 2 Superscript III RT (200 U/μL) 1 RNase–DNase-free water 7 Total 20 Final volume 30 In this protocol, this step is performed with SuperScript® III First-Strand Synthesis System for RT-PCR kit [Invitrogen], although various other commercial kits are available. All reagents are provided with the kit unless otherwise specified. Prepare the master mix as follows: The cDNA samples can be used directly for PCR amplification or conserved at −20 °C for long-term storage. PCR amplification This step requires the use of a high-fidelity proofreading DNA polymerase (e.g. Phusion High-Fidelity DNA Polymerase [Finnzymes] in this protocol) to mini- mize the introduction of errors during the amplification process. Nested PCR should be avoided for the same reason. All reagents are provided with the kit unless otherwise specified. Prepare the following master mix Reagent Volume per reaction (µL) 5X Phusion® HF buffer 10 10 mmol dNTPs (Thermo Scientific) 1 Forward primer (10 mmol) 2.5 Reverse primer (10 mmol) 2.5 Phusion® DNA polymerase 0.5 RNase-DNase free water 31.5 Total 48 Laboratory techniques in rabies Fifth edition 52 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Add 2 µL of cDNA and run the amplification with the following cycling parameters: Cycling step Temperature Time Number of cycles Initial denaturation 98 °C 30 s 1 Amplification 98 °C 10 s Determined by prim- ers used Determined by primers used 30 s 72 °C To be adapted Final elongation 72 °C 7 min 1 Pending 16 °C ∞ n/a The temperature of the annealing step as well as the time of elongation and the number of cycles must be adjusted according to the primers selected. Purification and preparation of amplicons Visualization of the amplified products after PCR is performed by electro- phoresis on agarose gel (1% generally, according to the size of amplicons). Verify the size of the observed band compared with the expected size of the amplicon using appropriate DNA size markers. Individually purify each amplicon directly for the electrophoresis gel using an appropriate gel purification kit (such as NucleoSpin Gel and PCR clean-up kit [Macherey Nagel]) according to the manufacturer’s recommendations. Quantify the purified amplicon using a fluorescence-based approach (e.g. Quant-iT PicoGreen dsDNA Assay Kit [Invitrogen]), according to the manufactu- rer’s recommendations. Pool all amplicons from the sample with equimolar proportions to obtain at least 1 ng of dsDNA and either use to prepare the NGS library, or conserve for long term storage at −20 °C. Protocol based on unbiased non-specific amplification Different protocols are available for the nonspecific amplification of genetic material. The protocol described below is based on the use of the whole-transcrip- tion amplification (WTA) protocol (QuantiTect Whole Transcriptome kit [Qiagen]) as previously described (10–12). This kit uses phi29 polymerase to generate large quantity of dsDNA from a low quantity of RNA. This protocol was successfully applied for the generation of complete genome sequences of EBLV-1 lyssaviruses. Laboratory techniques in rabies Fifth edition 53 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences RNA extraction After resuspension of the RNA pellet in 50 µL of RNase–DNase-free water, a purification step is performed (using RNeasy® mini kit [Qiagen]) and the corres- ponding cleaned-up protocol. Purified RNA is eluted in a final volume of 30 µL of RNase–DNase-free water. cDNA synthesis The final volume of cDNA is 20 μL. Unbiased nonspecific amplification Prepare the following master mix 1 on ice, add 10 μL of cDNA and incubate 22 °C for 2 h: Reagent Volume per reaction (µL) Ligation buffer 6 Ligation reaction 2 Ligation enzyme 1 1 Ligation enzyme 2 1 Total 10 Final (with cDNA) 20 Then prepare the following master mix 1 on ice, add all the previous 20 μL of ligated cDNA from mix 1 and incubate at 30 °C for 8 h, then at 95 °C for 5 min: Reagent Volume per reaction (µL) REPLI-g midi reaction buffer 29 REPLI-g midi DNA polymerase 1 Total 30 Final (with cDNA) 50 Store at 4 °C for short-term storage or at −20 °C for long-term storage. Protocol based on host nucleic-acid depletion without amplification steps Different protocols are available for the preparation of RNA for next genera- tion sequencing without the use of specific or non-specific amplification steps. Instead, these protocols are based on the removal of host nucleic acid using enzymatic depletion of host DNA and ribosomal RNA (rRNA). These protocols have been validated to the full-length genome sequencing of lyssaviruses directly from clinical or murine propagated samples (brain), and on cell culture propagated viruses (13), or even from other matrices such as FTA cards (14). Laboratory techniques in rabies Fifth edition 54 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences RNA extraction and host DNA depletion As previously described above (and presented also in Chapter 27 on conven- tional RT-PCR), extraction of total RNA can be performed using guanidinium isothiocyanate-phenol-chloroform-based extraction methods (e.g. TRIzol) or commercial column-based extraction kits (e.g. RNeasy Mini Kit [Qiagen]) following manufacturer’s recommendations, depending on the initial biological material. However, it is essential when sequencing samples that have not been selectively amplified that carrier RNA is not used in any part of the process. In addition, both of these approaches can be combined, as described: 1. Start total RNA extraction using TRIzol and follow the manufacturer’s recom- mendations until the phase separation step (obtained after addition of chloro- form and centrifugation). 2. Collect the upper aqueous phase in a separated tube and add an equal volume of 100–70% ethanol. 3. Continue the extraction using columns from the RNeasy Mini Kit through the loading of the sample (aqueous phase supplemented with 70–100% ethanol) onto the membrane of the column, then follow the manufacturer’s recommen- dations (split the volume and proceed to successive loading and centrifugation steps to ensure to load all the sample). In this protocol, choose to perform an on-column DNase I treatment (using RNase-free DNase set [Qiagen]) to eliminate as much as possible host DNA (after an incubation of 15 min at room temperature). Eluate the RNA in a final volume of 30 μL nuclease (RNase– DNase)-free water. rRNA depletion Different protocols are available for the specific depletion of rRNA. This deple- tion can be performed with a 5’-phosphate-dependent exonuclease that specifi- cally targets single stranded RNA with a 5’ monophosphate, including large rRNA such as 18S and 28S (e.g. Terminator™ 5’-Phosphate-Dependent Exonuclease [Epicentre Biotechnologies] (13)). This approach is not limited to host species. Another strategy uses a selective RNase H-based digestion to deplete unwanted RNA (including poly(rA) carrier and ribosomal RNA) from the viral RNA sample, based on specific oligonucleotides targeting rRNA. This protocol can be performed using commercial kits (e.g. NEBNext® rRNA Depletion Kit [New England Biolabs]), although they had been initially designed for a limited number of specific mamma- lian species (generally human, rat or mouse); however, in-house implementation of this protocol can be done (15), and specifically adapted to other animal hosts. Other commercial kits (e.g. Ribo-Zero-Gold (Epidemiology) Kit [Illumina] for rRNA depletion) are based on specific oligonucleotides coated on magnetic beads, hence avoiding the use of enzymes. The latter kit covers a wide range of applica- tion beyond the three initially designed species (human, mouse and rat), at least in silico (including dog) or after being used in large studies (16). The main drawbacks of all these commercial kits are the high cost per reaction as well as the relative specificity of host species of such reagents. These latter approaches have been successfully used with RNA viruses (15) and are under investigation with lyssa- viruses. However, only the protocol based on the Terminator™ 5’-Phosphate-De- pendent Exonuclease already used for lyssaviruses will be described here. Laboratory techniques in rabies Fifth edition 55 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Prepare the following master mix and incubate at 30 °C for 60 min. All reagents are provided with the kit unless otherwise specified. Reagent Volume per reaction (µL) RNA template 30 Buffer A 3.5 Terminator (1 U/μL) 1 RNAsin® ribonuclease inhibitor (20–40 U/μL) [Promega] 0.5 Total 35 Clean up using RNA solid phase reversible immobilization (SPRI) beads (Agen- court RNAClean XP SPRI beads [Beckman Coulter Genomics]) following the manufacturer’s recommendations or using the RNeasy Mini Kit without DNase digestion. Elute with 11 μL or 30 μL of RNase–DNase-free water, respectively. cDNA synthesis Use a volume of 8 μL of DNA–rRNA depleted RNA, to obtain a final volume of cDNA of 20 μL. Second-strand synthesis (15) This step can be also directly included in the library step, depending on the protocol used. Prepare the following master mix on ice: Reagent Volume per reaction (µL) RNase–DNase-free water 43 10x second-strand reaction buffer [New England Biolabs] 8 10 mmol dNTP mix [Eurobio] 3 E. coli DNA Ligase (10 U/μL) [New England Biolabs] 1 E. coli DNA Polymerase I (10 U/μL) [New England Biolabs] 4 E. coli RNase H (2 U/μL) [New England Biolabs] 1 1st strand reaction 20 Total volume 80 1. Add all the volume of cDNA (20 μL), vortex gently and centrifuge at 280 x g at room temperature for 1 min. Incubate for 2 h at −16 °C (keep lid at 25 °C) without allowing the temperature to rise above 16 °C. 2. Place the tubes on ice and inactivate reaction by adding 5 μL of 0.5 mol EDTA, mix gently and centrifuge at 280 x g at RT for 1 min. Laboratory techniques in rabies Fifth edition 56 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences 3. Clean up using DNA SPRI beads (Agencourt AMPure XP SPRI beads [Beckman Coulter Genomics]) following the manufacturer’s recommendations. Elute in a small volume (e.g. 9 μL RNase–DNAse-free water). Preparation of libraries The choice of the library preparation depends on several parameters, inclu- ding the choice of NGS platform and the amount of input of nucleic acid avai- lable. These aspects have been extensively described elsewhere (17, 18) and can also be found from the respective manufacturers. However, the main general steps are mostly similar and correspond to: (i) fragmenting and/or sizing the target nucleic acid to a desired length (mechanically or enzymatically-based); (ii) converting the target to dsDNA (this step can also be performed upstream, as described previously); (iii) attaching oligonucleotide adapters (to the ends of target fragments) that contain the necessary elements for immobilization on a solid surface and sequencing; (iv) amplification of the library; and (v) quantifying the final library product for sequencing. The level of multiplexing (i.e. the number of different tagged samples sequencing simultaneously) is also dependant on the library preparation. Depending on the choice in library preparation and in NGS platform, the format of the data generated after sequencing will vary, in terms of read length (generally from 100 bp to 350 bp [for Illumina technology]) and number of sequence reads (from several thousand to millions) and therefore in terms of sequence depth and percentage of genome coverage (see below). From a practical point of view, this preparation is mainly based on commer- cial kits according to the manufacturer’s recommendations and adapted to the respective sequencing platform, bearing in mind the technologies are regularly being updated and improved. In the field of rabies, several different protocols have been described; the most recent is associated with the Illumina technology (8, 13, 19), but will not be detailed in this chapter. However, optimization of library preparation may be necessary for DNA fragmentation and minimization of puri- fication steps in order to reduce sample loss and prevent cross-contamination. Bioinformatics analysis The bioinformatics process to obtain RABV and other lyssavirus genome consensus sequences is general to those used for other viruses and is broadly similar whatever the NGS platform used. The first step of this process is the cleaning of raw sequence (reads) data using adapted and validated parame- ters of quality control. Then the construction of the viral consensus sequence is performed, based on the mapping of the high-quality reads against a selected reference sequence. This consensus sequence is finally controlled and validated after a second mapping or a de novo assembling step. Cleaning of raw sequence data Raw sequence reads need to be pre-processed before use for subsequent genome sequence reconstruction in order to select only high-quality reads after filtering. Various parameters must be taken into account and adjusted for this process, all of which are relatively common irrespective of the NGS platforms considered. The first step is to eliminate adapter sequences (used during library preparation) and (if using amplicon-based sequencing) primer sequences. The other parameters are primarily based on the quality (through the Phred quality Laboratory techniques in rabies Fifth edition 57 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences score) associated with each individual base, and on the length of individual reads. For example, bases at either end of each read with a Phred quality score below a selected value are trimmed, and reads with length of less than another selected value after these processing steps are discarded, as well as those containing more than a specific proportion of low Phred quality score bases. Various work- flows for this pre-processing step are available (free of access or combined with specific software) and can be found in the literature (8, 19). Consensus sequence reconstruction After high-quality filtering of sequence reads, the reconstruction of the viral consensus sequence is based on a mapping approach. The principle is to try to position each read, according to specific parameters, to a reference full-length genome sequence which is as similar as possible to the expected sequence. In the field of lyssaviruses, the choice of this reference sequence could rely on the source of the virus isolate, i.e. its principal animal reservoir and the availabi- lity of already published complete genomes, etc. After this mapping step, a first consensus sequence is obtained and will serve as the new reference sequence for a second mapping step, using all the filtered reads, to obtain a final refined consensus sequence (8). Alternatively, the mapped reads can be used to perform a de novo assembly to generate a consensus sequence which can then be used as the new reference sequence for a last mapping step using all the filtered reads to generate the final consensus sequence (19). The majority nucleotide (> 50%) at each position, provided there is sufficient coverage, is generally used to gene- rate the consensus sequence. Various mapper and de novo assembler programs exist and are described elsewhere; they must be tested and adapted before use. A minimum mean coverage is necessary to obtain a reliable consensus genome sequence (see discussion section below), and sequence assembly should be visually inspected using appropriate software to evaluate the coverage along the genome sequence, at the level of each individual base. Additional information can also be obtained from the data generated by NGS sequencing. In particular, and depending on the average coverage (the “depth” of the sequence or the number of reads covering each nucleotide position), these NGS technologies offer the possibility (i) to determine the minority single nucleo- tide polymorphism (SNP) at each nucleotide position, after a specific percen- tage cut-off has been defined, and (ii) to explore the intrinsic diversity for each isolate (9, 20). Such analysis requires a coverage rate of hundreds to thousands of reads per base, as the highest resolution and reliability in terms of intrinsic diver- sity is associated with the greatest coverage obtained. For viruses that are divergent from known viruses (or where a full reference genome is not available) a difference approach is required, as described (21, 22). In such cases, after high-quality filtering of raw data, host sequences should be removed by mapping to a suitable host genome. Subsequently, the remaining non-host reads can be used for de novo assembly, and BLAST is used to find assembled contigs that correspond to viral genomes. Mapping can then be used as described above to ensure the accuracy of the consensus sequence. Laboratory techniques in rabies Fifth edition 58 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences Discussion This chapter presents several examples of different protocols already used and validated for the preparation of RABV and other lyssaviruses for NGS sequen- cing, and summarizes how to analyse the output data and generate a consensus genome sequence, mainly based on Illumina technology (which is currently the most widely used NGS platform). Special focus is given to the preparation of samples for NGS sequencing using three different strategies each with their own pros and cons. The first strategy, the amplicon-based protocol, provides homogeneous, deep coverage of the genome sequence of each sample, because the genetic mate- rial sequenced is exclusively viral. This approach is best adapted to obtain the consensus genome sequence relatively similar to a known sequence. The high depth of coverage permits the investigation of the intrinsic diversity at a low level. However, this must be interpreted with care as the amplification may have skewed the relative abundance of the minority variants, and errors may have been intro- duced by the amplification step, although they can be compensated for or mini- mized with the use of a high proof-reading DNA polymerase. The main disad- vantage of this method is the cost, both in the researcher’s time (in continued designing and optimizing of the primers) and in the reagents used. The second strategy is based on an unbiased nonspecific amplification of the extracted RNA, using for example a whole transcriptome amplification. The main advantage of this approach is to obtain a huge quantity of genetic material, espe- cially when working with precious and quantity-limited biological materials (e.g. with human CSF samples or saliva swabs), adapting to sequencing protocols requesting a large quantity of dsDNA or when additional tests are requested on starting material (e.g. RT-qPCR). In addition, because this protocol is nonspecific it can be used for any lyssaviruses or indeed any virus. Similar to the previous protocol, one of the main disadvantages, although unlikely, is the potential intro- duction of errors during the amplification steps. Furthermore, as the amplification is nonspecific, the amount of viral RNA remains proportionally low in relation to host RNA. The third strategy does not rely on any amplification but on the depletion of host RNA to increase the proportion of viral or host RNA in the samples to be submitted. This method addresses the disadvantages of the other approaches as there is no amplification, and it can be used to sequence any lyssavirus or virus. Depletion of host nucleic material is utilized to increase the proportion of viral RNA present, but will mean that there is generally limited input material. This can be mitigated by using a sequencing library kit that requires minimal input mate- rial (e.g. commercially available [Illumina NexteraXT]). However, in clinical tissue samples the percentage of reads that are viral is still low (usually < 5%), but a reliable consensus sequence can be obtained even with a relatively low cove- rage (see below). The low coverage occasionally results in an incomplete genome sequence, and can be less suitable for investigating the genetic intrinsic diversity, especially at a low level. Despite their differences, all protocols have been used to obtain the complete genome sequence of RABV and other lyssavirus isolates, or at least the complete coding regions (the genome extremities with the leader and the trailer regions Laboratory techniques in rabies Fifth edition 59 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences often absent or having low coverage for all of these approaches). However, the quality and the reliability of the consensus sequence obtained remain associated with the average depth of the coverage as well as with the number of reads per nucleotide position (this number varying along the genome sequence). In this context, it is essential at least to visualize and inspect the depth of coverage along the genome, particularly through adapted software and at least through a coverage graph, as well as to evaluate the proportion of each per nucleotide position (especially for positions or regions associated with very low coverage). For novel viruses, Sanger sequencing of PCR amplicons spanning low coverage regions, followed by remapping of NGS reads with the corrected consensus, may be required to confirm the sequence. However, it is very important to bear in mind that the methods used in NGS sequencing are constantly evolving, whether at the level of platforms, the prepa- ration of samples or the tools applied for data analysis. Before implementing this sequencing approach, it is necessary to ensure that the choice of the methodo- logy is cost effective and adapted to the needs and expected outcomes and to ensure that all steps have been validated, to be confident in the data generated. In parallel, remaining vigilant to the development of the methodology is recom- mended. The recent advent of NGS sequencing technologies has revolutionized various fields of biological sciences, including microbiology and virology in particular. One of the major impacts in the field of virology is observed with molecular epide- miological analysis. Indeed, NGS platforms offer the possibility to obtain rapidly and cost effectively the complete genome sequences of any virus compared with previous methods based on Sanger sequencing. In this context, NGS sequencing allows a complete molecular characterization of new isolates or lyssavirus species based on the complete genome sequence (21, 22) essential for the official valida- tion of new virus species, and represents now a useful tool for the quality control of viral vaccine strains found in live vaccines strains used for rabies vaccination in wildlife (7, 23). In parallel, the dramatic increase of genetic information available for each isolate enables more accurate and precise molecular epidemiological and phylogenetic analysis. Various recent examples illustrate this progress, especially with the 2014–2015 outbreak of Ebola virus infection in West Africa (24–26). In the rabies field, NGS has also been utilized to obtain full-length genome sequences which, combined with associated epidemiological data (such as animal host, location and date of collec- tion), already allows refined details to be obtained using phylogenomic analysis on the evolutionary history of lyssaviruses (27), as well as large-scale analysis of RABV (8) for a specific phylogenetic lineage (19) or for a specific geographical location. In addition, molecular analysis of complete genome sequences, at the level of the consensus sequence or at the level of the intra-host genetic diver- sity, provides important data to understand the cross-species transmission and mechanisms of new host adaptation frequently observed with RABV (8, 9). As the cost associated with NGS sequencing is reducing and protocols are becoming standardized, it is now evident that the widespread use of this sequen- cing approach will significantly improve our capacity to understand the drivers of transmission (28), providing important data for the prevention and control of rabies. Laboratory techniques in rabies Fifth edition 60 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences References 1. van Dijk EL, Auger H, Jaszczyszyn Y, Thermes C. Ten years of next-genera- tion sequencing technology. Trends Genet. 2014;30:418–26. doi:10.1016/j. tig.2014.07.001. 2. Mardis ER. Next-generation sequencing platforms. Annu Rev Anal Chem (Palo Alto Calif). 2013;6:287–303. doi:10.1146/annurev-anchem-062012-092628. 3. Mardis ER. DNA sequencing technologies: 2006–2016. Nat Protoc. 2017;12:213–8. doi:10.1038/nprot.2016.182. 4. Metzker ML. Sequencing technologies – the next generation. Nat Rev Genet. 2010;11:31–46. doi:10.1038/nrg2626. 5. Goodwin S, McPherson JD, McCombie WR. Coming of age: ten years of next-generation sequencing technologies. Nat Rev Genet. 2016;17:333–51. doi:10.1038/nrg.2016.49. 6. Radford AD, Chapman D, Dixon L, Chantrey J, Darby AC, Hall N. Applica- tion of next-generation sequencing technologies in virology. J Gen Virol. 2012;93:1853–68. doi:10.1099/vir.0.043182-0. 7. Hoper D, Freuling CM, Muller T, Hanke D, von Messling V, Duchow K, et al. High definition viral vaccine strain identity and stability testing using full-ge- nome population data – The next generation of vaccine quality control. Vaccine. 2015;33:5829–37. doi:10.1016/j.vaccine.2015.08.091. 8. Troupin C, Dacheux L, Tanguy M, Sabeta C, Blanc H, Bouchier C, et al. Large-scale phylogenomic analysis reveals the complex evolutionary history of rabies virus in multiple carnivore hosts. PLoS Pathog. 2016;12:e1006041. doi:10.1371/journal.ppat.1006041. 9. Borucki MK, Chen-Harris H, Lao V, Vanier G, Wadford DA, Messenger S, et al. Ultra-deep sequencing of intra-host rabies virus populations during cross-species transmission. PLoS Negl Trop Dis. 2013;7:e2555. doi:10.1371/ journal.pntd.0002555. 10. Dacheux L, Berthet N, Dissard G, Holmes EC, Delmas O, Larrous F, et al. Application of broad-spectrum resequencing microarray for genotyping rhabdoviruses. J Virol. 2010;84:9557–74. doi: 10.1128/JVI.00771-10. 11. Dacheux L, Cervantes-Gonzalez M, Guigon G, Thiberge JM, Vandenbogaert M, Maufrais C, et al. A preliminary study of viral metagenomics of French bat species in contact with humans: identification of new mammalian viruses. PLoS One. 2014;9:e87194. doi:10.1371/journal.pone.0087194. 12. Joffret ML, Bouchier C, Grandadam M, Zeller H, Maufrais C, Bourhy H, et al. Genomic characterization of Sebokele virus 1 (SEBV1) reveals a new candi- date species among the genus Parechovirus. J Gen Virol. 2013;94:1547–53. doi:10.1099/vir.0.053157-0. 13. Marston DA, McElhinney LM, Ellis RJ, Horton DL, Wise EL, Leech SL, et al. Next generation sequencing of viral RNA genomes. BMC Genomics. 2013;14:444. doi:10.1186/1471-2164-14-444. 14. Goharriz H, Marston DA, Sharifzoda F, Ellis RJ, Horton DL, Khakimov T, et al. First complete genomic sequence of a rabies virus from the Republic Laboratory techniques in rabies Fifth edition 61 Application of next generation sequencing Part 5. Demonstration of viral nucleic acids and sequences of Tajikistan obtained directly from a Flinders Technology Associates card. Genome Announc. 2017;5 e00515-17. doi:10.1128/genomeA.00515-17. 15. Matranga CB, Gladden-Young A, Qu J, Winnicki S, Nosamiefan D, Levin JZ, et al. Unbiased deep sequencing of RNA viruses from clinical samples. J Vis Exp. 2016;113. doi:10.3791/54117. 16. Shi M, Lin XD, Tian JH, Chen LJ, Chen X, Li CX, et al. Redefining the inverte- brate RNA virosphere. Nature. 2016;540:539–43. doi:10.1038/nature20167. 17. Head SR, Komori HK, LaMere SA, Whisenant T, Van Nieuwerburgh F, Salomon DR, et al. Library construction for next-generation sequencing: overviews and challenges. Biotechniques. 2014;56:61–4, 6, 8, passim. doi:10.2144/000114133. 18. van Dijk EL, Jaszczyszyn Y, Thermes C. Library preparation methods for next-generation sequencing: tone down the bias. Exp Cell Res. 2014;322:12– 20. doi:10.1016/j.yexcr.2014.01.008. 19. Hanke D, Freuling CM, Fischer S, Hueffer K, Hundertmark K, Nadin-Davis S, et al. Spatio-temporal analysis of the genetic diversity of Arctic rabies viruses and their reservoir hosts in Greenland. PLoS Negl Trop Dis. 2016;10:e0004779. 20. Borderia AV, Stapleford KA, Vignuzzi M. RNA virus population diversity: implications for inter-species transmission. Curr Opin Virol. 2011;1:643–8. doi:10.1371/journal.pntd.0004779. 21. Marston DA, Ellis RJ, Horton DL, Kuzmin IV, Wise EL, McElhinney LM, et al. Complete genome sequence of Ikoma lyssavirus. J Virol. 2012;86:10242–3. doi:10.1128/JVI.01628-12. 22. Marston DA, Ellis RJ, Wise EL, Arechiga-Ceballos N, Freuling CM, Banyard AC, et al. Complete genome sequence of Lleida bat lyssavirus. Genome Announc. 2017;5:e01427-16. doi:10.1128/genomeA.01427-16. 23. Cliquet F, Picard-Meyer E, Mojzis M, Dirbakova Z, Muizniece Z, Jaceviciene I, et al. In-depth characterization of live vaccines used in Europe for oral rabies vaccination of wildlife. PLoS One. 2015;10:e0141537. doi:10.1371/journal. pone.0141537. 24. Carroll MW, Matthews DA, Hiscox JA, Elmore MJ, Pollakis G, Rambaut A, et al. Temporal and spatial analysis of the 2014–2015 Ebola virus outbreak in West Africa. Nature. 2015;524:97–101. doi:10.1038/nature14594. 25. Dudas G, Carvalho LM, Bedford T, Tatem AJ, Baele G, Faria NR, et al. Virus genomes reveal factors that spread and sustained the Ebola epidemic. Nature. 2017;544:309–15. doi:10.1038/nature22040. 26. Holmes EC, Dudas G, Rambaut A, Andersen KG. The evolution of Ebola virus: insights from the 2013–2016 epidemic. Nature. 2016;538:193–200. doi:10.1038/nature19790. 27. Hayman DT, Fooks AR, Marston DA, Garcia RJ. The global phylogeography of lyssaviruses – challenging the “Out of Africa“ Hypothesis. PLoS Negl Trop Dis. 2016;10:e0005266. doi:10.1371/journal.pntd.0005266. 28. Dellicour S, Rose R, Faria NR, Vieira LFP, Bourhy H, Gilbert M, et al. Using viral gene sequences to compare and explain the heterogeneous spatial dynamics of virus epidemics. Mol Biol Evol. 2017;34:2563–71. doi:10.1093/molbev/msx176. Laboratory techniques in rabies Fifth edition 62 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Chapter 32 Reverse transcriptase loop-mediated isothermal amplification system for the detection of rabies virus Introduction Innovative loop-mediated isothermal amplification (LAMP) (1,2) provides a rapid, simple, sensitive and inexpensive method for amplifying specific DNA sequences. The technique was first demonstrated in 2000 (3). LAMP depends on the autocy- cling of strand-displacement DNA synthesis conducted by Bst DNA polymerase. This reaction proceeds without denaturation of DNA templates (4) and thus can be performed at an isothermal temperature. It provides high amplification efficiency with DNA being amplified 109–1010 times in 15–60 min. The amplified products consist of a series of stem-looped DNA in various lengths (5). The results can be determined by visual inspection of the turbidity due to precipitation of white magnesium pyrophosphate, a byproduct of DNA synthesis (6), or by visual and ultraviolet (UV) inspection of DNA amplification with a fluorescent dye (7). For the amplification of target RNA, the RT (reverse transcriptase) LAMP method can synthesize cDNA from target RNA and the LAMP technology applied to amplify the resultant cDNA. After mixing and incubating at a constant tempe- rature between 60 °C and 65 °C, amplification and detection can be carried out in a single step. The RT-LAMP method has potential application for detection of pathogens and has been developed for the diagnosis of many RNA viral diseases. For rabies virus (RABV), several examples of the application of this method have been reported (8–13). Materials Reagents • AMV reverse transcriptase [New England Biolabs] • Bst DNA polymerase [New England Biolabs] • Betaine [Sigma] • 10×ThermoPol II (Mg-free) reaction buffer [New England Biolabs] • dNTPs (100 mmol) • MgSO4 • Purified primers (HPLC or Cartridge purification grade) These reagents, as a mixture that excludes the specific primers to be used, are commercially available [as Loopamp RNA Amplification Kit (RT-LAMP) from EikenChemical (5)]. Laboratory techniques in rabies Fifth edition 63 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Primer set for RT-LAMP To assess the applicability of RT-LAMP, a primer set can be designed by using PrimerExplorer V4 software (14) or LAMP designer software (15). The primer sets for RABV detection used in the previous studies are shown in Table 32.1. The concept of primer design for effective gene amplification and elongation reac- tions can be explored by an accessible animation on the Eiken GENOME SITE (5). The standard set of four primers (F3, B3, FIP, BIP) consisting of two outer primers and two inner primers is basically used for the gene amplification in RT-LAMP (Fig.  32.1). The outer primers are referred to as the forward outer primer (F3) and the backward outer primer (B3). The two inner primers are referred to as the forward inner primer (FIP: F1c+F2) and the backward inner primer (BIP: B1c+B2). The  use of the primers through OPC (oligonucleotide purification cartridge) or HPLC (high-performance liquid chromatography) purification is advisable. Two further loop-binding primers (FLoop and BLoop) have been optionally added to increase the rate of strand displacement and synthesis. RT-LAMP, reverse transcriptase loop-mediated isothermal amplification Fig. 32.1. Schematic diagram of RT-LAMP primers showing the position of the six primers spanning the target gene The inner primers FIP (BIP) are composed of F2 (B2) and F1c (B1c). The outer primers are at the region of F3 and B3. The loop primers Floop and Bloop are designed between F1c (B1c) and F2c (B2c). The U (Uracil) on target RNA sequence will be transcribed into T (thymine) for primer design. B y co ur te sy o f T ak uy a Ito u, W an da M ar ko tt er a nd L ou is N el ; p ar tia lly ad ap te d w ith p er m is si on fr om th e Ei ke n G EN O M E S IT E, E ik en C he m ic al Laboratory techniques in rabies Fifth edition 64 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Primer Sequence (5’–3’) Position Target strain Reference C-F3 ACATGTCCGGAAGACT 250–265 CVS-11 (8) C-B3 CAGACTCAGGAGAAGACC 424–441 C-BLP GGCATGGAATTGACAAGGGACC 373–394 C-FIP ACTAGAGAGTTTGGGGTGA-GGACCAGCTATGGAATCC 308–326+266–283 C-BIP ACGGGAATTGGGCTCTGAC-CTAAAGATGCATGTTCAG 350–368+403–421 P-F3 ACATGCCCTGAAGATT 250–265 Philippines dog (8) P-B3 AAGACTCAGGAGAAGACC 424–441 P-BLP GGTAGGAGCTGACAAGGGACC 373–394 P-FIP ACAAGGGAATCAGGGGTGA-GGACTAGCTATGGGATCT 308–326+266–283 P-BIP AAGGAAATTGGGCTCTGAC-CTAAAGACGCATGTTCTG 350–368+403–421 F3 GCCCCCGACTTAAACAAAGC 118–137 PV (Cosmopolitan lineage and vampire bat lineage) (9) B3 TTCCCCTCTACATCAGTACG 319–338 FIP ACTGCATTGCTGCTGCCAAGTA-GCATGAACGCCGCCAAAC 199–220+158–175 BIP TGTCCGGAAGACTGGACCAGCT-ACAAGAGAATCTGGGGTGAT 235–256+289–308 FLoop GGAGCATACATCATCAGGATCNA 176–198 BLoop ATGGAATCCTGATTGCACGAMA 257–278 Rab1F3 AGCCCCCGACTTAAACAAAG* –# Cosmopolitan lineage (10) Rab1B3 CTGTCAGAGCCCAATTTCCT* – Rab1FIP GCATTGCTGCTGCCAAGTAGGATTTTCAGGCATGAATGCAGCCA* – Rab1BIP CGTGTCCAGAAGACTGGACCAGTTTTATTTCCACCAGAGAATCC* – Rab1FLOOP ACATACATCATCAGGATCAAGT* – Rab1BLOOP CTATGGAATCTTGATCGCACG* – Rab4F3 GCCCCCGATTTGAACAA* – Arctic lineage (10) Rab4B3 GGGAATTGGGCTTTGACG* – Rab4FIP ACTGCATCGCAGCTGCTAAGTAGGATTTTCAGGCTTGAATGCTGCCAA* – Rab4BIP CATGTCCTGAAGACTGGACCAGTTTTATCTCCACAAGAGAATCTGGGGT* – Rab4FLOOP ACATACATCAGGATCAAGC* – Rab4BLOOP CTATGGGATCTTGATTGCAAG* – F3 GAAAAGGAGACAAGATCACC 363–382 PV (Africa 1b lineage) (11) B3 CCGGTGTTTTGTCCTGAT 528–545 FIP CCTTGTCAGCTCCATGCCTCCCGGACTCTCTAGTGGAAAT 383–460 BIP ACCCCACTGTCTCTGAGCATTGCTCAACCTATACAGACTCA 461–524 CVSF3 AGCCCCCGACTTGAACAAAG – CVS (12) CVSB3 CTGTCAGAGCCCAATTCCCG – CVSFIP GCATTGCTGCTGCCAAGTAGGATTTTCAGGCATGAATGCCGCCAA – CVSBIP CATGTCCGGAAGACTGGACCAGTTTTATCTCCACTAGAGAGTTTGG – CVSFLOOP GCATACATCCGGATCAAGT – CVSBLOOP CTATGGAATCCTGATTGCACG – Deg-F3 Deg-B3 Deg-FIP Deg-BIP Deg-LF Deg-LB YCCWGATGATGTRTGYTCCTA AGTTRCCRGTGTTYTGYC TATYTCYACMAGAGAATCYGGR+GAYTGGACCAGCTAYGGR GACNGGAGGAATGGARYTRAC+ACTCAARAGAAGACRACTAA RTCYCCTTTYCKTGCRATCAR CCACTGTYYCYGAGCATG 268–288 534–551 382–403+332–349 436–456+488–508 353–373 465–482 Indian RABV strains (13) *1 The combination of these 12 primers was examined and deemed feasible for use via RT-LAMP. See reference 10 for the optimal concentration of each primer. # No information Table 32.1. Details of oligonucleotide primers designed to detect rabies virus using RT-LAMP Laboratory techniques in rabies Fifth edition 65 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Equipment • For real-time turbidity detection – Loopamp Realtime Turbidimeter [Eiken Chemical] • For visual and real-time fluorescence detections – Incubator (temperature accuracy within ±  0.5 °C) and fluorescence scanner (e.g. ordinary real-time PCR detection system or ESEQuant Tube Scanner [Qiagen]) – Heat block (for termination of the LAMP reaction) – UV transilluminator (wavelength at 240–260 nm or 350–370 nm) Several additional methods for detection are reviewed by Zhang and collea- gues (16). Biologicals and sample preparation For detection, brain samples are used. Viral RNA extraction of RABV from brain tissue is undertaken as described in Chapter 27 on RT-PCR. Commercial extrac- tion kits (such as the QIAamp Viral RNA Kit [Qiagen] and TRIzol [Life Technologies or Invitrogen]) are available. Methods Preparation of master mix 1. After frozen reagents are thawed at room temperature, prepare the following master mix on ice. Once the reagents are thawed, keep them on ice. Composition of master mixa Reagents Amount/final concentration 10×ThermoPol II (Mg-free) reaction buffer 2.5 μL dNTPs 0.5–1.0 mmol each MgSO4 8 mmol Betaine (Sigma) 1 mol Bst DNA polymerase 8–16 units AMV reverse transcriptase (or equivalent enzyme) 0.2–1.0 U Primer: FIP 40 pmol BIP 40 pmol FLoopb 20 pmol BLoopb 20 pmol F3 5 pmol B3 5 pmol RNase–DNase-free sterile water X μL (ad q.s.) Total 20.0 μL/tube a Master mix reagents excluding primers are replaced by reaction mix and enzyme mix in Loopamp RNA Amplification Kit (RT-LAMP). b These loop primers are optional and their use is merely to accelerate the LAMP reaction. Laboratory techniques in rabies Fifth edition 66 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences 2. For real-time fluorescence detection, add a fluorescent dye such as 1 μL of fluorescent detection reagent [Eiken Chemical] or 0.4 μmol of SYTO-9 green fluorescent dye [Life Technologies] and maintain the total mixture amount of 20 μL. 3. After dispensing, gently tap the tubes for a few times, or mix the solution by repeatedly inversing the tube, or mix thrice by vortexing for 1 s. After mixing well, centrifuge the tubes for a few seconds. Avoid too much vortexing because of enzyme inactivation. The master mix should be prepared immediately before use. Mixing of master mix and sample (on ice) 1. Dispense 20 μL of the master mix into a micro tube. 2. Add 5 μL of extracted sample RNA to the master mix; the volume should be 25 μL in total. For the negative control reaction, use 5 μL of water instead of sample RNA. Thoroughly mix the solution by pipetting or tapping the tube with the cap closed and then spin down. Take care not to create air bubbles when mixing. Amplification reaction 1. Place the reaction tubes in a turbidimeter, fluorescence scanner or the incu- bator, and incubate at 60–65 °C for 30–60 min. (The reaction condition must be optimized for specific primers sets.) 2. Inactivate the enzyme and terminate the reaction by incubating the mixture for 2 min at 95 °C. Detection and interpretation of results Turbidity detection The turbidity of magnesium pyrophosphate, a byproduct of the LAMP reaction, is formed in proportion to the amount of amplified products. Since LAMP can yield extremely high amounts of amplified products, white turbidity can be visually observed. Real-time turbidity detection can be conducted with the turbidimeter (e.g. Loopamp Realtime Turbidimeter). An example is shown in Fig. 32.2. Fluorescence detection Visual fluorescence detection can be achieved by the addition of 2 μL of 10–100-fold diluted SYBR Green I [Lonza] to the reaction tube after the amplifica- tion reaction (Fig. 32.3). An ultraviolet transilluminator and protective goggles are required. The fluorescence of samples should be evaluated by comparison with the positive and negative controls. The incubation can be done in commercially available incubators or in the Loopamp Realtime Turbidimeter [Eiken Chemical]. Real-time fluorescence detection can be conducted with a fluorescence scanner (ordinary real-time PCR detection system or ESEQuant Tube Scanner [Qiagen]). Laboratory techniques in rabies Fifth edition 67 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences RT-LAMP, reverse transcriptase loop-mediated isothermal amplificationBy c ou rt es y of th e U ni ve rs ity o f P re to ria , S ou th A fr ic a Fig. 32.2. Real-time monitoring of the representative results of the RT-LAMP assay The solid line shows the RT-LAMP reaction of a RABV-positive sample. The dotted line shows the reaction of a negative sample. The inset shows representative tubes after the RT-LAMP reaction. A positive reaction is represented by the formation of magnesium pyrophosphate, a white precipitate by-product. RT-LAMP, reverse transcriptase loop-mediated isothermal amplification Fig. 32.3. Visual inspection with SYBR Green I after RT-LAMP The panels U and V indicate the results under ultraviolet and visible lights, respectively. P, RABV-positive sample; N, negative control B y co ur te sy o f t he U ni ve rs ity o f P re to ria , S ou th A fr ic a Laboratory techniques in rabies Fifth edition 68 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Electrophoresis To avoid contamination, extra care should be taken when handling the amplifi- cation products during the electrophoresis process. The reaction solution is analysed on a 2% agarose gel (1–2 μL.) A typical ladder pattern can be observed after electrophoresis (Fig. 32.4), as the amplified products consist of various sizes of inverted repeats of the target sequence on the same strands. Validation of the specificity of LAMP reaction To validate whether the amplified product is derived from the target region, sequencing or restriction, enzyme digestion of the amplicon can be undertaken. Discussion The RT-LAMP technology has remarkably high amplification efficiency, achie- ving highly sensitive detection of specific nucleotide sequences in about 1 h. Its sensitivity is 10–1000 times higher than that of conventional RT-PCR (8, 9) and equivalent to real-time RT-PCR (12). Thus, the RT-LAMP is a promising technology for simple and rapid genetic detection of RABV. The LAMP reactions also have high specificity and can discriminate slight differences in the sequences of the target genes because the length of binding sites complementary to LAMP primers are longer than that of PCR primers. Hence, the design of LAMP primers with high sensitivity and specificity is crucial to the success of LAMP analysis. The LAMP primer sets in previous studies using RT-LAMP for RABV detection all targeted the nucleoprotein gene, which is relatively conserved among RABV variants. Fig. 32.4. Agarose gel electrophoresis of RT-LAMP product M, 100 bp (base pair) ladder marker; P, RABV-positive sample; N, negative control B y co ur te sy o f t he U ni ve rs ity o f P re to ria , S ou th A fr ic a Laboratory techniques in rabies Fifth edition 69 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences Saitou and colleagues reported a risk for false–negative results in RT-LAMP when applied to RABV isolates from different parts of the world, depending on the primers selected (9). In most geographical areas, multiple genetic lineages of RABV exist, and the development of primer sets based on DNA sequencing data is recommended. Ultimately, universal RT-LAMP primer sets which can detect all lyssavirus species worldwide will be ideal. Hayman and colleagues demonstrated that RT-LAMP successfully detects multiple lineages of African RABV by using a combination of two sets of LAMP primers, a total of 12 primers (10). Additional evaluations using these primer sets or improved primers are necessary for the development of universal sets. The RT-LAMP is prone to the same challenges as other molecular detection techniques, such as cross-contamination during the opening of the tubes due to the high amplification efficiency. To avoid false positive–results by contamina- tion, the samples and reagents should be prepared in dedicated areas; the use of multiple negative controls between samples is recommended. The RT-LAMP technique is inexpensive and can be performed without the need for a thermal cycler. Results can also be detected by a portable scanner (e.g. ESEQuant Tube Scanner [Qiagen]) and adapted to an easy-to-use lateral flow device format for visual detection of LAMP products (10). Therefore, the RT-LAMP can be useful in low resource settings where rabies incidence is usually the highest. References 1. Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP): recent progress in research and development. J Infect Chemother. 2013:19:404–411. doi:10.1007/s10156-013-0590-0. 2. Notomi T, Mori Y, Tomita N, Kanda H. Loop-mediated isothermal amplification (LAMP): principle, features, and future prospects. J Microbiol. 2015;53:1–5. doi:10.1007/s12275-015-4656-9. 3. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28:E63. PMID:10871386. 4. Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T. Loop-mediated isothermal amplification reaction using a non-denatured template. Clin Chem. 2001;47:1742–43. PMID:11514425. 5. Eiken GENOME SITE In: Eiken Chemical Co. Ltd. [website] (http://loopamp. eiken.co.jp/e/, accessed 1 October 2018). 6. Mori Y, Nagamine K, Tomita N, Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyro- phosphate formation. Biochem Biophys Res Commun. 2001;289:150–54. doi:10.1006/bbrc.2001.5921. 7. Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplifica- tion (LAMP) of gene sequences and simple visual detection of products. Nat Protoc. 2008;3:877–82. doi:10.1038/nprot.2008.57. Laboratory techniques in rabies Fifth edition 70 Reverse transcriptase loop-mediated isothermal amplification system Part 5. Demonstration of viral nucleic acids and sequences 8. Boldbaatar B, Inoue S, Sugiura N, Noguchi A, Orbina JR, Demetria C, et al. Rapid detection of rabies virus by reverse transcription loop-mediated isothermal amplification. Jpn J Infect Dis. 2009;62:187–91. PMID:19468177. 9. Saitou Y, Kobayashi Y, Hirano S, Mochizuki N, Itou T, Ito FH, et al. A method for simultaneous detection and identification of Brazilian dog- and vampire bat-related rabies virus by reverse transcription loop-mediated isothermal amplification assay. J Virol Methods. 2010;168:13–7. doi:10.1016/j. jviromet.2010.04.008. 10. Hayman DT, Johnson N, Horton DL, Hedge J, Wakeley PR, Banyard AC, et al. Evolutionary history of rabies in Ghana. PLoS Negl Trop Dis. 2011;5:e1001. doi:10.1371/journal.pntd.0001001. 11. Muleya W, Namangala B, Mweene A, Zulu L, Fandamu P, Banda D, et al. Molecular epidemiology and a loop-mediated isothermal amplification method for diagnosis of infection with rabies virus in Zambia. Virus Res. 2012;163:160–68. doi:10.1016/j.virusres.2011.09.010. 12. Fooks AR, Johnson N, Freuling CM, Wakeley PR, Banyard AC, McElhinney LM, et al. Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century. PLoSNegl Trop Dis. 2009;3:e530. doi:10.1371/ journal.pntd.0000530. 13. Reddy RVC, Satya AK, Surendra KSNL, Rana SK, Subramanian BM, Sharma GK, et al. Reverse transcription loop-mediated iso-thermal amplifi- cation (RT-LAMP) assay for the detection of rabies virus. Adv Anim Vet Sci. 2016:4:584–92. doi:10.14737/journal.aavs/2016/4.11.584.592. 14. PrimerExplorer. In: LAMP primer designing software [website]. Kanagawa: Fujitsu Limited; 1999–2005 (http://primerexplorer.jp/e/, accessed 1 October 2018). 15. LAMP primer designer software [website]. Kanagawa: Fujitsu Limited; 1999– 2005 (http://primerexplorer.jp/e/, accessed 1 October 2018). 16. Zhang X, Lowe SB, Gooding JJ. Brief review of monitoring methods for loop-mediated isothermal amplification (LAMP).  Biosen Bioelectron. 2014;61:491–9. doi:10.1016/j.bios.2014.05.039. Laboratory techniques in rabies Fifth edition 71 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Chapter 33 Detection of lyssavirus nucleic acids by in situ hybridization Introduction Gold standard methods for the detection of rabies virus (RABV) and other lyssa- viruses, such as the direct fluorescent antibody test (DFAT; see Chapter 11), or current molecular methods, such as reverse transcriptase polymerase chain reac- tion (RT-PCR; see Chapter 27), require the use of fresh or fresh frozen samples, and their sensitivity may be impaired by autolytic and putrefactive changes (1). Formalin fixation is widely and routinely used to preserve tissues for histopatho- logy. On occasions when maintaining a suitable cold chain or accessing diagnostic laboratories with specialized equipment is a challenge, formalin fixation provides an alternative method for maintaining sample integrity for downstream testing. However, the performance of DFAT and molecular methods for RABV detection is less optimal in formalin-fixed and in formalin-fixed, paraffin-embedded (FFPE) tissues due to formalin-induced cross linking, RNase activation and RNA frag- mentation, or both (2,3). Alternative histopathological methods for the detection of RABV in FFPE samples have been developed, including immunohistochemistry and in situ hybri- dization (ISH). ISH allows the detection of specific nucleic acid sequences in morphologically preserved cells and tissues, and the visualization of messenger RNA (mRNA) and genomic RNA (gRNA) of lyssaviruses at cellular and subcellular level for diagnosis, virus typing and viral pathogenesis studies. Originally, radioactive-labelled RNA probes were used for the detection of nucleocapsid protein mRNA and gRNA in the central nervous system of RABV-in- fected mice (3). Radioactive probes were also used for the detection of RNA enco- ding all five RABV proteins in mice and human brains (5) and to evaluate the effect of autolysis up to 72 h in the detection of virus RNA by ISH (6). Jackson and Rintoul showed that autolysis resulted in a noticeable progressive reduction of the ISH signal, less marked for the detection of RABV antigens. The detection of RABV mRNA in mouse brains using digoxigenin (DIG)-labelled RNA probes demonstrated the advantages of this method over the use radioactive probes (7). DIG-labelled probes were used subsequently to detect RABV RNA in experimen- tally infected mouse and human brains (8, 9). DIG-labelled probes have also been designed and used on FFPE tissues to discriminate and type RABV, based on P gene sequences and allowing for retrospective typing (10). Such use has also differentiated RABV, European bat lyssavirus type 1 (EBLV-1) and type 2 (EBLV-2), targeting the N gene (11). Fluorescent in situ hybridization (FISH) methods using biotinylated oligonucleotide probes on fixed RABV-infected cell cultures have shown that all viral RNAs (genome, antigenome and mRNA) are present in the inclusion bodies or Negri body-like structures developed in infected cells, indi- cating that viral transcription and replication occur in these structures (12). Using Laboratory techniques in rabies Fifth edition 72 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences a similar method, Nikolic et al. have shown that viral mRNAs, but not gRNA, are selectively transported from Negri bodies to the stress granules induced by RABV infection, demonstrating the direct application of ISH to the study of subcellular changes and viral pathogenesis (13). The ISH protocol described in this chapter utilizes commercially sourced oligo- nucleotide probes. The probes can be tailored to differentiate between specific lyssaviruses (e.g. RABV, EBLV-1 or EBLV-2) or can be designed for cross-spe- cies detection. Therefore, identification of genomic regions with the adequate genetic diversity is fundamental for probe design and consequently the success of the technique. Oligonucleotides are stable, not degraded by RNase, and their small size improves tissue and cell penetration as well as target detection in FFPE tissues, where the process of tissue fixation has a detrimental effect on the length of nucleic acid sequences. The probes used for the protocol described herein are labelled with digoxigenin (DIG) and will detect viral genomic RNA. They were designed to detect the nucleoprotein gene of selected virus isolates with species specificity; their sequences are shown in Table 33.1. CVS was used as a template for the RABV probe, while RV20, isolated from a serotine bat (Eptesicus serotinus) in Denmark during 1986, and RV1332, isolated from a Daubenton’s bat (Myotis daubentonii) in the UK during 2002, were used for the EBLV-1 and EBLV-2 probes, respectively (14). Protocol Generation of control material and test samples Positive control material is generated by inoculating mice intracerebrally with 10% suspensions of RABV-infected brain tissue. With presentation of clinical signs, the animal is euthanized, and the brain is removed and fixed in 10% neutral buffered formalin at room temperature for a minimum of 48 h. A proportion of the brain can be removed prior to fixation for confirmatory testing using another stan- dard method (e.g. DFAT or RT-PCR). Similar fixation protocols will be required for the test samples. When the histological processing of the tissues is conducted at a lower containment level, a validation of the inactivation of the fixed samples may be required. Virus present in samples up to 1 cm in thickness is inactivated after 24 h. The fixed tissue is then processed through graded alcohol and a clearing agent before being embedded in paraffin wax using standard histological proto- cols. Negative control material can be generated in the same way using mice that have not been inoculated with RABV suspensions. Table 33.1. Sequences of DIG-labelled probes used for lyssavirus ISH detection in FFPE tissues Species Nucleotide sequence RABV 5’-GGATGCCGACAAGATTGTGTTCAAAGTCAATAATCAGGTGGTCTCTTTGAAGCC-3’ EBLV-1 5’-CGTCTGCTCTTATTTAGCTGGAGCCATGGTCTTGTTTGAGGGCATCTGCCCGG-3’ EBLV-2 5’-CCCTTGGAAAAGCTCCGGACCTGAACAGAGCTTATAAGTCCATTCTGTCCGG-3’ DIG, digoxigenin; EBLV-1, European bat lyssavirus type 1, EBLV-2, European bat lyssavirus type 2; ISH, in situ hybridization; RABV, rabies virus Laboratory techniques in rabies Fifth edition 73 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Section preparation 1. Cut embedded brain tissue at a thickness < 5 µm using a microtome, float the section on a water bath containing water treated with diethylpyrocarbonate (DEPC) and mount onto a Superfrost charged slide. 2. Improved adherence of the tissue section to the charged slide can be achieved by incubating at 60 °C for 30 min. In situ hybridization The ISH protocol is subdivided into three sections: (i) slide preparation and permeabilization, (ii) probe hybridization and (iii) probe detection (Fig. 33.1). Each section includes temperature dependent steps. All steps of the process are to be undertaken at room temperature unless otherwise indicated. Slide preparation 1. Use two 6-min changes in Xylene to deparaffinize the tissue sections, clear with two 6-min changes of 100% ethanol and rehydrate with 6-min incubations in each of the following: 70% ethanol, 50% ethanol and DEPC-treated distilled water. 2. Following two, 5-min washes in DEPC and phosphate buffered saline (PBS), transfer the slides to 4% paraformaldehyde in 0.1 mol phosphate buffer for 10 min. 3. After a further two, 5-min washes in DEPC–PBS, immerse the slides in a 0.1 mol triethanolamine (TEA) buffer containing 0.25% acetic anhydride for 5 min. B y co ur te sy o f t he A ni m al a nd P la nt H ea lth A ge nc y, A dd le st on e, S ur re y, U K Original magnification 100x (left) and 400x (right) ISH, in situ hybridization; RABV, rabies virus Fig. 33.1. Specific ISH labelling of the neuronal cell body in the piriform cortex of mice intracerebrally inoculated with challenge virus standard RABV using the RABV probe labelled with digoxigenin (purple colouration) Laboratory techniques in rabies Fifth edition 74 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences 4. Add additional acetic anhydride to the 0.1 mol TEA buffer containing 0.25% acetic anhydride to make a final 0.1 mol TEA buffer containing 0.5% acetic anhydride and incubate the slides for a further 5 min. 5. Wash the slides in 2x saline-sodium citrate (SSC) buffer for 3 min before trans- ferring them to a DEPC–TEA buffer containing proteinase K (10 µg/mL) and incubate for 30 min at 37 °C. 6. To quench residual proteinase K activity, immerse the slides in DEPC–PBS containing 2% glycine for 60 s and then wash in PBS for 5 min. Probe hybridization 1. Pre-heat hybridization buffer to 37 °C before use. 2. Lay slides out on staining trays and rinse them twice with PBS, allowing the PBS to remain on the slides for 5 min between each rinse. 3. Drain excess buffer from the slides, apply hybridization buffer, cover the tissue section on the slide with plastic paraffin film (trimmed to size) and incubate for 2 h at 37 °C. 4. Rinse with 2x SSC to remove the plastic paraffin film and hybridization buffer and then wash slides in 2x SSC for 5 min. 5. To prepare the probe, vortex oligonucleotide probe stock for 60 s, add probe to the hybridization buffer to achieve a 200 ng/mL concentration, mix by inverting the probe and buffer several times and apply < 200 µL to each section. Cover the tissue section on the slide with plastic paraffin film (trimmed to size) and incubate for a minimum of 18 h at the calculated hybridization temperature. Optimal probe hybridization temperature (Thyb) can be calculated using the following formula: Thyb = 24.21+0.41(%GC)–500/length of probe, based on the assumption that hybridization buffer contains 4 x SSC and a formamide concentration of 50%. Probe detection 1. Pre-warm 0.5 and 1x SSC post-hybridization washes. These washes should be between 5 °C and 20 °C warmer than the hybridization temperature of the probe. 2. Rinse with 1x SSC to remove plastic paraffin film and hybridization buffer from the slide, immerse slides in 1x SSC wash buffer pre-heated to wash tempera- ture and incubate at the wash temperature for 15 min. 3. Discard 1x SSC and re-fill immersion trough with pre-heated 1x SSC wash buffer and incubate slides for a further 15 min at the wash temperature. 4. Following two, 15-min immersions in 0.5x SSC wash buffer (at wash tempera- ture), transfer the slides to 0.5x SSC wash buffer and incubate at room tempe- rature for 10 min. 5. Transfer slides to tris-buffered saline (TBS) and wash sections three times for 5 min each. Laboratory techniques in rabies Fifth edition 75 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences 6. Drain off TBS and apply blocking solution comprised of 0.1% Triton X-100 and 1% normal sheep serum diluted in TBS for 30 min. 7. Drain off blocking solution and apply (< 200 µL per slide) anti-DIG antibody conjugated to alkaline phosphatase diluted 1/100 in blocking solution for a minimum of 4 h. 8. Wash in three, 5-min changes of TBS and apply (200 µL per slide) NBT/BCIP (dissolved in distilled water supplemented with 10 µL of 1 mol levamisole solu- tion per 10 mL). Development time variable and the reaction should be moni- tored regularly under a microscope. Minimum development time is 20 min. 9. Rinse slides in tap water to stop the reaction and counterstain with nuclear fast red for 10 min. 10. Wash slides in running tap water for 10 min, transfer to distilled water and then mount the sections using an aqueous mountant. Interpretation of results To ensure the fidelity of the results, negative and positive control material must be included in the assay along with the test sample. Technique controls, which include the omission of the probe or the substitution of the lyssavirus probe with a nonsense or non-lyssavirus specific sequence of the same length, should also be included. RABV-positive control material must demonstrate purple-labelled intracytoplasmic inclusions, ranging in size from fine granular particles to large inclusion bodies, within the neuron perikarya. Labelling of a similar nature and location must not be present in the negative control material nor on tests on positive control material, where the lyssavirus-specific probe has been omitted or replaced with a nonsense probe. The amount of lyssavirus-specific labelling within the sample will vary depending upon the level of infection. Positive sections can be scored based on the intensity of labelling using well established scoring procedures (e.g. 1+ weak to 3+ strong). Laboratory optimization The success of this protocol is directly dependent upon the ability of the probe to access the target sequence. Proteinase K actively breaks down the extensive protein framework cross-linking proteins in the tissue, which is produced during fixation, and increases accessibility to the target sequence. Therefore, manipu- lation of the enzyme concentration (generally 5–20  µg/mL) and the length and temperature of incubation can help optimize probe access and ultimately influence the final ISH signal intensity. The conditions described in this protocol are optimal for our laboratory. However, optimization may be required when performing this assay in other laboratories due to differences in the length and type of fixation. Laboratory techniques in rabies Fifth edition 76 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Critical parameters, troubleshooting and precautions The impact of RNase is reduced through the use of oligonucleotide probes; however, care should still be taken in the preparation of reagents and equipment used for this assay. Laboratory glassware should be sterilized or treated for the potential contamination with RNase. Use sterile slides and plastic paraffin film where possible. Reagents must be prepared with either nuclease-free or DEPC- treated water. Good laboratory practice should be maintained at all times to minimize the introduction of contaminants (e.g. by the wearing of gloves). Oligo- nucleotide probes are robust and are suitable for long-term storage. For example, reconstituted probes from one of the commercial suppliers can be stored at 25 °C for 3 months and at −20 °C for up to 3 years. Preparation and aliquoting on receipt for long-term storage will also minimize the number of freeze–thaw cycles, which can degrade the probe, affecting ISH signal. Several parameters can be modified if labelling is not produced to expected levels. The concentration and duration of proteinase K treatment can be altered to counter the effects (i.e. diminished or lack of labelling) of an extended or shortened tissue fixation. The length of probe hybridization can be extended (<  40  h) if labelling is suboptimal. The intensity of the labelling colour product can also be increased or reduced by extending or shortening the NBT–BCIP development period. Increased nonspecific label- ling or background staining can be reduced by increasing the probe hybridization temperature or reducing the duration of NBT–BCIP development. Alternative materials and/or methods The use of commercial synthetic oligonucleotides in ISH enables a greater flexibility in the design and choice of visualization methods. A biotin or fluorescent tag can be incorporated into the probe in place of the DIG label allowing for the visualization of multiple target sequences by confocal microscopy. The use of oligonucleotide probes also means that even in situations where there is difficulty in producing a consensus probe for all lyssavirus species, the capacity exists to commercially order interspecies consensus probes and apply a probe cocktail. Rapid advances have been made with ISH methodology over recent years. The emergence of kit-based systems for both the bench and for automated staining systems and commercially available probe design and prepa- ration services have substantially reduced the labour requirements and turna- round times for testing using an ISH assay. These advances have also simplified the optimization process to a single parameter, reducing the lead-in time for tech- nique development and validation. Time considerations This ISH methodology as described is labour intensive and does not lend itself to a rapid diagnostic testing turnaround in this format. Lead-in time for tissue processing to wax, once tissue is fixed, is approximately 24 h. Slide prepara- tion requires 3–4 h, pre-hybridization steps require 2–3 h, probe hybridization Laboratory techniques in rabies Fifth edition 77 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences requires an overnight incubation (> 18 h), post-hybridization washes and detec- tion with anti-DIG antibody-AP conjugate requires a minimum of 6–7 h, although the anti-DIG AP conjugate is routinely left on overnight to enable the monitoring of development the next day. Finally, development of the ISH signal and slide mounting requires 2–3 h. To incorporate the overnight incubations, approximately 5 days are required to complete this assay. Limitations This technique has been validated on FFPE material, where the fixation period is variable (5 days up to several months). Application of this method to FFPE tissues and material prepared in other fixatives would require optimization. The size of the oligonucleotide probes used (approximately 50 base pairs) counteract the issue of extended fixation periods to some degree. However, the fixation time should be minimized, where possible, to reduce the impact on the ISH signal. Laboratory techniques in rabies Fifth edition 78 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences References 1. Arslan A, Saglam YS, Temur A. Detection of rabies viral antigens in non-au- tolysed and autolysed tissues by using an immunoperoxidase technique. Vet Rec. 2004;155:550–2. PMID:15559421. 2. Kashofer K, Viertler C, Pichler M, Zatloukal K. Quality control of RNA preser- vation and extraction from paraffin-embedded tissue: implications for RT-PCR and microarray analysis. PLoS One. 2013;8:e70714. doi:10.1371/journal. pone.0070714. 3. Beck S, Gunawardena P, Horton DL, Hicks DJ, Marston DA, Ortiz-Pelaez A, et al. Pathobiological investigation of naturally infected canine rabies cases from Sri Lanka. BMC Vet Res. 2017;13:99. doi:10.1186/s12917-017-1024-5. 4. Jackson AC, Reimer DL, Wunner WH. Detection of rabies virus RNA in the central nervous system of experimentally infected mice using in situ hybridiza- tion with RNA probes. J Virol Methods. 1989;25:1–11. PMID:2778026. 5. Jackson AC, Wunner WH. Detection of rabies virus genomic RNA and mRNA in mouse and human brains by using in situ hybridization. J Virol. 1991;65:2839– 44. PMID:2033657. 6. Jackson AC, Rintoul NE. Effects of post-mortem autolysis on the detection of rabies virus genomic RNA and mRNA in mouse brain by using in situ hybridiza- tion. Mol Cell Probes. 1992;6:231–5. PMID:1406731. 7. Jackson AC. Detection of rabies virus mRNA in mouse brain by using in situ hybridization with digoxigenin-labelled RNA probes. Mol Cell Probes. 1992;6:131–6. doi:10.1016/0890-8508(92)90057-5. 8. Warner CK, Whitfield SG, Fekadu M, Ho H. Procedures for reproducible detec- tion of rabies virus antigen mRNA and genome in situ in formalin-fixed tissues. J Virol Methods. 1997;67:5–12. 9. Warner CK, Zaki SR, Shieh WJ, Whitfield SG, Smith JS, Orciari LA, et al. Labo- ratory investigation of human deaths from vampire bat rabies in Peru. Am J Trop Med Hyg. 1999;60:502–7. PMID:10466985. 10. Nadin-Davis SA, Sheen M, Wandeler AI. Use of discriminatory probes for strain typing of formalin-fixed, rabies virus-infected tissues by in situ hybridization. J Clin Microbiol. 2003;41:4343–52. doi:10.1128/JCM.41.9.4343-4352.2003. 11. Finnegan CJ, Brookes SM, Johnson L, Fooks AR. Detection and strain differen- tiation of European bat lyssaviruses using in situ hybridisation. J Virol Methods. 2004;121:223–9. 12. Lahaye X, Vidy A, Pomier C, Obiang L, Harper F, Gaudin Y, et al. Functional characterization of Negri bodies (NBs) in rabies virus-infected cells: evidence that NBs are sites of viral transcription and replication. J Virol. 2009;83:7948– 58. doi:10.1128/JVI.00554-09. 13. Nikolic J, Civas A, Lama Z, Lagaudrière-Gesbert C, Blondel D. Rabies virus infection induces the formation of stress granules closely connected to the viral factories. PLoS Pathog. 2016;12:e1005942. doi:10.1371/journal.ppat.1005942. 14. Johnson N, Selden D, Parsons G, Healy D, Brookes SM, McElhinney LM, et al. Isolation of a European bat lyssavirus type 2 from a Daubenton’s bat in the United Kingdom. Vet Rec. 2003;152:383–7. PMID:12696703. Laboratory techniques in rabies Fifth edition 79 Detection by in situ hybridization Part 5. Demonstration of viral nucleic acids and sequences Annex Equipment • items for an automated tissue processor for paraffin embedding of fixed samples • microtome for sectioning FFPE tissues • slide staining trays • vortex mixer, magnetic stirrer, water bath, micro centrifuge • incubator (room temperature up to approximately 80 °C) • observation light microscope (low power) to monitor colour change during development • light microscope (with camera) • reagents • Superfrost plus charged slides • Xylene • ethanol (molecular grade) • diethyl pyrocarbonate (DEPC) • paraformaldehyde and buffer (0.1 mol phosphate buffer) • proteinase K • glycine • phosphate buffered saline (PBS) • acetic anhydride • saline-sodium citrate (SSC) buffer in various concentrations • hybridization buffer (dextran sulfate, Formamide, PolyA, ssDNA, tRNA, DTT (1 M solution), 50x Denhardts) • anti-DIG fab fragment antibody • M triethanolamine buffer (0.1 mol TEA buffer in distilled water) • plastic paraffin film • NBT/BCIP substrate-chromogen • aqueous mountant • tris-buffered saline (TBS, 100 mmol Tris HCl, 150 mmol NaCl, pH 7.6) • 1x tris-EDTA buffer (TE buffer) Laboratory animals Mice would be required for the generation of known positive and negative control material. Field cases could be used for controls, once the technique is optimized. Laboratory techniques in rabies Fifth edition 80 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Chapter 34 Rapid diagnosis and genetic typing of rabies virus and other lyssaviruses using SYBR Green RT-PCR and pyrosequencing assays Introduction Rabies is a major public health problem in Asia and Africa, offering diagnostic challenges (1–3). Within North America, more than 100 000 suspected rabid animal samples are tested annually (4). Canine rabies viruses (RABV) are responsible for most human deaths in the developing world (5). Lyssaviruses include at least 15 different species with significant diversity in genome sequences, in which the sequence similarity among RABV can be as low as 80% of the nucleoprotein (N) gene sequences. Other lyssaviruses are more divergent. The sequence similarity of the N gene are in the range of 68–79% among different lyssavirus species (6). The sequence divergence among RABV and other lyssaviruses makes the diagnosis challenging. Highly sensitive and specific assays and sequencing of suspected samples are needed to confirm diagnostic results with confidence. WHO and OIE have defined the direct fluorescent antibody test (DFAT) as the gold standard for rabies diagnosis of postmortem samples (see Chapter 11). The DFAT is a rapid and sensitive method for rabies diagnosis, but its accu- racy depends on the quality of brain tissue, availability of high-quality anti-ra- bies diagnostic conjugates, accessibility to a fluorescence microscope and, most importantly, an experienced diagnostician (7). Real-time reverse transcriptase polymerase chain reaction (RT-PCR) assays have been used for rabies diagnosis for decades. A recently developed pan-lys- savirus real-time TaqMan RT-PCR assay, LN34, is able to detect RABV or other lyssaviruses (6). SYBR Green-based real-time RT-PCR assays have also demons- trated superior sensitivity and broad specificity in rabies diagnosis. However, the rabies SYBR RT-PCR assays may use degenerated primers or short primers for the PCR amplification and be inclined to produce nonspecific PCR products or primer dimers which can lead to false–positive results, as SYBR Green binds to double-stranded DNA nonspecifically (8). Despite rapid advances in next-generation sequencing technology, the Sanger sequencing method is still used widely for the routine analysis of suspect samples to confirm diagnostic RT-PCR results or to determine the source of infection based on the genetic typing results (see Chapter 29). Sequences from positive samples are critical for the investigation and control of outbreaks as well as the rapid iden- tification of lyssavirus infections. Normally, a Sanger protocol takes up to 12–24 h to generate sequences from a RT-PCR amplicon. Alternatively, a pyrosequencing method can be used for the diagnosis and genetic typing of suspected RABV samples by directly sequencing the RT-PCR amplicon. The pyrosequencing method generates short sequences, but the method is fast and very sensitive (9). Laboratory techniques in rabies Fifth edition 81 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences By combining these techniques, we take advantage of the superior sensitivity and broad specificity of the SYBR Green RT-PCR assay in rabies sample testing and the rapid sequencing ability of pyrosequencing technology. This protocol produces both real-time RT-PCR data followed by sequencing confirmation of the diagnostic results within 4 h. This protocol can be used for the diagnosis of rabies postmortem and antemortem samples, including saliva, nuchal skin samples and paraffin-embedded samples. This method is of particular use for a rabies refe- rence centre to perform additional diagnostic confirmations, rapid genetic typing of positive samples and monitoring the emergence of novel RABV variants or other lyssaviruses. Technique This protocol uses a one-step SYBR Green RT-PCR assay (LN12) to amplify a suspected RABV sample, followed by a pyrosequencing method (PyroLN12) to confirm the positive LN12 assay result. The forward and reverse primers of the LN12 assay target two of most conserved regions of RABV and other lyssavirus genomes. The forward primer overlaps with previously known LYS001 primer sequences, and the reverse primer overlaps with previously known JW12 primer sequences (10, 11). Those primer selections allow minimal primer degenerations and are able to amplify all known lyssaviruses as the primer sequences are highly conserved. The amplicon size is about 70 base pairs, which improve the assay’s sensitivity compared with previously published assays (12, 13). Our validation results show that the LN12 assay is more sensitive than those of the TaqMan- based pan-lyssavirus real-time RT-PCR assay LN34 (6). The advantage of pyrosequencing is that the sequencing reading starts at the first base after the sequencing primer and the sequencing results are generated in real time. Although the amplicon sequences of the assay LN12 are only 33 bases after the primer sequences, those 33 bases sequences are highly diverged and generate specific typing results among different lyssavirus species and major RABV variants. The PyroLN12 takes < 2 h to complete. Those pyrosequencing results may not be suitable for detailed phylogenetic analysis of the samples, especially among closely related RABV variants, but the sequences are specific for diagnostic confirmation and differentiation of RABV from other lyssaviruses and among major RABV variants, especially combined with clinical and animal contact information. The PyroLN12 is able to generate sequences for weak or difficult RABV samples. The optimization process of the protocol shows that the pyrosequencing method produces clear sequencing reads from the amplicons with cycle threshold (Ct) values ≥ 35 (< 100 copy of RABV RNA) from the LN12 assay. This protocol has been optimized in the nucleotide dispensation order and template quantities in the pyrosequencing process to improve the sequencing signal and sequencing length. Laboratory techniques in rabies Fifth edition 82 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Standard procedure Amplicon generation using the LN12 assay The LN12 assay is recommended to run on the real-time PCR instrument ABI ViiA7 and ABI 7500 [Applied Biosystems, Cat # 4453535 and 4406984]. Other real- time instruments may also be used following the recommended running condi- tions. Both forward (Fwd) and reverse primers (Rev) contain degenerate nucleo- tides (using the nomenclature of IUPAC). The Fwd sequences are: Fwd1, 5’-ACG CTT AAC RAC AAA ATC ARA GA-3’, Fwd2, 5’-ACG CTT AAC AAR ATC AGA GA-3’; and the Rev sequences are: Rev1, 5’-Biotin-GCA TCC ATT GTA GGR GTG TTA C-3’, and Rev2, 5’-Biotin-GCA TCC ATT GTA GGG GTG TTR C-3’. The Fwd1 and Fwd2 or Rev1 and Rev2 are mixed in an equal molar ratio. The Rev primers have biotin labels at the 5’ end and are used to generate a single-stranded DNA template for pyrosequencing (Fig. 34.1). Equipment and reagents • Invitrogen Superscript III Platinum SYBR Green One-Step qRT-PCR kit [cata- logue number 11736051] • high-purity nuclease-free water • Fwd and Rev primers with stock concentration of 10 µmol • RNase Away • RABV samples to be tested • positive control (historic RABV-positive RNA) • negative control, no template control (NTC), nuclease-free water • biosafety cabinets • ABI ViiA7 • QuantStudio Real-Time PCR Software V1.2 [ABI] • MicroAmp 96-well fast PCR plate [catalogue number 4346906] • MicroAmp optical adhesive film [ABI 4311971] • small benchtop centrifuge • pipettes Fwd, forward; Rev, reverse Fig 34.1. Primer design for the LN12 The logograph was constructed using 12 highly diverged RABV sequences (14). The small letters indicate the variable positions among RABV sequences. The Fwd primer is also used as the pyrosequencing primer and the biotinylated Rev primer is used for the purification of single-stranded template. Laboratory techniques in rabies Fifth edition 83 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Reaction setup for the LN12 1. Keep all reagents on ice after thawing. Reagents are returned to storage at −20 °C after use. 2. Use primer aliquots (40 µL) to minimize possible contamination. Discard the primers after 10 times of use. 3. Use separate biosafety cabinets for PCR setup and adding RNA samples. The bench surfaces of biosafety cabinets and pipettes are treated by spraying RNase Away before and after use to eliminate possible RNase contamination. 4. Prepare a reaction master mix as shown in Table 34.1. All samples are run in duplicate. 5. Gently mix the master mix. Spin briefly to collect all the liquid to the bottom of tube. 6. Dispense 18.0 µl of master mix to each reaction well of a MicroAmp 96-well fast PCR plate. 7. Transfer the PCR plate into the other biosafety cabinet designated exclusively for RNA work. 8. Thaw RNA samples and mix well. 9. Use 2.0 µL of extracted RNA per reaction. 10. Seal the plate. 11. Spin the 96-well PCR plate for 1.0 min and place it into an ABI ViiA7 thermo- cycler. Table 34.1. Preparation of master mix for the LN12 assay Components Volume per reaction (µL) Volume of master mixa = number of reactionsb x volume per reaction 2X SYBR Green reaction mix 10 Forward primer (10 µmol) 0.4 Reverse primer (10 µmol) 0.4 ROX reference dye (50 µmol)c 0.04 SuperScript III RT/Platinum Taq Mix 0.5 Nuclease-free water 6.66 a Prepare 10% extra volume. b All samples are run in duplicate, including positive and negative controls. c Different instruments require different ROX concentration as background reference dye, so adjust ROX volume accordingly. For exam- ple, ViiA 7 and ABI 7500 need 30–50 nmol ROX while ABI PCR StepOnePlus needs 300–500 nmol ROX. Laboratory techniques in rabies Fifth edition 84 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences PCR program setup using QuantStudio™ Real- Time PCR software V1.2 QuantStudio Real-Time PCR software V1.2 was used on the ViiA7 system. A similar software was used on the ABI 7500 system. Choice selections are highlighted in bold for easy illustration. Open the software and at the home screen: 1. In the Set UP panel, click Experiment Setup. 2. The Experiment Menu panel contains steps for program setup and result analysis. a. Fill the boxes of Experiment Name, User Name and Comments. b. Check the appropriate options for Experiment Property. 3. Click Define to access the next screen. a. Keep Target 1 in Targets Name; pick SYBR Green for Reporter, None for Quencher. b. In Samples panel, click New to add samples, and enter sample names. c. Choose ROX for Passive Reference. 4. Click Assign to access the next screen. 5. Assign reaction wells with sample names. 6. Select all reaction wells and assign them with Target 1. 7. Click Run Method to access the Rum Method screen 8. Set 20 µL for Reaction Volume per Well. 9. Set the thermal cycle profile under the Graphical View tab as in Table 34.2. 10. Click Run. Choose the ViiA7 instrument and save your run in a desired folder. 11. After the run is completed, the positive samples are sequenced or stored at −20 °C for future use. Table 34.2. The thermoprofile for the LN12 Temperature °C Time Comments 50 °C 5 min Reverse transcription 3 min 95 °C 3 s PCR amplification 60 °C 20 s 40 cycles 95 °C 15 s Melting curve (optional) 60 °C 1 min 95 °C 15 s 50 °C 5 min Laboratory techniques in rabies Fifth edition 85 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Run analysis When the run is completed, choose Automatic Threshold in the Analysis setting. Click the Analyse tab above the Plate Layout panel to analyse the run data. In the Analysis tab, check out each the following analysis. 1. Amplification Plot: pick ΔRn Vs Cycle plot and linear model. Expected results would be: a. The plots of positive samples should have the amplification curve in sigmoid with exponential phase. b. For a sample with a weak amplification and high Ct values, the Multi- component Plot may be used to check the increases of fluorescence for a true amplification. 2. Melt curve (optional): most RABV-positive samples have a single melting curve peak between 75 °C and 77.5 °C. 3. Samples that display Ct values will be processed for pyrosequencing. For more details of run analysis and troubleshooting, refer to the Getting started guides: Applied Biosystems ViiA™ 7 Real-Time PCR System (English), Booklet 2, Running standard curve experiments (https://www.thermofisher.com/). Exporting the run Run data and results can be exported by clicking Export in the navigation panel. 1. Check all the boxes including Sample Setup, Raw Data, Amplification, Multi- component, Results and Melt Curve Raw. 2. Chose a location and a file name for the exported file. 3. Saved file can be opened in Microsoft Excel for further analysis. Pyrosequencing of the LN12 assay amplicon Equipment and reagents • PyroMark Q24 Advance Instrument [catalogue number 9002270] • PyroMark Q24 Vacuum Workstation (110V) [catalogue number 9001516] • PyroMark Q24 Cartridge [catalogue number 97902] • Q24 Plate (100) [catalogue number 979201] • PyroMark Q24 Advanced Reagents kit [catalogue number 970902] • PyroMark Denaturation Solution (500 ml) [catalogue number 979007] • 10x PyroMark wash buffer concentrate (200 mL) [catalogue number 979008] • sequencing primer: Fwd1 for RABV sequencing, or Fwd1 and Fwd2mixture for other lyssaviruses; primers are prepared at a concentration of 10 µmol Laboratory techniques in rabies Fifth edition 86 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences • Streptavidin Sepharose High Performance beads (6% highly cross-liked Agarose) [GE Healthcare 17-5113-01] • 70% ethanol • 96-well PCR plate [Phenix research products, MPS-499] • 96-well PCR plate seal [Phenix research products, LMT-SEAL-EX] • highly purified water [Milli-Q 18.2 MΩ x cm or equivalent] • horizontal shaker • heat block • marker • timer • PyroMark Q24 Advanced 3.0.0 (software) Set up of the PyroLN12 assay Pyrosequencing requires a method that matches the method number on the cartridge. The method in this protocol is 13 and can be downloaded from the Qiagen website (https://www.qiagen.com/us/resources/technologies/pyrose- quencing-resource-center/managing-instrument-methods/pyromark-q24-ad- vanced/). The dispensation order and cycle of dNTP for the RABV SEQ assay were optimized; the dNTP is dispensed in the order of AACGT for 18 cycles and the method is saved as 18 (AACGT). 1. Save the method file on a computer that has the PyroMark Q24 Advanced 3.0.0 software installed on it. 2. Import the method file into the software by clicking Tools à Instrument Methods, click Import. 3. Find the saved Method 13, then click Open. 4. Close the Import window when the method file appears in it. 5. Click File in the toolbar and select New Assay à SEQ Assay. 6. In the SEQ Assay Setup screen, click Setup, enter 18(AACGT) in the Dispen- sation Order panel. 7. Leave other Settings and Analysis Parameters in default. 8. Save the assay file 18 (AACGT) on the computer. 9. Import the assay file 18 (AACGT) into the Shortcuts folder on the SEQ Assay Setup screen. Laboratory techniques in rabies Fifth edition 87 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Preparations at the beginning of the experiment 1. Bring the washing buffers and the denaturing buffer to room temperature from a 4 °C refrigerator. 2. Dilute 5.0 mL of 10x washing buffer with 45 mL of highly purified water to make a 1x working concentration. 3. Turn on the PyroMark Q24 Advanced Instrument. 4. Power on a heat block with a preset of 80 oC for later use in step 3.2.8. Immobilizing the PCR amplicon 1. Mix Streptavidin Sepharose beads by inversion. Do not vortex. 2. Prepare the master mix in a tube as in Table 34.3. 3. Distribute 70 µL master mix per well in a 96-well plate. 4. Transfer 10 µL PCR product (use one to third dilution if Ct < 20 to improve pyrosequencing read quality) into a reaction well containing the immobilizing buffer. Seal the PCR plate. 5. Shake the plate at 1400 r/min for 10 min. Run set up and loading reagents into the PyroMark Q24 cartridge 1. Click New Run à SEQ assay. 2. In the Run Setup screen, select Method 013 from the dropdown list of Instru- ment Method. 3. Enter run info into the Run Note panel. 4. In the Plate Setup panel, choose wells for your samples and enter sample names. 5. Highlight all reaction wells, apply the assay file 18 (AACGT). 6. Click Tools à Pre Run Information, write down the volumes of each reagent, Enzyme mix, Substrate mix and four nucleotides A, T, G, and C. Table 34.3. Preparation of master mix for DNA immobilization Components Volume per reaction (µL) Volume of master mixa = number of reactionsb x volume per reaction PyroMark binding buffer 40 Sepharose bead 1.0 Water 29 Total volume 70 a Prepare 10% extra volume. Laboratory techniques in rabies Fifth edition 88 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 7. Place the Cartridge on the bench with the label facing you. Note: Make sure the cartridge is dry at the time of use. 8. Load the volume of each reagent into its compartment. Caution: Make sure no air bubbles form inside the cartridge compartment during loading. 9. Tap the cartridge gently on the bench a few times to help settle reagents in the bottom of the cartridge. 10. Open the instrument lid and cartridge gate, insert the filled cartridge with the label facing out, and close the cartridge gate. 11. Save the run setup from the computer into a flash drive. 12. Insert the flash drive into the PyroMark Q24 advanced instrument and the setup file will be used during the sequencing run. Preparation of the sequencing primer of PyroLN12 The Fwd primer of the assay LN12 is used as the sequencing primer. 1. Prepare a sequencing primer stock at 10  µmol concentration. The working concentration of the sequencing primer is 0.375 µmol. 2. Dilute the sequencing primer using the PyroMark advanced annealing buffer to make a sufficient amount. 3. Mix and spin briefly to collect all the liquid to the bottom of tube. 4. Dispense 20 µL diluted sequencing primer to each well of a Q24 plate accor- ding to the run setup. Purification of template DNA 1. Switch on the PyroMark Q24 Vacuum pump. 2. Turn on the vacuum tool. 3. Prime the Filter Probes with 40 mL of highly pure water. 4. Place the PCR plate from Step 3.2.4 and the primer-filled Q24 plates on the vacuum station. 5. Slowly lower the filter probes of the vacuum tool into the PCR plate to capture the beads containing immobilized template. Hold the vacuum tool in the place for 15 s. Raise the vacuum tool and check for any PCR leftover in the wells of the 96-well PCR plate. Note: Beads sediment quickly, and capturing should take place immediately after the plate is set on the holder of the vacuum work station. If more than ONE min has elapsed, agitate the PCR plate again for one min. 6. Place the vacuum tool into the trough containing 40 mL 70% ethanol. Flush the filter probes for 5 s. 7. Transfer the vacuum tool into the trough containing 40 mL denaturation solu- tion. Flush the filter probes for 5 s. 8. Transfer the vacuum tool into the trough containing 40 mL wash buffer. Flush the filter probes for 10 s. 9. Raise the vacuum tool up and back beyond 90° vertical for 5 s to drain any liquid in the filter probes. Laboratory techniques in rabies Fifth edition 89 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 10. Switch off the vacuum tool, then turn off the vacuum. Detach the vacuum tool from the vacuum tubing. 11. Align the vacuum tool with the PyroMark Q24 plate and lower the filter probes into the diluted sequencing primer. Gently shake beads off the filter probes. 12. Reattach the vacuum tool to the vacuum, and power on the vacuum and switch on the vacuum tool. 13. Flush the filter probes in highly pure water for 10 s. Place the vacuum tool in the parking trough. 14. Turn off the vacuum pump. 15. Set up the pyrosequencing reactions following the steps in Table 34.4. Primer annealing 1. Transfer the Q24 plate containing the sequencing primer and DNA template to the heat block and heat it at 80 °C for 5 min. 2. Transfer the hot plate holder together with the Q24 plate from the heating block to the PyroMark Q24 advanced instrument. 3. Immediately place the Q24 plate into the PyroMark Q24 advance instrument. Ensure that the plate-holding frame is closed. Note: The time from removing the hot plate holder to placing the Q24 plate into the PyroMark Q24 advanced instrument should not exceed 30 s. Start the run 1. Select Run at the screen of PyroMark Q24 advance instrument. 2. Pick the run file from Step 3.2.5. 3. Click Run to start the reactions. Clean-up after the run 1. Open the PyroMark Q24 advanced instrument lid. 2. Take out and trash the Q24 plate. 3. Take out the cartridge. Discard the remaining solution. Table 34.4. Reaction setup for the PyroLN12 Reagents Volume per reaction Master mix a = reaction number x volume per reaction Sequencing primer Fwd1 (10 µmol)b 0.75 µL PyroMark advanced annealing buffer 19.25 µL Single-stranded DNA (the Sepharose beads from Step 3.2.7) Released in the wells with diluted primer Fwd1 Enzyme/substrate mix To be dispensed during sequencing Prepared in Step 3.2.5 Nucleotides To be dispensed during sequencing Prepared in Step 3.2.5 a Prepare 10% extra volume. b Sequence primer is diluted in the annealing buffer. Beads with captured DNA are released in the diluted primer solution. Laboratory techniques in rabies Fifth edition 90 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences 4. Wash and “milk” it three times using high-purity water. 5. Watch the straight downright water jet during the “milking” process. Place the cartridge in a box for air drying and storage. 6. Turn off the instrument. Note: Discard the cartridge when usage reaches 30 runs, the cartridge is blocked or the water jet is not straight. Result analysis 1. Run result is stored automatically on the flash drive. Insert the drive into a computer with installed PyroMark Q24 Advanced software. 2. Open the software. Click File à Open the run file. 3. The run file is now open in SEQ mode. 4. On the SEQ screen, the top, middle, and bottom panels are plate Overview (I), Pyrogram (II) and Histogram (III) (Fig. 34.2). 5. To view a reaction, click it in the plate Overview (I). The run result will populate in the Pyrogram (II), Histogram (III), and the Well Information panel (IV). The info in General Warnings is useful for base calling analysis. 6. The called sequence of the selected sample is displayed on the top of the Pyro- gram panel. 7. Sequencing quality is colour coded, Blue: Passed; Yellow: Check; Red: Failed. 8. Called sequences of all samples can be exported by clicking Reports à SEQ Analysis Results, then choose All wells and Passed + Checked. Save it into a folder. Fig. 34.2. Analysis of PyroLN12 run Panel I summarizes the run results; the quality of base-calling is colour coded (blue, passed; yellow, checked; red, failed). The algorithm-called sequences of selected wells are listed at the bottom of panel I. The raw sequencing signal is in panel II for a selected well and the histogram of the sequencing results is in panel III. Panel IV contains error messages. Laboratory techniques in rabies Fifth edition 91 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences Making a diagnosis and genetic typing using BLAST (Basic Local Similarity Searching Tool) 1. Go to the nucleotide Blast website at NCBI (https://blast.ncbi.nlm.nih.gov/ Blast.cgi). 2. Copy the called sequences (only blue- and yellow-coloured sequence) and paste into the query sequence box. 3. Perform Blast search using the program optimized for “Somewhat similar sequences”. 4. Among all the hit sequences, only top hits with the highest maximum scores are considered. 5. The sample is positive if the top hits contain RABV sequence(s). Additional notes 1. Reconstituted enzyme mix and substrate mix of the PyroMark Advanced reagent can be stored at 4 °C and last for one week. Unused aliquots can be stored at −20 °C. Do not thaw or freeze the reconstituted enzyme and substrate mix more than three times. 2. High-quality base calling of pyrosequencing usually has an initial peak value above 20. The initial peak height of a positive control is usually around 45–55 relative light units. If the initial peak value is lower than 20, discard the consti- tuted enzyme and substrate mix. 3. Never freeze and thaw the nucleotides of the kit. Freeze–thaw cycling raises background peaks, making base call more difficult. 4. Cartridges should not be used more than 30 times. Discard the cartridge if it is blocked. Keep a record of usage. 5. A Filter Probe can be used 100 times. It needs to be cleaned using sonication or replaced when usage reaches 100 times. Keep a time record of usage. 6. Streptavidin Sepharose beads (6%) should not exceed 1.0 µL per reaction. Overuse will cause baseline drifting. 7. Rinse troughs with high-purity water. Air dry and place them back into their position in the station. 8. The cartridge should be cleaned as soon as possible after a run has been completed to prevent a blockage in the cartridge. Laboratory techniques in rabies Fifth edition 92 Rapid diagnosis and genetic typing Part 5. Demonstration of viral nucleic acids and sequences References 1. WHO Expert Consultation on Rabies, third report. Geneva: World Health Organization; 2018 (WHO Technical Report Series, No. 1012; http://apps.who.int/ iris/bitstream/ handle/10665/272364/9789241210218-eng.pdf, accessed 1 October 2018 ). 2. Franka R, Smith TG, Dyer JL, Wu X, Niezgoda M, Rupprecht CE. Current and future tools for global canine rabies elimination. Antiviral Res. 2013;100:220–5. doi:10.1016/j. antiviral.2013.07.004. 3. Hampson K, Coudeville L, Lembo T, Sambo M, Kieffer A, Attlan M, et al. Estimating the global burden of endemic canine rabies. PLoS Negl Trop Dis. 2015;9:e0003709. doi:10.1371/journal.pntd.0003709. 4. Birhane MG, Cleaton JM, Monroe BP, Wadhwa A, Orciari LA, Yager P, et al. Rabies surveillance in the United States during 2015. J Am Vet Med Assoc. 2017;250:1117– 30. doi:10.2460/javma.250.10.1117. 5. Mani RS, Madhusudana SN. Laboratory diagnosis of human rabies: recent advances. ScientificWorldJournal. 2013; 2013:569712. doi:10.1155/2013/569712. 6. Wadhwa A, Wilkins K, Gao J, Condori Condori RE, Gigante CM, Zhao H, et al. Pan-lys- savirus Taqman real-time RT-PCR assay for the detection of highly variable rabies virus and other lyssaviruses. PLoS Negl Trop Dis. 2017;11(1):e0005258. doi:10.1371/ journal.pntd.0005258. PMCID: PMC5230753 following competing interests: Patents have been filed for assays described in this manuscript through CDC Technology Transfer Office/NIH Office. 7. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emerg Infect Dis. 2006;12:310–3. doi: 10.3201/eid1202.050812. 8. Dupuis M, Brunt S, Appler K, Davis A, Rudd R. Comparison of automated quantita- tive reverse transcription-PCR and direct fluorescent-antibody detection for routine rabies diagnosis in the United States. J Clin Microbiol. 2015;53:2983–9. doi:10.1128/ JCM.01227-15. 9. Harrington CT, Lin EI, Olson MT, Eshleman JR. Fundamentals of pyrosequencing. Arch Pathol Lab Med. 2013;137:1296–303. doi:10.5858/arpa.2012-0463-RA. 10. Heaton PR, Johnstone P, McElhinney LM, Cowley R, O’Sullivan E, Whitby JE. Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. J Clin Microbiol. 1997;35:2762–6. 11. Markotter W, Kuzmin I, Rupprecht CE, Randles J, Sabeta CT, Wandeler AI, et al. Isolation of Lagos bat virus from water mongoose. Emerg Infect Dis. 2006;12:1913–8. doi:10.3201/eid1212.060514. 12. De Benedictis P, De Battisti C, Dacheux L, Marciano S, Ormelli S, Salomoni A, et al. Lyssavirus detection and typing using pyrosequencing. J Clin Microbiol. 2011;49:1932–8. doi:10.1128/JCM.02015-10. 13. De Benedictis P, De Battisti C, Marciano S, Mutinelli F, Capua I, Cattoli G. Pyrosequen- cing of the rabies virus glycoprotein gene to demonstrate absence of vaccine-asso- ciated rabies cases following oral vaccination. Vet J. 2013;195:388–90. doi:10.1016/j. tvjl.2012.06.030. 14. Troupin C, Dacheux L, Tanguy M, Sabeta C, Blanc H, Bouchier C, et al. Large-scale phylogenomic analysis reveals the complex evolutionary history of rabies virus in multiple carnivore hosts. PLoS Pathog. 2016;12:e1006041. doi:10.1371/journal. ppat.1006041. Laboratory techniques in rabies Fifth edition 93 Part 6. Production of biologicals Part 6. Production of biologicals Laboratory techniques in rabies Fifth edition 94 Regulatory perspectives Part 6. Production of biologicals Chapter 35 Regulatory perspectives on the design of human rabies biologicals Introduction The regulation of medicines demands the application of sound scientific, medical and technical knowledge, and operates within a legal framework. While medicines regulation is often associated with administrative aspects, far more relevant is the science that supports it. All medicines should meet three main criteria: to be of acceptable quality, to be safe, and to be effective. Any judge- ments about these criteria should be based on solid science. The use of unsafe and low-quality medicines could lead to treatment failures, adverse effects, resistance to medicines and even death. In the case of rabies, the quality, safety and effectiveness of medicines are essential as the onset of clinical disease can only be prevented effectively by timely administration of rabies vaccine and rabies immunoglobulins (RIG) in the event of a severe expo- sure (WHO category III). Ineffective or poor-quality medicines could have detri- mental effects on patients, and also undermine the community’s trust in health systems, medical professionals, manufacturers and distributors. Moreover, finan- cial resources spent on ineffective and poor-quality medicines are lost – whether by patients or governments. This is a concern for rabies, which occurs mostly in developing countries with limited resources. Institutions such as WHO and national regulatory authorities ensure that the manufacture, use and distribution of medicines are adequately controlled. Medi- cines regulation is based on a number of documents including pharmacopoeial monographs, WHO guidance documents and regional guidelines (published e.g. by the United States Food and Drug Administration and the European Medicines Agency). These documents describe the requirements necessary to ensure that the safety and efficacy of medicines such as rabies biologicals are acceptable, assuring for instance that a tested vaccine does indeed induce neutralizing anti- bodies. A fundamental of medicines regulation is the evaluation of their quality. Quality control of rabies biologicals should be ensured at two levels: by the manufac- turer and by a national control authority, e.g. the national rabies laboratory or national veterinary service laboratory. Quality control will, for instance, ensure that the potency of RIG for rabies post-exposure prophylaxis (PEP) is correctly and accurately determined using virus neutralization assays in line with the regula- tory requirements, e.g. according to pharmacopoeial monographs (1) as further described in this chapter. Medicines regulation also addresses necessary inspections of manufacturers, ensuring that the medicines are compliant with good practice (GxP) regulations. The “x” in GxP is a variable that stands for manufacturing, clinical, laboratory, or clinical laboratory. For example, GMP (Good Manufacturing Practice) covers all Laboratory techniques in rabies Fifth edition 95 Regulatory perspectives Part 6. Production of biologicals aspects of production from starting materials, premises and equipment to the trai- ning and personal hygiene of staff. Detailed, written procedures are essential for each process that could affect the quality of the finished product. Systems must be available to provide documented proof that correct procedures are consistently followed at each step in the manufacturing process, each time a product is made.  Regulatory requirements evolve over time following the course of scientific progress. Substantial scientific advances have been made to improve the methods of producing rabies vaccines and RIG and in developing new assays and tests. Major advances in molecular biology techniques have been extensively applied, for instance to express recombinant monoclonal antibodies directed against the rabies virus (RABV) glycoprotein for testing in clinical trials (2, 3). Thus, additional regulatory requirements need to be taken into consideration nowadays by rabies researchers and professionals, such as the existing guidelines and pharmaco- poeial monographs for monoclonal antibodies (4, 5). There has been a great deal of efforts to align regulatory requirements across the world. The establishment of the International Council for Harmonisation of Technical Requirements for Pharmaceuticals for Human Use (ICH) in 1990, a collaborative initiative among the European Union, Japan and the United States with observers from WHO, the European Free Trade Association and Canada, was a milestone in facilitating the harmonization of medicines regulation (6). ICH guide- lines focus primarily on technical requirements for new, innovative medicines. Outside of the ICH regions and associated countries, many regulatory requi- rements have been addressed by WHO. In the field of quality assurance of medi- cines, WHO plays an important role, especially for those countries with few means to develop their own quality controls, and helps national competent authorities with various activities such as creating nomenclatures, guidelines, delivering trai- ning and awareness courses, and fostering discussions surrounding regulatory science to build and increase capacity. A regulatory tool particularly relevant for developing countries is the “WHO prequalification of medicines”, a process which vets promising medicines around the world. Prequalification is often a condition under which international donors, such as the vaccine alliance GAVI, consider procuring them. The WHO Prequalifi- cation of Medicines Programme helps ensure that medicines supplied by procure- ment agencies meet acceptable standards of quality, safety and efficacy (7). The work of WHO is supported and complemented by other organizations and authorities, using specific regulatory pathways such as the European Union Article 58 of Regulation (EC) No 726/2004. This procedure enables the European Medi- cines Agency (EMA) to assess products and provide scientific advice for WHO. A procedure based on Article 58 includes an EMA assessment of the quality, safety and efficacy of a medicine intended for use outside the European Union, based on the same standards and procedures as those for medicines marketed in the Euro- pean Union. Article 58 has been applied successfully in recent years, for example for assessment of the malaria vaccine Mosquirix and anti-HIV medicines (8). Laboratory techniques in rabies Fifth edition 96 Regulatory perspectives Part 6. Production of biologicals Regulatory challenges for rabies biologicals To facilitate the availability of safe, effective and good-quality medicines, products such as RIG and vaccines need to be tested in laboratories, as mandated by their pharmacopoeial monographs. One challenge in testing rabies biologicals is the need for high-containment biosecure laboratories, e.g. for measuring the neutralizing potency of RIG or neutralizing antibodies in serum following vaccina- tion. Serological methods to analyse vaccine-induced humoral responses to RABV include the fluorescent antibody virus neutralization (FAVN) test (see Chapter 20), the rapid fluorescent focus inhibition test (RFFIT), discussed in Chapter 19, and the enzyme-linked immunosorbent assay, ELISA (9) as well as variations of the aforementioned assays (10, 11). The routinely used FAVN assay and RFFIT are the assays of choice with OIE/ WHO reference laboratories and make use of live virus neutralization assays. The standard methods to test for neutralizing antibodies against RABV involve high containment, Biosafety Level 3 facilities; however, most rabies-endemic countries have resource-limited laboratories and performing the assays under high contain- ment presents several financial and logistical challenges. To address these issues, several techniques have been developed, including the pseudotype neutralization assay (PNA) (12, 13). Pseudotypes are viruses that carry the genome and core of one virus and the envelope of another. RABV pseudotypes have been constructed using lentiviral backbones and an analytical method established that utilizes these replication-incompetent viruses to accurately measure neutralizing antibody titres. This method has the advantage of allowing experiments to be conducted in category 2 biosafety laboratories as the pseudotypes cannot replicate and are unable to cause a lasting infection (12, 13). The assay also benefits from detecting virus neutralizing antibody alone, in contrast to ELISA, and gives a more detailed picture of the protective antibodies present (as not all virus-binding antibodies are necessarily neutralizing). Furthermore, the RABV pseudotypes were demonstrated to be stable during freeze–thaw cycles and storage at room temperature, confir- ming that the proposed analytical method could be a useful option for conducting neutralization studies in regions most affected by these infections (12, 13). Although not currently registered in pharmacopoeias, such an assay would be ideally suited for use in resource-limited countries and should be incorporated in the relevant guidance and monographs in future. Apart from the financial and logistical challenges associated with current neutralization assays, low accessibility to medicines for post-exposure prophy- laxis (PEP) is problematic across many rabies-endemic countries. Access to the recommended complete PEP regimen components such as RIG remains insuffi- cient. Human RIG (HRIG) is widely unavailable in rabies-endemic countries and its supply depends on a limited number of vaccinated individuals as donors (14). Cheaper equine rabies immunoglobulins (ERIG) are available in limited quantities but several manufacturers are discontinuing ERIG production. The remaining ERIG manufacturers are mainly local ones with limited capacities for expansion. In the past, there were also some safety concerns regarding adverse events in recipients of ERIG, although purification techniques have advanced and the safety profile of ERIG has greatly improved. Adverse events with ERIG have been mitigated by generating antibody fragments lacking the equine antibody Fc region, i.e. F(ab’)2 fragments, but these are less potent than whole antibodies and usually have only Laboratory techniques in rabies Fifth edition 97 Regulatory perspectives Part 6. Production of biologicals a few days of half-life. Thus, a widely available product that could be used along- side HRIG and ERIG would be highly desirable. The use of monoclonal antibodies (MAbs) could address the low availability of RIG and overcome variability in specificity and potency. MAbs can be produced in cell lines using large bioreactors and can therefore easily be expanded to address the low availability of RIG. While MAbs have significant promise as rabies PEP agents, they are not without limitations, including expense, but some low-cost production platforms have been described (15, 16). As MAbs come in the form of a concentrated product, they may also be more effective than polyclonal serum at wound infiltration, and thereby reduce the introduction of excess volume at the site of intramuscular injection, which in turn could lead to a better local tolerabi- lity (2). While MAbs are a step ahead in terms of scalability and lot-to-lot consistency, navigating the complicated clinical development path for rabies MAbs and asso- ciated ethical considerations remains complicated. Their effect may be difficult to measure in any feasible clinical trial, particularly for phase III efficacy studies. Most trials so far have been conducted in the non-RABV exposed population, which allow the study of different components and combined regimens of esta- blished and proposed PEP. Initial exploration of tolerability of a novel rabies MAb and information about adverse events can be understood from these types of trials. While early stage clinical trials in non-RABV exposed healthy volunteers can provide some information about the safety and tolerability of a medicine, the rela- tion to protection against disease when used after exposure may be complex. A range of factors could potentially contribute to the absence of RABV after recei- ving PEP following a suspected exposure; thus, the absence of clinical disease may not indicate the effect of the antibody component. Differences in bite sites, viral strains and animal vectors might influence any studies in a population poten- tially exposed to RABV. The risk of developing rabies after a suspected expo- sure depends on multiple factors, such as whether the biting animal was rabid, whether the animal was shedding RABV, how close the bite was to the central nervous system, whether the bite site was thoroughly cleaned, and whether an appropriate rabies vaccination series was initiated and completed. While a placebo control would put patients at inappropriate risk and might not be ethically possible for rabies in a clinical trial setting, the use of HRIG for compa- rison presents some challenges including its low availability and the fact that the efficacy of the RIG/vaccine combination has not been rigorously tested under controlled conditions, as stated in the Imogam HRIG product label. Close atten- tion must therefore be paid to the clinical trial design, to ethical considerations of such testing in adults and children, and to measurements that might aid our understanding about whether a new rabies MAb product provides early protection without increasing vaccine interference. Worldwide, several rabies MAbs are in various stages of development (17). One MAb has received a marketing authorization in a pioneering project completed by MassBiologics and the Serum Institute of India (3, 18). A phase I clinical trial and a phase II/III trial were undertaken for this Mab. The phase II/III randomized, single blind, non-inferiority study was conducted in 200 participants with WHO category III suspected  rabies  exposures. Study participants received proper Laboratory techniques in rabies Fifth edition 98 Regulatory perspectives Part 6. Production of biologicals wound care followed by injections of either the investigational MAb or the stan- dard HRIG treatment in combination with the vaccine (18). On Day 0, participants received either the MAb or HRIG (1:1 ratio) into wounds and, if required, five doses of rabies vaccine intramuscularly on days 0, 3, 7, 14 and 28. The primary end-point was the ratio of day 14 geometric mean concentration of rabies virus neutralizing antibodies (RVNA) activity as measured by RFFIT for MAb recipients relative to HRIG recipients. Initially, only patients with category III exposures on the lower extremities were enrolled, followed by evaluation in patients with any type of category III exposure after interim analysis. No case of PEP failure or rabies was observed during the study period. The PEP regimen containing the MAb was safe and demonstrated non-inferiority to HRIG PEP in neutralizing anti- body production. A marketing authorization was received in India in October 2016 and an event announcing the launch of this antibody (branded as Rabishield) was held in October 2017 in Mumbai. Two presentations of the MAb are available, including a 100 IU/2.5 mL (40 IU/mL) vial and a 250 IU/2.5mL (100/mL) vial (19). According to the Serum Institute of India, Rabishield might be offered at a cost 25% cheaper than existing RIGs (20). It will be interesting to see how this innovative product is taken up by medical professionals. The availability of this MAb could fill critical public health gaps. As it is made by recombinant technology, it will be less prone to problems such as availability, safety and purity. It should be recommended for use in public health programmes, depending on the epidemiological and geographical setting, with monitoring of its safety and efficacy (clinical outcomes) during post-marketing use. The advent of this MAb presents an important step in making rabies PEP more accessible, and cost savings compared with RIG might be even more pronounced once additional MAbs are licensed. Another project on rabies MAbs, initiated by the WHO Rabies Collaborating Centres (21), provided several MAbs for inclusion in an antibody cocktail. Two MAbs were selected based on their strong potencies and different epitope specifi- cities and were transferred to other parties and manufacturers. Preclinical studies of the WHO MAbs were undertaken by multiple groups (22, 23); the Indian company Zydus Cadila has taken the MAbs into clinical trials. Another project on a Mab cocktail comprising two MAbs was undertaken by Crucell (2); however, the company was sold following phase II clinical trials and product development was discontinued. Clinical trials for a MAb combination have also been initiated by Synermore Biologics, China (17, 24). Finally, several other companies including the Korean biologicals manufacturer Celltrion have generated strong preclinical data (25) which could pave the way for clinical studies of their MAbs. The following sections will focus on general quality requirements for rabies biologicals, whether they are MAbs, RIGs or rabies vaccines. Laboratory techniques in rabies Fifth edition 99 Regulatory perspectives Part 6. Production of biologicals Specifications and controls A specification is a list of tests and methods with appropriate acceptance criteria, such as numerical ranges or other criteria for the tests described. The tests concern the active substance, finished product or, potentially, materials at other stages of their manufacture. “Conformance to specification” means that the drug substance and drug product, when tested according to the listed analytical procedures, will be compliant with their prespecified acceptance criteria. Specifications are just one part of a total control strategy designed to ensure quality and consistency of products. Other parts of this strategy include extended characterization during development, compliance with Good Manufacturing Prac- tice (GMP), validation of the manufacturing process, validation or qualification of the analytical methods, quality of raw materials, in-process testing and stability studies. Specifications are chosen to corroborate the quality of the active subs- tance and finished product and should not focus on all quality attributes, but rather on those that are most relevant for the safety and efficacy of the medicine. Minimum standards for specifications are listed in monographs and usually include at least identity, potency and impurities. Additional product-specific specifications are set by the manufacturers and must be assessed by regulatory authorities before approval of products. Specifications and limits can be set for both the active substance (often also referred to as drug substance) and the fini- shed product (often also referred to as drug product). Pharmacopoeial specifications apply to all products across a class (e.g. rabies cell culture vaccines), independent of their manufacturer. These limits are decided by pharmacopoeial committees, e.g. at the European Directorate for the Quality of Medicines (EDQM) in Strasbourg, France. Conversely, product-specific specifi- cations are set for each individual product by their respective manufacturer. Since specifications are chosen to confirm the quality rather than to fully characterize each product batch, the manufacturer must provide the justification for inclu- ding and/or excluding testing for specific quality attributes. The following points are usually taken into consideration by manufacturers and regulatory agencies when reviewing proposed specifications: specifications should be based on data obtained from lots used to demonstrate manufacturing consistency; they should account for the stability of drug substance and drug product; they are linked to qualified or validated analytical procedures; and they should be based on data obtained for lots used in preclinical and clinical studies. Both pharmacopoeial specifications and product-specific specifications for representative rabies biologicals are further described in the following para- graphs. The setting of specifications and limits is often accompanied by appro- priate control standards, such as the international standard for rabies immunoglo- bulins. Standards are important to ensure that repeatability and reproducibility are maintained. The first international standard for HRIG was established in 1985 and the second was established in 1993 (26). Laboratory techniques in rabies Fifth edition 100 Regulatory perspectives Part 6. Production of biologicals Pharmacopoeial specifications Pharmacopoeias contain important requirements pertaining to certain analy- tical procedures and acceptance criteria, which, where relevant, are part of the evaluation of either the active substance or the finished product. Such mono- graphs, applicable to biological products including rabies vaccines or immuno- globulins, generally include, but are not limited to, tests for sterility, endotoxins, microbial limits, volume in container, uniformity of dosage units and particulate matter. Compliance with available monographs is mandatory, but all tests listed in a monograph do not necessarily have to be performed at release. When agreed by the competent authority, alternative (validated) methods may be used for control purpose. Several pharmacopoeias are in use around the world, e.g. the European Phar- macopoeia (Ph. Eur.), the British Pharmacopoeia (BP) and the United States Phar- macopoeia (USP). These monographs contain the basic requirements for medi- cines, and their content should theoretically also be largely applicable to other regions. As an example, the Ph. Eur. monograph with the specifications for HRIG is summarized below (for full details, refer to Ph. Eur. monograph 0723, Immuno- globulinum humanum rabicum). The Ph. Eur. specifications for RIG include require- ments for definition/identity, potency limits and methods, culture medium, storage and labelling: Definition Sterile liquid or freeze-dried preparation containing immunoglobulins, mainly immunoglobulin G. The preparation is intended for intramuscular administration. It is obtained from plasma from donors immunized against rabies. It contains specific antibodies neutralizing the rabies virus. Human normal immunoglobulin for intramuscular administration (monograph 0338) may be added. It complies with the monograph on Human normal immunoglobulin for intramus- cular administration  (0338), except for the minimum number of donors and the minimum total protein content. Potency The potency is determined by comparing the dose of immunoglobulin required to neutralize the infectivity of a rabies virus suspension with the dose of a refe- rence preparation, calibrated in international units (IU), required to produce the same degree of neutralization. The test is performed in sensitive cell cultures and the presence of unneutralized virus is revealed by immunofluorescence. The IU is the specific neutralizing activity for rabies virus in a stated amount of the Inter- national Standard for anti-rabies immunoglobulin. The equivalence in IU of the International Standard is stated by WHO. Human rabies immunoglobulin BRP is calibrated in IU by comparison with the International Standard. Laboratory techniques in rabies Fifth edition 101 Regulatory perspectives Part 6. Production of biologicals Methods The method for the neutralization assay in suitable cells such as the BHK-21 cell line is described in detail in the monograph. The stated potency is not less than 150 IU/mL. The estimated potency is not less than the stated potency and is not greater than twice the stated potency. The confidence limits (P = 0.95) are not less than 80% and not more than 125% of the estimated potency. Culture medium The culture medium for growth of BHK-21 cells is described in the monograph. Storage and labelling The monograph states requirements for storage and labelling (in IU). As RIG is derived from blood donations, certain regulatory requirements for blood products apply. These products need to be treated to eliminate or reduce any risks of transmission of infectious agents. Briefly, plasma donors are initially screened for exposure to a range of viruses. After fractionation with cold ethanol of plasma from vaccinated donors, the HRIG products such as HyperRAB S/D and Imogam Rabies-HT are treated to eliminate potential pathogens. Use of HRIG in the USA has not resulted in any known cases of transmission of infectious agents (14). For blood products such as HRIG, only donations from qualified donors (“Regular donors”) are accepted for fractionation. To qualify, applicant donors (“First time donors” and “Repeat donors”) usually have to pass a history of two accepted donations given within 6 months of each other. For source plasma, the National Donor Deferral Registry (NDDR) allows donor deferral information to be shared on a confidential inter-company nationwide basis. This ensures that any donor who has been deferred at one centre under NDDR criteria may not donate at another (27). Each manufacturer also operates an inter-centre deferral to ensure that “higher risk” donors are excluded. Donors are encouraged to donate regularly, resulting in frequent virus testing and review of post-donation information. A quali- fied donor who has not donated plasma for 6 months reverts to applicant donor status. All donations are tested at least for Hepatitis B surface antigen (HBsAg), anti-HCV and anti-HIV 1 and 2 antibodies. The lower incidence of positive results in qualified than in applicant donors confirms the effectiveness of donor selection, testing and exclusion in limiting the risk of transmitting infections in plasma. A three-stage system is usually in place to ensure the safety of blood products such as RIG, namely: 1. Selection of healthy donors, with all donations tested and traceable to the donor; 2. Further safety tests of plasma minipools and pools in advance of the manufac- turing process; and 3. Virus removal and inactivation steps during the manufacturing process (e.g. low pH virus inactivation steps, virus filtration, heat treatment). Laboratory techniques in rabies Fifth edition 102 Regulatory perspectives Part 6. Production of biologicals Manufacturers’ product specifications In contrast to the pharmacopoeial specifications mentioned in the preceding paragraphs, product-specific specifications are set for each individual product by their respective manufacturer and are part of the registration process for each individual rabies vaccine and immunoglobulin. These specifications are critical quality standards that are proposed and justified by the manufacturer and reviewed by regulatory authorities as conditions of approval. They vary depending on the manufacturing process and are usually part of commercially confidential information provided in marketing authorization dossiers; hence they will not be described here. However, some general considerations apply: specifications set by the manufacturer should take into account the control of raw materials and excipients, in-process testing, process evaluation or validation, batch analysis data and stability. Finished product specifications should normally also be justi- fied with reference to batch analysis data from clinical trial batches and the limits for potency/purity/impurities should be clinically qualified. An in-depth characterization of a biological product by appropriate methods is necessary to allow suitable specifications to be set. Extensive characterization is performed in the development stages of a product and occasionally after licen- sing following substantial process changes. Heterogeneity may be observed during manufacture and/or storage of the drug substance or drug product. The degree of this heterogeneity should be evaluated, to assure consistency between production lots. When these variants have proper- ties closely related to those of the desired product with respect to activity, effi- cacy and safety, they are considered product-related substances. When process changes and degradation products result in heterogeneity patterns which are not clinically qualified, i.e. they differ from those observed in the material used during preclinical and clinical development, the significance of these alterations must be further investigated. Purity The absolute as well as relative purity should be analysed using suitable analy- tical methods. Traditionally, the relative purity of a biological product is expressed in terms of specific activity (that is, units of biological activity per mg of product) which could be highly method-dependent. Thus, the purity of the drug substance and drug product is usually assessed by a range of analytical methods. For the purpose of lot release, an appropriate set of methods is selected and justified for determination of purity. Impurities The manufacturer should assess impurities, either process or product-related. When adequate quantities of impurities can be enriched, they should be evaluated to the extent possible, including their impact on biological activity. Product-related impurities (e.g. precursors, certain degradation products) encompass molecular variants arising during manufacture and/or storage, which do not have properties comparable to those of the desired product with respect to activity, efficacy, and safety. Process-related impurities are those that are derived from the manufac- turing process, i.e. cell substrates (e.g. host cell proteins, host cell DNA), cell Laboratory techniques in rabies Fifth edition 103 Regulatory perspectives Part 6. Production of biologicals culture (e.g. inducers, antibiotics, or media components), or materials used in downstream processing. The acceptance criteria for impurities should be based on data obtained from lots used in preclinical and clinical studies and manufactu- ring consistency lots. Contaminants Contaminants include all adventitiously introduced materials not intended to be part of the manufacturing process, such as chemicals or microbial proteases. Contaminants should be strictly avoided and/or suitably controlled with appro- priate in-process acceptance criteria or action limits for drug substance or drug product specifications. In-process controls In addition to specifications for the active substance and the finished product, so called in-process controls (IPC) and tests are performed at critical decision-ma- king steps during manufacture. These data should be used to confirm consistency of the process during the production of either the active substance or the fini- shed product. The results of in-process testing may be recorded as action limits or reported as acceptance criteria. Performing such testing may eliminate the need for testing of the active substance or finished product. In-process testing for adventitious agents at the end of cell culture is an example of testing for which acceptance criteria should be established. Data obtained during development and validation runs should provide the basis for provisional action limits to be set for the manufacturing process. These limits, which are the responsibility of the manufacturer, may be used to initiate investigation or further action. They should be further refined as additional experience and further data are obtained after product approval. Raw materials and excipient specifications The quality of the raw materials used in the production should meet standards. Moreover, the quality of the excipients should meet pharmacopoeial standards. Otherwise, suitable acceptance criteria should be established for any non-phar- macopoeial excipients. Release limits vs shelf-life limits The stability of the medicine should be established, and an appropriate shelf- life should be set. The limits might be different for release and during shelf-life, i.e. limits are usually tighter for the release than for the shelf-life of the drug substance or drug product, e.g. in the case of potency and degradation products. Future perspectives An interesting development that could help advance the regulation of medi- cines such as rabies biologicals is the launch of an African Medicines Agency (AMA) (28). The AMA is intended to be an organ of the African Union legally mandated by Member States to provide a platform for coordination and stren- gthening of ongoing initiatives to harmonize the regulation of medicines. The remit Laboratory techniques in rabies Fifth edition 104 Regulatory perspectives Part 6. Production of biologicals of the AMA will be to speed up the availability of affordable medicines that are needed on the continent and reduce dangerous, poor-quality and falsified medi- cines. It will protect public health across 54 Member states, serving 1.13 billion African people. Like the EMA, its European counterpart, the AMA will not replace national regulators, who will continue their work to register medicines that are safe and efficacious for their own populations. Instead, the AMA will provide regulatory guidance, oversee emerging issues such as pandemics, review adverse effects of medicines and vaccines, and conduct inspections of manufacturing facilities to check that medicines are being manufactured at good international manufactu- ring quality standards. The agency has been set up by African Heads of State and Government with help from the WHO Regional Committee for Africa, as the result of a longstanding strategy to improve regulatory capacity on the continent (29). The establishment of the AMA, together with the advent of rabies MAbs and innovations such as pseudotype neutralization assays, should contribute to the widespread availability of high-quality, safe and effective rabies biologicals in the future. References 1. Immunoglobulinum humanum rabicum. In: European Pharmacopoeia, 9th edition monograph 0723; (http://www.uspbpep.com/ep60/human%20rabies%20 immunoglobulin%200723e.pdf, accessed 1 October 2018). 2. Bakker AB, Python C, Kissling CJ, Pandya P, Marissen WE, Brink MF, et al. First administration to humans of a  monoclonal antibody  cocktail against  rabies  virus: safety, tolerability, and neutralizing activity. Vaccine. 2008;26:5922–7. doi:10.1016/j.vaccine.2008.08.050. 3. Gogtay N, Thatte U, Kshirsagar N, Leav B, Molrine D, Cheslock P, et al. Safety and pharmacokinetics of a human monoclonal antibody to  rabies  virus: a randomized, dose-escalation phase 1 study in adults. Vaccine. 2012;30:7315– 20. doi:10.1016/j.vaccine.2012.09.027. 4. Monoclonal antibodies for human use. In: European Pharmacopoeia, 9th edition (monograph 2031; http://www.uspbpep.com/ep60/monoclonal%20 antibodies%20for%20human%20use%202031e.pdf, accessed 1 October 2018). 5. Guideline on development, production, characterisation and specification for monoclonal antibodies and related products. London (UK): European Medi- cines Agency; 2016. 6. ICH guidelines. In: ICH: harmonization for better health [website]. Geneva: International Council for Harmonisation of technical Requirements for Phar- maceuticals for Human Use (http://www.ich.org/products/guidelines.html, accessed 1 October 2018). 7. Prequalification of medicines by WHO [fact sheet]. Geneva: World Health Organization; 31 January 2013 (http://www.who.int/mediacentre/factsheets/ fs278/en/, accessed 1 October 2018). Laboratory techniques in rabies Fifth edition 105 Regulatory perspectives Part 6. Production of biologicals 8. Medicines for use outside the European Union. In: Marketing authorisa- tion [website]. London (UK): European Medicines Agency (http://www.ema. europa.eu/ema/index.jsp?curl=pages/regulation/document_listing/docu- ment_listing_000157.jsp, accessed 1 October 2018). 9. Cliquet F, McElhinney LM, Servat A, Boucher JM, Lowings JP, Goddard T. Development of a qualitative indirect ELISA for the measurement of rabies virus-specific antibodies from vaccinated dogs and cats.  J Virol Methods. 2004;117:1–8.  doi:10.1016/j.jviromet.2003.12.001. 10. Brookes SM, Parsons G, Johnson N, McElhinney LM, Fooks AR. Rabies human diploid cell vaccine elicits cross-neutralising and cross-pro- tecting immune responses against European and Australian bat lyssa- viruses. Vaccine. 2005;23:4101–4109. doi:10.1016/j.vaccine.2005.03.037. 11. Khawplod P, Inoue K, Shoji Y, Wilde H, Ubol S, Nishizono A. A novel rapid fluorescent focus inhibition test for rabies virus using a recombinant rabies virus visualizing a green fluorescent protein. J Virol Methods. 2005;125:35– 40. doi:10.1016/j.jviromet.2004.12.003. 12. Wright E, Temperton NJ, Marston DA, McElhinney LM, Fooks AR, Weiss RA. Investigating antibody neutralization of lyssaviruses using lentiviral pseudotypes: a cross-species comparison.  J Gen Virol.  2008;89:2204–13. doi:10.1099/vir.0.2008/000349-0. 13. Wright  E, McNabb S, Goddard T, Horton DL, Lembo T, Nel LH, et al. A robust lentiviral pseudotype neutralisation assay for in-field serosurveillance of rabies and lyssaviruses in Africa. Vaccine. 2009;27:7178–86. doi:10.1016/j. vaccine.2009.09.024. 14. Both L, Banyard AC, van Dolleweerd C, Horton DL, Ma JK, Fooks AR. Passive immunity in the prevention of rabies. Lancet Infect Dis. 2012;12:397–407. doi:10.1016/S1473-3099(11)70340-1. 15. Both L, van Dolleweerd C, Wright E, Banyard AC, Bulmer-Thomas B, Selden D, et al. Production, characterization, and antigen specificity of recombinant 62-71-3, a candidate monoclonal antibody for rabies prophylaxis in humans. FASEB J. 2013;27:2055–65. doi:10.1096/fj.12-219964. 16. Ko K, Tekoah Y, Rudd PM, Harvey DJ, Dwek RA, Spitsin S, et al. Function and glycosylation of plant-derived antiviral monoclonal antibody. Proc Natl Acad Sci U S A. 2003;100:8013–8. doi:10.1073/pnas.0832472100. 17. Rabies monoclonal antibodies post exposure (http://www.who.int/rabies/ resources/Summary-rabies-mAbs-for-Web_Dec2016.pdf, accessed 1 October 2018). 18. Gogtay NJ, Munshi R, Ashwathnarayan DH, Mahendra BJ, Kshirsagar V, Gunale B, et al. Comparison of a novel human rabies monoclonal antibody to human  rabies  immunoglobulin for post-exposure prophylaxis: a phase 2/3 randomized, single blind, non-inferiority, controlled study. Clin Infect Dis. 2018;66:387–95. doi:10.1093/cid/cix791. Laboratory techniques in rabies Fifth edition 106 Regulatory perspectives Part 6. Production of biologicals 19. Rabishield: rabies human monocloncal antibody. In: Products supplied over- seas [webpage]. Pune: Serum Institute of India PVT Ltd (https://www.seru- minstitute.com/product_recombinant5.php, accessed 1 October 2018). 20. AdarPoonawalla, CEO Serum Institute of India: “Our new drug – Rabishield – is a first-of-its-kind product for passive immunization against rabies [news article]. In: Indian News & Times; 2018. http://www.indiannewsandtimes. com/2017/10/31/63925our-new-drug-rabishield-is-a-first-of-its-kind-pro- duct-for-passive-immunization-against-rabies/, accessed 1 October 2018). 21. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Development of a mouse monoclonal antibody cocktail for post-ex- posure  rabies  prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. 22. van Dolleweerd CJ, Teh AY, Banyard AC, Both L, Lotter-Stark HC, Tsekoa T, et al. Engineering, expression in transgenic plants and characterisa- tion of E559, a  rabies virus-neutralising monoclonal antibody. J Infect Dis. 2014;210:200–8. doi:10.1093/infdis/jiu085. 23. Tsekoa TL, Lotter-Stark T, Buthelezi S, Chakauya E, Stoychev SH, Sabeta C, et al. Efficient in vitro and in vivo activity of glyco-engineered plant-pro- duced rabies monoclonal antibodies E559 and 62-71-3. PLoS One. 2016;11:e0159313. doi:10.1371/journal.pone.0159313. 24. Chao TY, Ren S, Shen E, Moore S, Zhang SF, Chen L, et al. SYN023, a novel humanized monoclonal antibody cocktail, for post-exposure prophy- laxis of rabies. PLoS Negl Trop Dis. 2017;11:e0006133. doi:10.1371/journal. pntd.0006133. 25. Kim PK, Keum SJ, Osinubi MOV, Franka R, Shin JY, Park ST, et al. Deve- lopment and characterization of novel chimeric monoclonal antibodies for broad spectrum neutralization of rabies virus. PLoS One. 2017;12:e0186380. doi:10.1371/journal.pone.0186380. 26. Other rabies biological products. In: Rabies [website]. Geneva: World Health Organization; 2018 (http://www.who.int/rabies/resources/other_rabies_ biolog_product/en/, accessed 1 October 2018). 27. National Donor Deferral Registry. In: Quality and standards [website]. Plasma Protein Therapeutics Association (http://www.pptaglobal.org/plas- ma-protein-therapies/overview?catid=0&id=19, accessed 1 October 2018). 28. African Medicines Agency [news story]. In: New Partnership for Africa’s Development (NEPAD) [website]; 22 February 2017 (http://www.nepad.org/ content/african-medicines-agency, accessed 1 October 2018). 29. Zarocostas J. Health ministers adopt African Medicines Agency treaty. Lancet. 2018;391:2310. doi:10.1016/S0140-6736(18)31313-8. Laboratory techniques in rabies Fifth edition 107 Regulatory issues Part 6. Production of biologicals Chapter 36 Regulatory issues in the development of animal biologicals for rabies Introduction Vaccinating domestic animals against rabies creates an effective barrier between the human population and rabies reservoirs. In multiple countries, mass canine vaccination yields a concomitant decrease in the incidence of human rabies cases (1–4). For this reason, many countries require vaccination of dogs and cats, and have strict requirements for importation of these animals regarding rabies vaccination status. Under some conditions of herd health management, it may be advisable to vaccinate livestock as well, especially in areas endemic for rabies where exposure to lyssavirus virus vectors is likely, such as with vampire bat exposure in the New World (5). In addition, vaccination of wildlife reservoirs can be a powerful tool for controlling endemic rabies in susceptible wildlife popu- lations (2–4, 6, 7). These efforts can further reduce human exposure by decreasing the likelihood of direct human contact with a rabid wild animal, and the likelihood of domestic animal contact and subsequent secondary human exposure. Hence, use of veterinary rabies vaccines can substantially reduce human exposures, resulting in fewer human deaths and reduced need for expensive post-exposure prophylaxis (PEP) in humans. Similarly, licensed diagnostic kits may be used for the detection of viral antigens, antibodies and amplicons from suspect animals. Regulatory considerations concerning vaccines for use in domestic animals Regulatory approval of rabies vaccines for use in domestic animals should be based upon solid evidence of their safety, purity, potency and efficacy. Early vaccines were based upon rabies virus (RABV) grown in adult or suckling animal brain tissue (3). While these products provided a much-needed tool for control of rabies in domestic animals, they are now obsolete and, given the high rates of adverse events, should not be considered for use. Tissue culture origin, inac- tivated vaccines and recombinant vaccines are now the preferred candidates for use in domestic animals. Worldwide, many vaccines are available for use in domestic animals. For example, products available from the United States, Canada, the European Union, Australia, New Zealand and Japan have met rigorous standards of safety, purity, potency and efficacy as required by these countries and regions. While the requirements for approval of rabies vaccines have not been harmonized worldwide, competent regulatory authorities use similar principles to assure that products are safe, pure, potent and effective. Evaluation for safety should include laboratory studies in host and non-host animals, as well as large-scale field studies. Batch safety should be confirmed either by laboratory and/or host animal testing and through demonstration of a high level of consistency in production. Laboratory techniques in rabies Fifth edition 108 Regulatory issues Part 6. Production of biologicals Evaluations for purity should begin with using a Master Seed and Master Cell concept. The cell cultures and virus seeds used should be characterized thoroughly and shown to be free of adventitious agents, before being approved for vaccine production. In addition, purity checks should be done at various stages of production. These might include testing of working seeds, production seeds and harvested bulks. Finally, each batch should be tested for mycoplasma, fungal, and bacterial contamination after filling of final containers. Assays should be well validated and should include proper controls to ensure assay integrity. Potency testing will be dependent upon the nature of the product. Currently, the standard approach for inactivated rabies vaccines for most countries is the NIH test or a modification of this assay (8). Briefly, mice are vaccinated with finished product, then challenged with a standard rabies challenge virus (see Chapter 42). This assay has been in place since the 1950s, and has several drawbacks. The assay takes at least one month to perform, and the outcome is highly variable. This results in frequent “no tests” because of the stringent validity requirements, requiring frequent retests. The assay is costly to run, represents a human health risk and results can vary dramatically from one operator to the next based on experience with the assay. In addition, the test relies on a standard reference vaccine, which must be replenished or replaced frequently (9). Efforts have been made to replace the mouse potency assay, but because most inactivated rabies vaccines for animals include an adjuvant, the development of an ELISA or other assay platform is complicated by the need to break the emulsion or dissociate antigen from the adjuvant (8, 10). This has proven challenging and, to date, there is no well-characterized, well-validated assay to replace the National Institutes of Health test for veterinary vaccines. However, efforts are ongoing to define a replacement test or battery of tests to measure potency (10, 11). Currently, most of the work being done is based on measurement of the trimeric form of the RABV glycoprotein (G). Recombinant vaccines for use in domestic and feral animals have been developed using various viral vectors, including non-virulent viruses such as raccoonpox, canarypox and others (4, 12). The RABV G gene is spliced into the vector, and the products are replication-competent in tissue cell culture, but most are replication-limited in vaccinates. Potency can be based on a simple virus titre accompanied with confirmation of protein expression. The titre for finished product should be based on the titre used in the pivotal efficacy trials, with some overage included to account for assay variability and titre loss over shelf-life. Efficacy should be based on host animal vaccination or challenge studies. The challenge phase of the efficacy trial should take place at the end of the recom- mended revaccination period; that is, if the product is labelled for annual revac- cination, the challenge event should occur at least one year after the vaccination event, and so forth for other duration of immunity claims. Products for domestic animals should result in a prevented fraction that approaches 85–90%. Relevant regulatory authorities should require that manufacturers of RABV vaccines have a vaccinovigilance or pharmacovigilance programme that is regu- larly reviewed and monitored. While no vaccine can be expected to provide 100% efficacy, reports of lack of efficacy should be investigated thoroughly. At the very least, a complete history of the animal involved should be obtained, the condi- tions of product administration should be determined, and retention samples of Laboratory techniques in rabies Fifth edition 109 Regulatory issues Part 6. Production of biologicals the product serial or batch should be tested for potency. If vaccine failure in an individual case is determined to be the result of a lack of sufficient potency, or if a cluster of reports occurs, a product recall should be conducted. End users should be notified, and animal revaccination should be strongly encouraged. Regulatory considerations for use of vaccines in wildlife Many countries have used wildlife vaccination campaigns to address epizootic outbreaks in wildlife reservoirs, such as raccoons, foxes, coyotes, and other meso- carnivores. Early work in this area involved trap/vaccinate/release campaigns using conventional parenteral vaccination. These efforts are resource intensive, and success is variable (3). Subsequent efforts that have shown success involve distribution of vaccine- laden baits. These products are either highly attenuated modified-live RABV or recombinant virus vectors containing the RABV G gene (3). Regulatory considerations for wildlife vaccines should include similar standards as those for domestic animals regarding safety, purity and potency. However, effi- cacy requirements may be adjusted species-by-species based on disease preva- lence, animal distribution density, migratory patterns, species behaviour and other factors. For example, it might be possible to disrupt an epizootic with a slightly less efficacious vaccine if the baiting programme achieves adequate coverage, but this is dependent upon the nature of the target species and factors specific to the disease situation. Regulatory authorities should work closely with wildlife specialists and other experts to develop a rational approach for establishing effi- cacy requirements for wildlife vaccines. Diagnostic test kits for use in animals Diagnostic tests for suspected rabies cases in animals should be conducted by well-trained personnel, using well-validated assays. Currently, there are no testing protocols for use in living animals; the “gold standard” is based on the direct fluorescent antibody test or DFAT (see Chapter 11), using postmortem brain tissue  (12). Most developed countries have established testing protocols, and laboratories engaged in testing have appropriate quality systems in place and participate in regular proficiency testing. Routine use of point-of-care diagnostic test kits is controversial. Although these types of tests can be useful, they should only be used as screening tools, or in situations where < 100% sensitivity and specificity is tolerable. An example situation would be attempts to conduct disease surveillance in wildlife, where the results are not being used to make management decisions for individual animals, especially in situations of human PEP. Point-of-care kits should be well characterized and validated for sensitivity, specificity, ruggedness, repeatability and reproducibility. Pre-marketing evalua- tion should include a robust field trial to establish and confirm those parameters. End use should be limited to researchers and wildlife management officials. Regulatory oversight of diagnostic test kits varies considerably from region to region. For example, in the United States, point-of-care kits for veterinary use Laboratory techniques in rabies Fifth edition 110 Regulatory issues Part 6. Production of biologicals must be licensed by the United States Department of Agriculture’s Center for Veterinary Biologics. Other countries and regions have requirements ranging from a similar model to limited or no regulatory oversight of such products. Authori- ties considering the approval and use of point-of-care kits should ensure that the products have adequate data supporting sensitivity and specificity claims. Use of post-exposure prophylaxis for unvaccinated domestic animals After exposure to a vaccinated animal, an immediate vaccine booster is recom- mended. Annually, in many countries, thousands of naive animals are euthanized after rabies exposure. Many are unvaccinated because they are too young (i.e. less than 3 months of age). There are currently no well-defined PEP protocols recom- mended for use with such naive domestic animals. However, objectively, there is no reason why such protocols could not be developed. Historically, supplies of anti-rabies immunoglobulin have been limited, costs are very high, and shortages have been commonplace. This situation raised ethical considerations around the use of a scarce commodity in animals when people in many parts of the world have no access to these life-saving materials. Recently, monoclonal antibodies have been developed that are much less expensive to produce and can likely be supplied in large quantities (13, 14). When these products have been fully evaluated, their availability may change the current paradigm related to using such products in exposed or potentially exposed naive animals. Evaluation of such products should be done using host animal exposure-prophylaxis studies as agreed upon by relevant regulatory authorities. Future considerations As technical advances continue, it can be expected that the tools available for rabies diagnosis, prevention and control in animals will expand. Next-generation products should be safer, more efficacious, more user-friendly and, hopefully, more economically sound. Given the status of rabies as a neglected tropical disease, future developments should allow for improved ability for enhanced, decentralized laboratory-based surveillance, to detect and reduce endemic rabies and respond effectively to rabies epizootics as they arise. Efforts should continue to educate at-risk regions as well as funding agencies as to the products and methods avai- lable. These efforts should include information related to product attributes and limitations to help ensure the most efficient allocation of limited resources, parti- cularly as considered by regulatory authorities for all relevant species at risk. Laboratory techniques in rabies Fifth edition 111 Regulatory issues Part 6. Production of biologicals References 1. Lucas CH, Pino FV, Baer G, Morales PK, Cedillo VG, Blanco MA, et al. Rabies control in Mexico. Dev Biol (Basel). 2008;131:167–75. PMID:18634477. 2. Franka R, Rupprecht CE. Treatment of rabies in the 21st century: curing the incu- rable? Future Microbiol. 2011;6:1135–40. doi:10.2217/fmb.11.92. 3. King AA, Fooks AR, Aubert M, Wandeler AI, editors. Historical perspective of rabies in Europe and the Mediterranean Basin. Paris: World Organisation for Animal Health; 2004. 4. Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, et al. Rabies – epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51. doi:10.108 0/01652176.2017.134351. 5. Liu Y, Zhang HP, Zhang SF, Wang JX, Zhou HN, Zhang F, et al. Rabies outbreaks and vaccination in domestic camels and cattle in Northwest China. PLoS Negl Trop Dis. 2016;10:e0004890. doi:10.1371/journal.pntd.0004890. 6. Slate D, Algeo TP, Nelson KM, Chipman RB, Donovan D, Blanton JD, et al. Oral  rabies  vaccination in North America: opportunities, complexities, and challenges. PLoS Negl Trop Dis. 2009;3:e549. doi:10.1371/journal.pntd.0000549. 7. Rupprecht CE, Hanlon CA, Slate D. Oral vaccination of wildlife against rabies: oppor- tunities and challenges in prevention and control. Dev Biol (Basel). 2004;119:173– 84. PMID:15742629. 8. Bruckner L, Cussler K, Halder M, Barrat J, Castle P, Duchow K, et al. Three Rs approaches in the quality control of inactivated rabies vaccines. The report and recommendations of ECVAM workshop 48. Altern Lab Anim. 2003;31:429–54. PMID:15601248. 9. Hermann J, Fry A, Reising M, Patterson P, Siev D, Gatewood D. Rabies vaccine standards: comparison of the 5th and 6th WHO international reference standards to the USDA veterinary reference standard. Vaccine. 2012;30:6892–6. doi:10.1016/j. vaccine.2012.09.002. 10. Jungback C, editor. Potency testing of veterinary vaccines for animals: the way from in vivo to in vitro. Dev Biol (Basel). Basel: Karger; 2012:29–33. 11. Lewis CE, Fry AM, Hermann JR, Siev D, Dusek DM, Gatewood DM. Potency testing of veterinary rabies vaccines: replacement of challenge by in vitro testing: consi- derations for development of alternative assays. Dev Biol (Basel). 2012;134:29–33. doi:10.1016/j.biologicals.2011.10.004. 12. National Association of State Public Health Veterinarians; Compendium of Animal Rabies Prevention and Control Committee. Brown CM, Slavinski S, Ettestad P, Sidwa TJ, Sorhage FE. Compendium of animal rabies prevention and control. J Am Vet Med Assoc. 2016;248.doi:10.2460/javma.248.5.505. 13. De Benedictis P, Minola A, Rota Nodari E, Aiello R, Zecchin B, Salomoni A, et al. Deve- lopment of broad-spectrum human monoclonal antibodies for rabies post-exposure prophylaxis. EMBO Mol Med. 2016;8:407–21. doi:10.15252/emmm.201505986. 14. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Develop- ment of a mouse monoclonal antibody cocktail for postexposure rabies prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. Laboratory techniques in rabies Fifth edition 112 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Chapter 37 Preparation of fluorescent antibody conjugate for the direct fluorescent antibody test Introduction During the past several decades, various live virus or purified antigens have been used to produce polyclonal or monoclonal antibodies for rabies diagnosis, as described in this manual and elsewhere (1–8). Monoclonal antibodies are characterized by their specificity of binding, their homogeneity and their ability to be produced in large quantities. For example, all the antibodies produced by descendants of one hybridoma are identical, making them powerful in testing for the presence of a desired epitope (4). In 1975, Köhler and Milstein developed a technique that allows the growth of clonal populations of cells secreting antibo- dies with a defined specificity (5). In an animal, antibodies are synthesized prima- rily by plasma cells, a type of terminally differentiated B lymphocyte. Polyclonal antibodies are a mixture of antibodies that are secreted by different B cell lineages. These antibodies are a collection of immunoglobulin molecules that react against a specific antigen, and each identifies or recognizes a different epitope(s) on an antigen. In 1973, Dean and Abelseth used inactivated rabies virus (RABV) infected mouse brain suspensions as a source of antigen to immunize animals and from the hyper-immune serum obtained concentrated specific antibodies (3). Generally, antibodies are typically produced by inoculating a suitable mammal, such as mice, rabbits, goats, chickens, guinea pigs, hamsters, horses, rats and sheep. Larger mammals are often preferred, as greater volumes of serum can be harvested. The basic principle is that an antigen is injected into the mammal, and this induces the B-lymphocytes to produce immunoglobulins (e.g. IgG) specific for that antigen. The primary goal of antibody production in animals is to obtain high titre, high affinity antisera for use in experimentation or diagnostic tests. The antigen may be administered with an adjuvant to improve or enhance the immune response to antigens. This chapter outlines the methods used to obtain polyclonal antibo- dies from goats and their labelling with fluorescein isothiocyanate (FITC). At least two animals per antigen should be used, as this reduces the failure resulting from non-responsiveness to antigens of individual animals. Purification of ribo- nucleoprotein (RNP) from baby hamster kidney (BHK) cells infected with a labo- ratory strain, such as Evelyn Rokitniki Abelseth (ERA) and/or Mokola virus 97/252 (MOKV), is described. The RNP is purified by employing ultracentrifugation in a cesium chloride gradient; the resulting RNP is checked for intactness and authen- ticity by immunoblotting with a specific lyssavirus antibody. The protein product(s) can be used for immunizing goats to raise hyperimmune serum, which is subse- quently labelled with either biotin for use in the direct rapid immunohistochemistry test (DRIT), as described in Chapter 12, or the FITC for detection of lyssavirus antigens in the direct fluorescent antibody test (DFAT); see Chapter 11. Laboratory techniques in rabies Fifth edition 113 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Ammonium sulfate precipitation is one of the most commonly used methods for removing proteins from solution. Water molecules are removed from the proteins, thereby decreasing their solubility. Although other salts, such as sodium sulfate, are sometimes used, precipitation of antibodies is commonly done with ammonium sulfate. Ideally, only the highest purity ammonium sulfate should be used. The concentration at which antibodies will precipitate varies from species to species. One disadvantage of using ammonium sulfate is that during the preci- pitation step, other high molecular weight proteins are trapped in the large floc- culent precipitates, thereby improving the purity of the preparation. Antigen production for antibody generation The antigens are purified from BHK-21 cells [ATCC CCL-10] infected with ERA and/or MOKV (Fig. 37.1A). The cells are ruptured by five freeze–thaw cycles, homogenization and detergent action to disrupt the virus envelope. Lipids are removed using solvent and centrifugation. Proteins are separated by polyethylene glycol 8000 (PEG) precipitation followed by elution. Finally, the RNP is purified on a cesium chloride gradient and is dialysed against phosphate buffered saline (PBS) buffer for use in immunization and antibody induction. Fig. 37.1A. RABV-infected murine neuroblastoma cells stained with FITC-labelled conjugate Laboratory techniques in rabies Fifth edition 114 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Protocol 1. Virus isolation and titration 1.1 Lyssavirus infection is confirmed by the DFAT as described (3). From a lyssa- virus-infected sample selected for RNP and hyperimmune serum production, prepare a 10% (w/v) brain tissue homogenate in tissue culture (TC) medium consisting of Dulbecco’s Modified Eagle Medium (DMEM F-12), supple- mented with 10% fetal bovine serum (FBS) and 5% antibiotics/antimycotic. Note: It is crucial that cells are actively growing and healthy. 1.2 Centrifuge the homogenate at 1076 x g (2500 r/min in a Sorvall centrifuge) for 30 min to separate tissue debris, then transfer the supernatant into a sterile 2.0 mL or 5.0 mL polypropylene tube. Repeat this step if necessary to clarify the supernatant further. The supernatant is now ready for use as inoculum. 1.3 Trypsinize a confluent T25 cm2 monolayer of BHK cells and resuspend the cell suspension in 20 mL of TC medium, then infect the cell suspension with a specific lyssavirus species at a multiplicity of 0.1. Mix gently by swirling and distribute 200 µL of the cell suspension into three adjacent wells in two separate 96-well plates as monitor plates. Incubate the two monitor plates and flask at 37 °C in a humidified incubator with 5% CO2 for up to 72 h. After 48 h, fix the first monitor plate with 80% cold acetone for 15 min and air dry for 5 min at room temperature and then stain the monolayer (see Chapter 11). Dilute the current batch of the FITC-conjugated anti-lyssavirus polyclonal antibody to a working concentration with PBS (pH 7.2–7.4). Distribute 50 µL of the conjugate into each well and incubate the plate in a humidified chamber or container at 37 °C for at least 45–60 min. Remove the plate from the incubator, discard the conjugate and rinse three times with PBS (pH 7.2–7.4) to remove unbound conjugate and excess buffer. Blot the plates dry on a stack of paper towel, view under a fluorescent microscope, then record the observations. 1.4 Keep the flask in the incubator until the last monitor plate has been acetone- fixed and stained as in step 1.3. Harvest the supernatant when the infection is 80–100% and establish the virus titres using the Spearman–Kärber method (see Chapter 20). Briefly, remove the flask from the incubator and freeze–thaw three times at −20 oC and room temperature. Harvest the supernatant and clarify at 1076 x g (2500 r/min) for 30 min to remove cell debris and store at −70 oC until required. The virus titre should be at least 105 tissue culture infectious doses (TCID50) for use in subsequent steps. Otherwise, repeat the process as in step 1.1. 2. Virus propagation and cell harvesting 2.1 The virus supernatant with a known titre is used to infect BHK cells re-sus- pended in TC medium. Briefly, determine the cell concentration of BHK cells from a confluent T75 cm2 flask and re-suspend in 10.0 mL of TC medium using a haemocytometer. Detach the BHK cells from 16 T75 cm2 [or T150 cm2] from the surface of the flask using trypsin, pool aliquots together and re-sus- pend into a total volume of 1000 mL with TC medium. For the virus use the formula: volume of virus stock to be added = multiplicity of infection x number of cells / (virus titre) to calculate how much virus is required to infect the re-suspended cells. Laboratory techniques in rabies Fifth edition 115 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 2.2 Infect the re-suspended BHK cells with a lyssavirus at a multiplicity of infection (MOI) of 0.1 and mix by gentle swirling. Sub-culture about 25 mL of infected BHK cells into 40 x T175 cm2 flasks or T150 cm2 and 200 µL into a specific well (take note of the flask from which it originated) into two separate 96-well monitor plates (i.e. one can also use 60- or 72-well plates). Incubate both the monitor plates and the flasks at 37 °C in a humidified incubator with 5% CO2 for 72 h. After 48 h, fix the first monitor plate with 80% cold acetone for 15 min and repeat step 1.3 after 72 h. 2.3 Harvest the BHK cells from the flasks when the monolayer infection is between 80% and 100% on the monitor plate. Remove the flasks from the incubator and carefully pour off TC medium into virucidal solution. 2.4 Scrape the infected monolayer of cells from the surface of the flask using a clean, sterile cell scraper into a 50-mL polypropylene centrifuge tube and collect the pellet of BHK cells by centrifuging at 2988 x g (5000 r/min) for 5 min. Re-suspend the cell pellet in 8.0 mL of cold STE buffer (pH 7.8), and store at −70 °C until required. 3. Ribonucleoprotein (RNP) purification 3.1 Thaw the infected pellet of cells under running cold water and once thawed transfer the sample into a Dounce homogenizer placed in a beaker filled with crushed ice. Homogenize the cell pellet with 10–20 strokes of the loose pestle, followed by 10 to 20 strokes of the tight pestle. Note: It is important that the suspension does not become warm. Sterilized glass beads may also be added to infected pellets; when thawing suspension, shake vigorously. Add 0.2 mL of cold 10% IGEPAL [Sigma Aldrich, USA] for every 1.0 mL of the cell homogenate and stir gently for 30 min using a magnetic stirrer in a cold room (4 °C) or mix the cell homogenate with 10 strokes of the loose pestle without forming foam. 3.2 Add an equal volume of cold 1,1,1,2,3,4,4,5,5,5 decafluoropentane and mix well by inverting the tube several times. Stir the reaction mixture vigorously with a magnetic stirrer for 30 min in a cold room, then centrifuge the reaction mixture for 20 min at 2988 x g (5000 r/min) at 4 °C to separate the phases. Harvest the aqueous layer into a clean 50 ml polypropylene centrifuge tube using a sterile glass Pasteur pipette and store the aliquot at 4 °C. Add cold STE buffer (pH 7.8), equivalent to the starting volume of the cell homoge- nate to the inter-phase and bottom layer. Mix the solution by inverting the tube, then stir vigorously at 4 °C for 30 min using a magnetic stirrer. Centrifuge the reaction mixture at 2988 x g (5000 r/min) at 4 °C for 20 min and harvest the aqueous layer. Pool the aqueous layer supernatant with the previously harvested sample and estimate the total volume of the pooled supernatant. 3.3 Add a final concentration of 0.3 mol NaCl and continue stirring until completely dissolved. For every 1.0 mL of the solution, slowly (over 4–6 h), add 0.06 g of PEG (polyethylene glycol) 8000 while stirring at 4 °C overnight. Laboratory techniques in rabies Fifth edition 116 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Fig. 37.1B. Ultracentrifuge tube demonstrating the two opaque bands observed after RNP purification from infected MNA cells 3.4 Centrifuge the mixture at 7649 x g(8000 r/min) for 30 min at 4 °C and discard the supernatant. Remove traces of moisture from the centrifuge tube using strips of Whatman No. 4 filter paper to absorb the moisture and allow to air dry for 5 min. Add about 500 µL of cold diluted STE buffer (1:4) and break the pellet using a Pasteur glass pipette, then stir at 4 °C overnight. 3.5 Centrifuge the reaction mixture at 7649 x g (8000 r/min) for 30 min at 4  oC and harvest the supernatant using a sterile Pasteur glass pipette into a sterile 50.0 mL polypropylene centrifuge tube. Add 500 µL of cold diluted STE buffer (1:4) to the pellet and solubilize by stirring at 4 °C for 4 h. Collect the superna- tant by centrifugation at 7649 x g (8000 r/min) for 30 min and repeat the same process as previously. Harvest the supernatants and pool with the previous supernatant, then clarify by centrifugation at 11 952 x g (10 000 r/min) for 30 min to remove any cell debris. 3.6 Prepare the different cesium chloride (CsCl) solution densities or gradients of 1.2 g/mL, 1.3 g/mL and 1.4 g/mL with STE buffer (pH 7.8). Note: The supernatant should not exceed 1.5 mL due to size limitation of the centrifuge tube to be used. Overlay the supernatant with 3.0 mL of each CsCl solution starting with 1.2 g/mL, 1.3 g/mL and 1.4 g/mL. Balance the tubes by adding 1.3 g/mL of cold STE buffer. Centrifuge the tubes at 266 676 x g (38 000 r/min) using a high-speed rotor (e.g. SW 41 rotor) for 16 h or overnight. Visualize the bands by placing the tube underneath a light source and a black sheet behind the tube (see Fig. 37.1B). 3.7 Harvest each opaque band into a separate and sterile 2 mL Eppendorf tube. Dialyse the harvested bands using nitrocellulose membrane against 2000 mL of STE buffer (pH 7.8) for 24 h with an STE buffer (pH 7.8); change every 2 h. Finally, dialyse against 2000 mL of PBS (pH 7.2–7.4) overnight. Distribute the harvested and dialysed proteins into labelled cryotubes and store at −70 °C until required. Laboratory techniques in rabies Fifth edition 117 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 4. SDS-PAGE and western blotting 4.1 Assemble the plates on the casting stand with the short glass facing the front and securely tighten to avoid leaking of the gel. Cast two gels, one for the Western Blot analysis and the other for the Coomassie blue staining. 4.2 Prepare both resolving and stacking gels according to Table 37.1, starting with the resolving gel. 4.3 Add the resolving gel between the plates, about 5 cm from the top, and overlay with 2% SDS to prevent bubbles from forming within the resolving gel. Allow the gel to polymerize for at least 30 min. Pour off the 2% SDS, then add 3 mL of the stacking gel on top of the resolving gel. Insert the comb gently between the plates and allow polymerizing for at least 5 min. Dilute samples and controls (10 µL) with an equal volume of sample loading buffer in a locking top Eppendorf tube and boil for 5 min. Mount the casting plates together with the gel onto a mini gel electrophoresis apparatus assembly with the short glass plate facing inwards and add about 20 µL of each sample into the wells. Fill the chamber with running buffer (see Annex) and electrophorese the samples at 100 V for 90 min or turn off when the dye is about a centi- meter from the bottom. Remove the gels and cut-off the stacking gel. Clearly mark the gels by cutting off the bottom corner to indicate the sequence of the samples on the gel. Place the gel in a large Petri dish, add stain solution (see Annex) to cover the gel and shake for 10 min (at 150 r/min). De-stain the gel with de-staining solution until clear. 4.4 For the Western Blot analysis, add running buffer into the gel contained in a Petri dish and allow to equilibrate for 15 min at room temperature with shaking. Cut two pieces of filter paper and nitrocellulose membrane to match the size of the gel and place each in a separate Petri dish containing running buffer. Place on the base of blotting apparatus filter paper, nitrocellulose membrane, gel, filter paper then roll out the bubbles using a Pasteur pipette. 4.5 Attach to power supply and run at a constant 12 V for 40 min. Remove the membrane from the blotting apparatus and block with 5% skimmed milk in PBS (pH 7.2–7.4) buffer. Allow blocking for 60–120 min at room temperature with shaking. Air dry the membrane and mark the top of the membrane to indicate the sequence of the samples. Dilute a labelled anti-lyssavirus mono- Table 37.1. Ratios of reagents used to prepare both resolving and stacking gels for SDS-PAGE and Western Blot analysis Item Resolving gel (10%) Stacking gel (4%) Distilled water 4.00 mL 2.80 mL Acrylamide mix 3.30 mL 0.83 mL 1.5 mol Tris pH 8.8 2.50 mL None 0.5 mol Tris pH 6.8 None 1.30 mL 10% sodium dodecyl sulfate (SDS) 0.10 mL 0.05 mL 10% ammonium persulfate (APS) 0.10 mL 0.05 mL TEMED 0.004 mL 0.005 mL Laboratory techniques in rabies Fifth edition 118 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals clonal antibody with horse radish peroxidase (HRP) in a 1:5 ratio known to react with specific lyssavirus species nucleoprotein or the target protein and add into the Petri dish containing the membrane. Incubate for 60–120 min with shaking at room temperature. Wash the membrane three times with PBS (pH 7.2–7.4) buffer and add chromogenic substrate buffer (TMB) to visualize the bands (Fig. 37.1C). 5. Immunization of animals 5.1 Obtain female goats aged 4–6 months. Provide all routine veterinary care, such as deworming (i.e. using anthelminthics [such as Valbazen Ultra and closantel, or similar]) and observe for 7 days. Collect 25 mL of blood from the jugular vein before the animals are immunized to obtain baseline antibody data. 5.2 Immunize the goats intramuscularly into the biceps femoris on day 0 with the RNP of interest (e.g. ERA RABV) together with complete Freund’s adjuvant in a total volume of 1 mL (1:1 ratio). It is recommended that the adjuvant is well emulsified prior to immunization. 5.3 On day 21, collect 25 mL blood through the jugular vein and administer a booster with ERA RNP together with incomplete Freund’s adjuvant in a total volume of 1 mL (1:1 ratio). Separate serum by centrifugation at 2988 x g (5000 r/min) and establish antibody titres by performing the immunofluores- cence assay (IFA) as described in Chapter 21 of this manual. 5.4 On day 42, collect blood (25 mL) from the goats, separate serum by centri- fugation and establish antibodies titres using IFA as described previously. Administer further booster doses on day 49 if a low antibody titre is observed (< 1:1000). Fig. 37.1B. Ultracentrifuge tube demonstrating the two opaque bands observed after RNP purification from infected MNA cells Laboratory techniques in rabies Fifth edition 119 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 5.5 On day 63, collect a sufficient blood sample (at least 50 mL) into sterile 250 mL bottles. Allow the blood to clot and collect serum by centrifugation as done previously. Establish the antibody titre by IFA and store serum at −20  °C if > 1:10 000 until required. Administer a further booster with a different lyssa- virus species (e.g. MOKV RNP) to generate broadly cross-reactive polyclonal antibodies. 5.6 On days 77 and 91, collect sufficient blood (at least 50 mL) from the jugular vein of animals into sterile 250 mL bottles. Allow the blood to clot, collect serum and clarify by centrifugation as done previously. Establish the antibody titre by IFA and store serum at −20 °C until required. Once the titre is adequate, sedate the animals, conduct a final bleeding and serum collection, euthanize the animals appropriately and incinerate the carcasses upon completion of the last collection. 6. Ammonium sulfate precipitation of immunoglobulins A maximum of 25 mL of serum should be processed at any one time. All solutions are prepared in advance and stored at 4 °C until required. Each newly prepared batch of FITC-conjugated immunoglobulin is tested for sensitivity and specificity against known circulating lyssaviruses in the geographical area. 6.1 Thaw serum and centrifuge at 12 000 r/min for 10 min at 4 °C. 6.2 Remove serum and place in a 100-mL sterile Schott bottle. 6.3 Add a stir bar and place the Schott bottle on the magnetic stirrer in a cold room at 4 °C. 6.4 Add 1.0 mL cold saturated ammonium sulfate for every 1.5 mL of serum, dropwise, with constant stirring at low speed to minimize protein denatura- tion. 6.5 Stir the mixture overnight at 4 °C. A white precipitate should form. 6.6 Collect the precipitated proteins by centrifuging the mixture at 5000 r/min for 30 min at 4 °C. 6.7 Discard the supernatant and re-suspend the sediment in 0.01 mol PBS until the final volume equals that of the original serum (in step 6.1 above). 6.8 Add an equal amount of cold saturated ammonium sulfate dropwise with constant stirring for 30 min and repeat steps 6.5–6.6 twice. 6.9 Re-suspend the final sediment in PBS (in half the original volume of serum). 6.10 Place this volume in a dialysis bag and dialyse the bag in a 2 L-beaker contai- ning PBS. 6.11 Change the buffer and leave stirring at 4 °C. 6.12 Check the PBS for the presence of sulfate ions. To 2–3 mL of PBS collected in a tube, add 1–2 drops of acidified saturated barium chloride, and watch for the formation of a visible white precipitate, barium sulfate. If sulfate ions are present, replace the PBS and let stir for another 2 h. Replace the 0.01 mol PBS at the end of the day and leave stirring at 4 °C overnight. Laboratory techniques in rabies Fifth edition 120 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 6.13 If sulfate ions are no longer present, replace 0.01 mol PBS, and let stir for a further 2 h. 6.14 Collect the immunoglobulins from the dialysis bag into a graduated cylinder and record the volume. 6.15 Determine the protein content on an aliquot using a protein assay kit or other protein concentration determining method. Calculate the total amount of protein. Continue on with labelling only if the amount of protein exceeds 2 mg/mL. 7. Labelling of the globulins 7.1 Add carbonate/bicarbonate buffer dropwise under constant stirring. The amount of buffer should not exceed 1/10th of the total volume of the collected globulins. 7.2 Monitor the pH of the globulins/carbonate buffer. 7.3 Add FITC (0.01 mg FITC per mg of protein) while stirring. 7.4 Let stir overnight or for a minimum of 8 h at 4 °C. 7.5 Centrifuge conjugate at 12 000 r/min for 10 min. 7.6 Remove untagged FITC from the conjugate [either with the Centriprep Centrifugal Filter Concentrator or Vivaspin tubes]. 7.7 Centrifuge tubes at 2400 r/min for 20 min at 4 °C. 7.8 Repeat the process until all excess dye is removed and the filtrate is clear. 7.9 Centrifuge the final product at 6140 r/min for 1 h at 4 °C. 7.10 Withdraw 0.2 mL of conjugate into a vial and determine the working dilution for DFAT and the RABV tissue culture isolation test (RTCIT; see Chapter 9). 7.11 Aliquot 1 mL of conjugate concentrate into sterile labelled containers and store at −70 to −80 °C, or 0.6 mL into small vials and freeze-dry. Each vial should contain the following information: identity of animal, year serum was collected, bottle number of serum, vial number of conjugate and date the conjugate was bottled. The hyperimmune serum produced as described above can be labelled with FITC for use in lyssavirus diagnosis or biotiny- lated for the DRIT assay (2). As this is a polyclonal hyperimmune serum, it is capable of detecting a large spectrum of lyssaviruses. However, these preparations should be validated against commercial conjugates such as those manufactured by Centocor, Fujirebio or others (7). Laboratory techniques in rabies Fifth edition 121 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals 8. Experimental tips 8.1 Viral isolation and titration Select a highly infected brain tissue sample or further passage the virus in mice to increase virus titres for the initial preparation of 10% brain tissue homogenate. 8.2 Ribonucleoprotein purification Avoid foam and heat formation at any step of the experiments. The foam and heat will decrease the yield and denature the protein of interest. Check the pH of diluted STE buffer, as it should not be below pH 7.8 or exceed pH 8.3. It will also affect the yield and denatures the protein. 8.3 SDS-PAGE and Western blot analysis Always add TEMED last and quickly add to the glass plates as it will polymerize with the tube. Protein concentration can be established using the nanodrop or with any other appropriate protein determining method. 9. Critical parameters and trouble shooting 9.1 Infection and harvesting of BHK cells It is recommended that the monolayer should be at least 80% infected before harvesting to ensure maximum yield of the target protein (RNP). Use clean and sterile cell scrapers to avoid contaminating particles within the end product. Avoid foam formation during homogenization of infected MNA cells and subsequent steps, since the target protein has been released from the cells. Slowly and care- fully homogenize BHK cells as mentioned above. This step will determine if you will obtain a good yield. 10. Precautions Wear protective clothing when handling virus and work in Biosafety Level 2 or 3 facilities, especially when growing up virus and infecting BHK cells. 11. Alternative materials and methods For SDS-PAGE, pre-cast gels as well as buffers are available commercially. There are also nitrocellulose membranes and semi transfer blots commercially available, which shorten the time required to complete the analysis. 12. Time considerations Adequate equipment, supplies, planning, budget and staff are needed for each of the steps in antigen preparation, immunization, antibody production and conju- gation over the time frames suggested above. 13. Limitations Facilities are needed to handle live virus, since lyssaviruses are classified as Biosafety Level 2 or 3 viruses, depending on the recommendations for each labo- ratory performing the procedure. Laboratory techniques in rabies Fifth edition 122 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals References 1. Aubert FA. Methods for the calculation of titres. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:445. 2. Caporale GMM, da Silva ACR, Peixoto ZMP, Chaves LB, Carrieri ML, Vassa RM. First production of fluorescent anti-ribonucleoprotein conjugate for diagnosis of rabies in Brazil. J Clin Lab Analysis. 2009:23:7–13. 3. Dean DL, Abelseth MK, Atanasiu P. The fluorescent antibody test. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:88–95. 4. Harlow E, Lane D. Antibodies, a laboratory manual. New York (NY): Cold Spring Harbour Laboratory Press; 1988. 5. Köhler G, Milstein C. Pillars Article: Continuous cultures of fused cells secreting antibody of predefined specificity. Nature. 1975;256:495–7. 6. Perrin P, Techniques for the preparation of rabies conjugate. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies. Geneva: World Health Organization; 1996:434. 7. Robardet E, Andrieu S, Rasmussen TB, Dobrostana M, Horton DL, Hostnik P, et al. Comparative assay of fluorescent antibody test results among twelve European National Reference Laboratories using various anti-rabies conju- gates. J Virol Methods. 2013:191:88–94. 8. Dietzschold B. Techniques for the purification of rabies virus, its subunits and recombinant products. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Labo- ratory techniques in rabies. Geneva: World Health Organization; 1996:177. Laboratory techniques in rabies Fifth edition 123 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Annex 1. Materials Reagents • sodium chloride, molecular grade • Tris-base, molecular grade • ethylene diamine tetra-acetic acid (EDTA), molecular grade • IGEPAL CA-630 (Sigma 1-3021) • polyethylene glycol PEG 8000 • cesium chloride, optical grade • Premix 30% acrylamide/Bis 29:1 • mol Tris buffer pH 8.8 • 0.5 mol Tris buffer pH 6.8 • nitrocellulose membrane • protein, molecular weight (MW) standards • sodium dodecyl sulfate (SDS), molecular grade • N,N,N’,N’-Tetramethylenediamine (TEMED) • tissue culture grade water or double distilled water • DMEM F-12 • fetal bovine serum (FBS) • penicillin streptomycin and amphotericin • trypsin • ammonium sulfate • FITC-conjugated anti-lyssavirus polyclonal antibody • 1,1,1,2,3,4,4,5,5,5 Decafluoropentane Equipment • centrifuges (Sorvall RC-3 and Beckman ultracentrifuge) • centrifuge rotors (SL-50T and SW 41 T) • Beckman ultracentrifuge tubes, ultra-clear • hard polypropylene tubes 35 mL, round bottom, screw cap (e.g. Oakridge tubes) Note: Propylene tubes do not bind antigen as compared with polystyrene tubes. It is advisable therefore to use hard polypropylene tubes, as they are able to handle high centrifugal forces. • electronic balance • Pasteur pipettes • dialysis tubing, 12–14000 MW cut-off, 10 mm flat-width • magnetic stirrer • cold room or refrigerator set at 4 °C • semi-dry protein transfer apparatus • gel casting trays, gel combs and plates Laboratory techniques in rabies Fifth edition 124 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals • running chamber • mini gel electrophoresis tank and power supply • Petri dishes (large) • shaker (mini) Biologicals • BHK-21 cells (CL1300 [European Cell Culture Collection, Salisbury, UK]) • Lyssavirus species (MOKV, ERA, etc.) • purified ribonucleoprotein (RNP) • laboratory animals – for this SOP, young female goats aged 4–6 months Labelling of the hyperimmune serum • serum, thawed, prior to use • magnetic stirrer with bar • crushed ice in a bucket • saturated ammonium sulfate (see Annex) • 0.01 mol PBS (12 L and 100 mL sterile) • acidified and saturated barium chloride (see Annex 2) • carbonate/bicarbonate buffer (see Annex 2) • 5 mmol EDTA/100 mmol sodium bicarbonate (see Annex 2) • dialysis bags. Spectra pro 1 membranes (6000–8000 MW cut-off), 20.4 x 30.5 cm with closures • FITC reagent • Viva spin • Sorvall RC-5C centrifuge with fixed angle rotor (SS-24) • glassware 2 L beaker, and graduated cylinder Laboratory techniques in rabies Fifth edition 125 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Annex 2. Reagents RNP purification STE buffer pH 7.8 • Sodium chloride (NaCl) • Tris (hydroxymethyl) aminomethane • EDTA • Measure 1000 mL of distilled water • Dissolve the salts in 90% of the total volume of water • Adjust the pH to 7.8 with 10 N HCl Phosphate buffered saline (PBS) pH 7.2–7.4 • Sodium chloride (NaCl) • Sodium phosphate, dibasic (Na2HPO4) • Potassium phosphate, monobasic (KH2PO4) • Distilled water to prepare 20 L • Adjust the pH to 7.2–7.4 by adding either 10 N HCl or NaOH pellets SDS-PAGE Sample loading buffer (4x) • 50 mmol Tris-HCl, pH 6.8 • 2% SDS • 100% glycerol • 1% 14.7 mol ß-mercaptoethanol • 12.5 mmol mol EDTA • 0.02% bromophenol blue • Distilled water Staining solution • Use at 1x for loading samples onto SDS-polyacrylamide gels • 0.25 % Coomassie blue R-250 • 50% methanol • 10% acetic acid • 39.75% distilled water Destaining solution • 20% methanol • 10% acetic acid • 70% distilled water Laboratory techniques in rabies Fifth edition 126 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals Running buffer • 10% SDS • Glycine • Tris base • 1000 mL distilled water Western blot analysis • Running buffer (pH 8.3) • 25 mmol Tris base • 192 mmol glycine • 20% methanol • 1000 mL distilled water Washing buffer (pH 7.4–7.6) • 50 mmol Tris • 200 mmol NaCl • 0.5% Tween Saturated ammonium sulfate • Add sufficient amount of ammonium sulfate to 400 mL of double distilled water to produce a saturated solution (undissolved ammonium sulfate must be visible). • Store at 4 °C. • Before use, dispense the saturated solution into a beaker, being careful not to disturb the undissolved sediment, adjust to pH 7.0 with 4N HCl. Acidified saturated barium chloride • To 50 mL of water add enough barium chloride to prepare a saturated solution. • To 20 mL of saturated barium chloride add 1–2 drops of 4N HCl. • Mix well and store at room temperature until needed. Carbonate-bicarbonate buffer • Add 0.3 g of Na2Co3 to 25 mL of sterile double distilled water. • Add 1.85 g of NaHCO3 to 20 mL of sterile double distilled water. Mix well. • Combine both and add sterile double distilled water to make a final volume of 50 mL. • Verify pH and adjust if necessary with 10N NaOH. • Store at 4 °C. Laboratory techniques in rabies Fifth edition 127 Preparation of fluorescent antibody conjugate Part 6. Production of biologicals mmol EDTA/200 mmol sodium bicarbonate • Add the following to 1000 mL of sterile double distilled water: • EDTA 1.46 g • NaHCO3 16.8 g • Mix well and store at 4 °C until needed. Preparation of dialysis bags • Place 500 mL of the EDTA/sodium bicarbonate solution into a beaker and bring to boil. • Place dialysis bags into the boiling solution and leave for 5 min. • Bring the remaining 500 mL to boil and immerse the dialysis bags in this solu- tion and leave for 5 min. • Remove bags, place in sterile PBS, and store at 4 °C until needed. • Rinse bags well in PBS before use. Laboratory techniques in rabies Fifth edition 128 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Chapter 38 Anti-rabies monoclonal antibody production using mammalian expression systems Introduction The overall applications for monoclonal antibodies (MAbs) have expanded during the past several decades. In the field of rabies, MAbs have been used not only in research but also for diagnostic purposes, and evaluated as a repla- cement for rabies immunoglobulins (RIG). Moreover, MAbs have proven to be very useful tools in research to identify antigenic sites, including for typing of rabies virus (RABV). To aid identification of RABV in tissue in rabid animals or human rabies victims, MAbs have been employed over the past several decades. Finally, a number of groups have identified MAbs that could potentially replace RIG in a post-exposure prophylaxis (PEP) setting for severe exposures to RABV, or so-called category III exposures (1). Today, RIG is obtained from rabies-immu- nized human or equine donors (2,3) and is limited in supply, partially due to the complexity and inconsistency of the manufacturing process. Using standard DNA recombinant technology, MAbs can be expressed in mammalian cell systems from which they can be produced in large quantities and, more importantly, produced consistently. Clearly, the use of MAbs has played a large role in research, since the original concept of hybridoma technology was introduced in 1975 (4). MAbs can be used as valuable tools in basic research to detect or purify a specific antigen in a variety of ways, but also for diagnostic purposes and as treatment and/or prevention of disease. In the context of rabies, all of the above options apply. For example, MAbs have long been of importance with the pioneering work described by Lafon and colleagues (5) to define the antigenic sites on the RABV glycoprotein. Further- more, MAbs directed against RABV antigens, labelled with fluorescein isothiocya- nate (FITC) or biotin, are used as tools for postmortem diagnostic testing, such as the direct fluorescent antibody test (DFAT) (6) or the direct rapid immunohisto- chemistry test (DRIT) (7) respectively, to determine whether a bite victim was truly exposed to RABV from a rabid biting animal. Finally, based on the recommenda- tions of WHO in 2002 (1) the use of anti-RABV MAbs as alternatives for equine RIG (ERIG) and human RIG (HRIG) has been explored and begun in practice (8–10). WHO recommends administration of PEP to all patients with category III expo- sure or to immunodeficient patients with category II exposure to RABV (1). A major component of PEP is passive immunization from RIG. However, given a lack of supply, financial constraints and noncompliance with WHO rabies exposure guidance, many patients die because no PEP or RIG is administered (11,12). To illustrate, in a recent study in the Philippines, several bite victims had inadequate knowledge of proper wound management, and some had resorted to “tandok”, a folk medicine practice where an animal horn is placed over the bite wound to suck out the virus (unpublished data). Access to RIG in the developing world is Laboratory techniques in rabies Fifth edition 129 Anti-rabies monoclonal antibody production Part 6. Production of biologicals particularly poor – a survey in India revealed that only 2.1% patients bitten by a rabid animal received RIG (13). Recombinant MAbs can be obtained through hybridoma technology, or phage display technology. The former depends on antibody responses in animals and subsequent generation of hybridoma cells expressing the antibody of interest, whereas the latter involves cloning of immunoglobulin gene segments to create antibody libraries with large numbers of specificities from which antibodies with desired specificities can be selected (14). The expression and purification of MAbs in mammalian expression systems are suitable for use in research settings or for prevention, treatment and diagnosis of rabies. This chapter describes techniques for expressing MAbs in mammalian cell lines, purifying MAbs via Protein A chromatography, and desalting with both manual and automated methods. Generic steps for production and purification are discussed, in addition to analysis of product quality. Materials Reagents • RABV glycoprotein • FITC-labelled anti-rabies and control reagents • cell culture medium • expression vectors • fetal bovine serum (FBS) • phosphate buffered saline (PBS) • transfection reagent [e.g. Lipofectamine or FuGene]. Equipment • CO2 incubator • ELISA reader • Protein A sepharose column • size exclusion high-performance liquid chromatography (HPLC) column • fluorescence microscope • gel electrophoresis equipment Biological materials • human embryonic kidney (HEK) 293T cells • Chinese hamster ovary (CHO) cells • mouse myeloma cells (NS0, SP2.0) • challenge virus standard strain (CVS)-11 (or other laboratory RABV strain) • non-expressing bacteria cells (e.g. DH1, DH5α™, XL1Blue) Laboratory techniques in rabies Fifth edition 130 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Methods Cells and cell culture Successful MAb production can be achieved in commercially available cell lines such as HEK293T, CHO or mouse myeloma cells (NS0 or SP2.0) depending on the user requirements. If a specific hybridoma is available, these cells can be used as well for antibody production. Preparation of expression vector A variety of standard expression vectors can be used to express MAbs. Because MAb purification is mainly based on natural binding properties of the antibodies, the use of tags is not needed. Typically, the heavy and light chains are cloned into a single vector, each under control of its own promotor. If such plas- mids are not available, separate vectors can be used to express both antibody chains. In either case, standard cloning techniques can be employed to obtain the expression plasmid(s). Preparation of mammalian cell stocks Quickly thaw a vial of cells and transfer them into pre-warmed media: for HEK 293T, CHO, grow cells in 10 mL DMEM [Dulbecco’s minimum essential medium] (with 10% FBS) overnight in a 25 mL flask. For NS0, SP2.0, grow cells in 10 mL MEM at 37 °C with 0.5% CO2 at 37 °C with 10% CO2 overnight in a 25 mL flask. In all cases, after growth, re-suspend cells in PBS and harvest. Transfection and clone selection Plate out adherent cells at 3.5 × 106 cells into a 96 mm dish. Before trans- fection, incubate the plasmid (2 µg of each) with 10 µL transfection reagent in serum-free medium for 30 min. Add plasmid to cells for 5 h before adding DMEM with 10% FBS and incubating overnight. Add growth medium containing appro- priate antibiotic. Wash cells twice a week for 3 weeks to remove dead cells. Pick and transfer clones to a 96-well plate. After several days of further growth under selective pressure, cell culture supernatants can be directly analysed for the presence of antibody using Protein A HPLC or Octet system [ForteBio]. Alterna- tively, antibody concentration can be quantified by ELISA specifically detecting mouse or human MAbs. With each approach, the assay results can be used to select the highest expressing clones to be expanded further using 24- and 6-well plates before transferring to T25 or T80 culture flasks and growing for several days before flash freezing cells (−80 °C). The process is repeated to select the highest expressing clones and to ensure the construct is stably expressing MAbs. At this stage, selective pressure is typically no longer needed. Depending on the requirements, it could also be considered to produce small batches through transient transfection. The principles are the same as those described above but this approach has limitations with respect to the amount of antibody that can be produced in one run. Nowadays, new transient transfection systems or kits are commercially available that can produce at relatively high titres (e.g. 2–3 g/L), such that for a research setting it will yield more than sufficient material to perform a large set of experiments. For application such as diagnostic Laboratory techniques in rabies Fifth edition 131 Anti-rabies monoclonal antibody production Part 6. Production of biologicals purposes, where batch to batch consistency is preferred, a stable clone should be considered as most optimal. Production of MAb using HEK 293T or CHO cells Thaw a vial of frozen cell clone stocks or take cells from ongoing cultures. Inoculate clones to a target concentration of 1 × 106 viable cells/mL into DMEM containing 10% FBS at 37 °C in 10% CO2. Expand the cells to the desired biomass in T flasks and shaker flasks or roller bottles before production is started. The total biomass will be highly dependent on user needs. Prior to the production phase, it is advised that serum containing medium should be washed away and replaced with DMEM, without serum, or lower concentrations of serum be used (e.g. up to 2%). The production phase is ideally performed in shake flasks, where again the selected working volume should be based on required yield. To monitor culture performance, daily samples can be taken to determine cell concentration and viability (using a cell culture analyser). In addition, MAb concentration in culture can be analysed by Protein A HPLC or Octet system (ForteBio). The culture should be harvested if the cell viability drops below 50%. Transfer medium to centrifuge bottles and centrifuge at 5000 x g for 20 min. Filter supernatant through 0.22 µm filter and collect for purification. For larger scale expression, roller bottles or bioreactors can be used instead of shake flasks. Ensure optimal inoculation cell densities are used according to the cell type. Production of antibody using hybridoma cells It is assumed that hydridoma cells are available that express the antibody of interest. It is up to the reader to assess whether the hybridoma is stable enough or if additional subcloning is required. To reach consistently high antibody titres, a relatively pure MAb cell population is recommended. Subcloning of hybridoma cell lines can be achieved by performing serial dilutions to eliminate non-antibody producing cells. Plate 1 to 0.5 cells per well in 96-well plates and culture them until visible colonies appear. Once the colonies appear large enough, they can be tested for antibody production by ELISA. Hybridoma cell lines can be grown in Roswell Park Memorial Institute medium (RPMI) plus 10% FBS during expan- sion, and grown at lower FBS (e.g. 2% but will be clone-dependent) or even in special serum-free hybridoma cell culture medium, such as EX-CELL Hybridoma medium (Sigma Aldrich) during antibody production. Depending on the antibody requirements, these cultures can be grown for 3–5 days to obtain small quantities or in bigger batches by increasing the number of flasks or expanded into larger production vessels. The yield is highly dependent on the hybridoma cell line itself. The choice of production medium with or without use of FBS is dependent on subsequent application of the purified MAb and the level of the purification proce- dure itself. To prevent potential background staining, binding or neutralization, production in the absence of serum is recommended. It must be noted that if a number of purification steps (as described below) are being executed, the serum impurities can be easily removed. MAb purification Depending on the end use of the MAb, different purification strategies can be executed. For research purposes, a straightforward Protein A chromatography will typically provide sufficient purity to perform a number of different experiments. Laboratory techniques in rabies Fifth edition 132 Anti-rabies monoclonal antibody production Part 6. Production of biologicals For diagnostic MAb tools, as well as MAb with the intention to use in humans, additional purification steps are recommended. Protein A chromatography Protein A has a high affinity for human IgG1/IgG2 and mouse IgG2a/IgG2b, moderate affinity for human IgM/IgA/IgE and mouse IgG3/IgG1, but no affinity for other human or murine immunoglobulins. Protein A chromatography can be performed via gravity columns or liquid chromatography systems. Use of the purest water available is recommended for use in all buffers (e.g. HPLC grade). Either prepacked columns can be used, or home-made columns can be gene- rated using Protein A sepharose resin. Before purification of larger batches, it is advised to perform scouting experiments to ensure that optimal conditions are established for purification of antibody. Performing Protein A separation on a gravity column Each Protein A column will have manufacturer-specific protocols to follow. In short, columns must be equilibrated with binding buffer (e.g. PBS pH 7.4) before applying the sample with a syringe or peristaltic pump. Several wash steps to remove all unbound sample and impurities (protein presence should be determined by UV absorbance at 280 nm) can be implemented. This is somewhat dependent on the starting material and its purity. If highly enriched medium is used, and/or cell viability at the time of harvest was low, the column load can contain high levels of impurities. Using additional wash steps, in which a combination of high salt (up to 1 mol NaCl) and lower pH buffers (down to pH 5.5) are incorporated, such impurities can be removed prior to elution of the MAb. Bound MAb is displaced with elution buffer at low pH (range 3–3.6). Depending on the MAb in question, it is important to investigate which elution conditions are best for each antibody. It is known from experience that low pH can induce antibody aggregates at this stage of purification, which could be as high as 20%. Therefore, it may be helpful to achieve a higher recovery to explore slightly higher pH levels which are less harsh for the bound antibody. In addition, fraction collection into a high pH buffer (e.g. Tris buffer pH 8) to ensure a final pH in the more neutral range will also help to reduce aggregate formation. After elution, columns can be cleaned with 0.1 mol NaOH, flushed with PBS, and stored in 20% ethanol at 4–8 °C. Performing a Protein A separation using liquid chromatography systems By using liquid chromatography systems (e.g. FPLC, HPLC), a very similar yet much faster process is applied, but performed in an automated manner thereby obtaining more consistency between MAb batches. Desalting columns MAbs for research purposes can be processed further using desalting columns to exchange buffers and make them suitable for subsequent use. Desal- ting columns are very fast and efficient in doing so, with recoveries typically in the range of 90–100%. Similar to Protein A chromatography, this step can be performed either with bench top gravity columns or using liquid chromatography systems. In the case of gravity desalting columns, the manufacturer’s protocol Laboratory techniques in rabies Fifth edition 133 Anti-rabies monoclonal antibody production Part 6. Production of biologicals can be followed and typically works efficiently. The advantage of using liquid chro- matography systems is that it provides a more consistent approach, but is not an immediate necessity for research MAb batches. Additional purification steps To achieve highly purified MAbs with high-quality standards, a combination of anion and cation exchange chromatography steps should be implemented. This is most likely more applicable to MAbs used for diagnostic purposes or for human use, for which the latter obviously would have to be produced under GMP (good manufacturing practice) conditions (which are beyond the scope of this chapter). However, in a research setting, there may also be reasons to include more puri- fication steps (e.g. if high levels of aggregates have been observed during the Protein A purification step). Antibody aggregates can cause nonspecific binding and false–positive results during experimental evaluation, which can be prevented by additional purification steps to remove the aggregates. Most suitable in that case would be a cation exchange chromatography step, in which the MAb is bound to the column at low salt conditions and eluted with a high salt gradient. The monomer MAb species will elute before the aggregate peak and hence sepa- ration can be achieved. The detailed conditions are highly dependent on the MAb, type of resin, pH and buffer conditions, such that this will have to be explored further by the reader. Generally, a binding buffer at 25–50 mmol NaCl and a pH range of 5–6.5 dependent on the isoelectric point (pI) of the MAb can be used as starting point. Elution up to 1 mol NaCl can be achieved using a linear gradient. If additional impurities are still present, anion exchange chromatography could be explored to further purify the antibody. MAb product testing To assess the quality and purity of antibody, various analytical techniques can be used. The MAb concentration can be determined by a standard UV280 method using a nominal value of 1.5 as the theoretical extinction coefficient. Purity is most often assessed using SDS-PAGE to separate proteins by molecular weight. If the purified MAb has incurred significant insertions or deletions, this should be detected by SDS-PAGE. Non-reducing SDS-PAGE and reducing SDS-PAGE will indicate intact antibody and heavy and light chains, respectively. Precast gels (4–12%) will yield suitable results. Fig. 38.1A shows a composite SDS-PAGE of a purified intact human IgG MAb under reducing and nonreducing conditions, as well as a stressed MAb sample to illustrate the presence of antibody fragments. If the purified MAb shows such fragments, the batch needs to be discarded and a novel MAb production should be initiated. In addition, isoelectric focusing (IEF) can be employed to assess charged isoforms of the MAb and their respective pI. Furthermore, IEF will detect if there have been events that altered the overall charge of the purified MAb, protein degradation or protein deamidation during purification and/or storage. Therefore, this method is also suitable to determine MAb consistency between antibody productions and to detect potential varia- tions. Fig. 38.1B shows an intact MAb sample in comparison with a stressed sample in which the antibody is purposely degraded. Such observations in the purified sample will indicate that the intact MAb has been altered and should be replaced with novel MAb batches. The theoretical molecular weight and pI for the MAb that is being purified can be determined using an online tool such as ExPASy (http://web.expasy.org/compute_pi/) to assess pI of the purified MAb. Laboratory techniques in rabies Fifth edition 134 Anti-rabies monoclonal antibody production Part 6. Production of biologicals Size exclusion HPLC (SE-HPLC) can be used to detect aggregates as well as fragments in the purified MAb product. A small amount (10–20 µg) of antibody can be applied to a SE-HPLC with an appropriate cut-off and equilibrated using a suitable buffer (e.g. 50 mmol sodium phosphate, 250 mmol NaCl [pH 7.0]) at a flow rate of 0.15 mL/min. Absorbance at A280 or A214 can then be used to determine the presence of aggregates and/or fragments. Aggregates (i.e. dimers, trimers, tetramers and oligomers) can form during the purification steps (e.g. protein A elution at low pH), during longer term storage or during multiple freeze–thaw cycles. The monomer intact MAb will be preceded by aggregates and elute prior to potential fragments that may be present in the sample (Fig. 38.2). A monomer concentration of >  95% should be achieved to have a MAb batch that yields reliable results when used in experiments. High aggregate content could result in background staining, or generate other false–positive results. To complement the analytical quality testing, additional assays that test for functionality can be included. For instance, the specific binding of the MAb to its target can be tested using an ELISA method. Depending on the MAb target, purified RABV glycoprotein or nucleoprotein can be coated onto 96-well plates. Coating conditions for the purified antigen would have to be determined, but typi- cally a target of 0.5 µg/mL as coating concentration will be a good starting point. After overnight incubation, each well is blocked with 0.3 mL of a 3% BSA (bovine serum albumin) solution for at least 1 h at room temperature. Then, the wells are washed and each well is incubated with MAb samples (a range of concentration can be used) or control samples for another 1 h. The plate is washed again and incubated with conjugate antibody for 1 h at room temperature, washed once and incubated with TMB substrate for 5–10 min. The reaction is stopped by the addi- tion of 1 mol sulfuric acid and the absorbance is read by an ELISA plate spectro- photometer. Alternatively, inactivated RABV, either prepared in-house or obtained as a rabies vaccine, could be used although typically the signal is less strong compared with purified antigens. If purified RABV glycoprotein is not available, commercially available RABV glycoprotein pre-coated ELISA plates [e.g. Platelia Fig. 38.1. Monoconal antibody (MAb) analysis by SDS-PAGE and IEF A: Purified MAb (10 µg) was loaded onto NuPAGE Novex 4–12% Bis-Tris gel under nonreducing (lane 1) or reducing (lane 2) conditions. Intact IgG and heavy (H) and light (L) chains are visualized with Coomassie Blue staining solution. A MAb sample exposed to low pH (2.7) was loaded under reducing conditions (lane 3) to illustrate occurrence of potential fragments in purified MAb batches. B: Purified MAb (20 µg) was loaded onto a FocusGel 3–10 24S IEF gel to separate the charged isoforms (lane 1). Additionally, a purified MAb sample was pretreated at high pH (9.5) before loading onto isoelectric focusing gel to illustrate the effect of protein degradation or deamidation (lane 2). Note that several bands will be observed, which will be specific for each sample due to multiple protein states with different isoelectric points. B y co ur te sy o f W ilf re d E. M ar is se n, C ru ce ll H ol la nd , T he N et he rla nd s Laboratory techniques in rabies Fifth edition 135 Anti-rabies monoclonal antibody production Part 6. Production of biologicals kit, BioRad] can be used. Demonstration of strong binding indicates correct MAb identity and functionality. Weak or lack of binding would suggest a loss of tertiary structure, mutations in the complementarity determining regions, or instability of the MAb, among others. Specific binding could also be assessed by flow cyto- metry using cell lines expressing RABV glycoprotein on the cell surface (15). Additional functionality can be assessed by analysis of in vitro potency testing such as RFFIT (see Chapter 19) if the MAb is directed against RABV glycoprotein. The capability of a MAb to neutralize RABV will be the ultimate test of its func- tionality and proof of appropriate quality. For each MAb, the 50% neutralizing titre against RABV (e.g. CVS-11 laboratory strain) can be determined and used to calculate an effective (EC50) or inhibitory (IC50) concentration. Most often, the MAbs are benchmarked against the 50% neutralizing titre (2 IU/mL) of a standard reference serum (e.g. standard RIG, lot R3); however, caution should be taken in doing so as neutralizing responses of a polyclonal antibody mixture versus a highly purified MAb may not necessarily be parallel. Lack of parallelism may result in an under- or over interpretation of MAb potency. In such a case, it is better to establish one’s own MAb reference standard that can be used to assess the potency of MAb batches and report MAb potency in EC50 in ng/mL. If required, several purified MAbs can be ranked according to potency. Alternatively, if the appropriate biosafety level laboratory for working with virus is unavailable, in vivo neutralization testing using rabies pseudoviruses can be used, as described previously (10). Interpretation of results The methods presented here allow quick expression of RABV MAbs at small scale but also at larger scale to obtain larger batches of MAb. Purification of anti- bodies can be performed using standard purification techniques as described that can be supplemented with additional purification steps depending on the end-user requirements. The quality of the purified MAb is demonstrated by SDS-PAGE, IEF, SE-HPLC, ELISA, flow cytometry or RFFIT. The MAbs are suitable for both in vivo and in vitro research purposes. If the MAb is used for in vivo testing, analysis of bioburden and endotoxin levels is highly recommended to confirm that the MAb batches are suitable for animal testing. Fig. 38.2. Determination of aggregate levels using SE-HPLC Purified MAb (20 µg) was injected onto a TSKgel SuperSW3000 column equilibrated in 50 mmol sodium phosphate, 250 mmol NaCl (pH 7.0) at a flow rate of 0.15 mL/ min. Absorbance was measured at 214 nm. Elution of aggregates, monomer IgG, and fragments, respectively can be observed. B y co ur te sy o f W ilf re d E. M ar is se n, C ru ce ll H ol la nd , T he N et he rla nd s Laboratory techniques in rabies Fifth edition 136 Anti-rabies monoclonal antibody production Part 6. Production of biologicals References 1. WHO Consultation on a rabies monoclonal antibody cocktail for rabies post expo- sure treatment. WHO, Geneva, 23–24 May 2002. Geneva: 2002 (http://www.who. int/rabies/resources/mabs_final_report_WHO_consultation_2002.pdf?ua=1, accessed 1 October 2018). 2. Rupprecht CE, Hanlon CA, Slate D. Oral vaccination of wildlife against rabies: oppor- tunities and challenges in prevention and control. Dev Biol (Basel). 2004;119:173–84. PMID:15742629. 3. Rupprecht CE, Hanlon CA, Hemachuda T. Rabies re-examined. Lancet Infect Dis. 2002;2:327–43. PMID:12144896. 4. Milstein C. The hybridoma revolution: an offshoot of basic research. BioEssays. 1999;21:966–73. 5. Lafon M, Wiktor TJ, Macfarlan RI. Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J Gen Virol. 1983;64:843–51. doi:10.1099/0022- 1317-64-4-843. 6. Protocol for postmortem diagnosis of rabies in animals by direct fluorescent antibody testing. Atlanta (GA): United States Centers for Disease Control and Prevention; 2006 (https://www.cdc.gov/rabies/pdf/rabiesdfaspv2.pdf, accessed 1 October 2018). 7. Lembo T, Niezgoda M, Velasco-Villa A, Cleaveland S, Ernest E, Rupprecht CE. Evaluation of a direct, rapid immunohistochemical test for rabies diagnosis. Emer- ging Infect Dis. 2006;12:310–3. doi:10.3201/eid/1202.050812. 8. Goudsmit J, Marissen WE, Weldon WC, Niezgoda M, Hanlon CA, Rice AB, et al. Comparison of an anti-rabies human monoclonal antibody combination with human polyclonal anti-rabies immune globulin. J Infect Dis. 2006;193:796–801. doi:10.1086/500470. 9. Müller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Deve- lopment of a mouse monoclonal antibody cocktail for post-exposure rabies prophy- laxis in humans. PLoS Negl Trop Dis. 2009;3:e542. doi:10.1371/journal.pntd.0000542. 10. Sloan SE, Hanlon C, Weldon W, Niezgoda M, Blanton J, Self J, et al. Identifica- tion and characterization of a human monoclonal antibody that potently neutralizes a broad panel of rabies virus isolates. Vaccine. 2007;25:2800–10. doi:10.1016/j. vaccine.2006.12.031. 11. Dodet B. Asian Rabies Expert Bureau. Preventing the incurable: Asian rabies experts advocate rabies control. Vaccine. 2006;24:3045–9. PMID:16652450. 12. Wilde H. Failures of post-exposure rabies prophylaxis. Vaccine. 2007;25:7605–9. 13. Sudarshan MK. Assessing burden of rabies in India: WHO sponsored National Multi- centric Rabies Survey, 2003. Indian J Community Med. 2005;30:100–1. 14. Kramer RA, Marissen WE, Goudsmit J, Visser TJ, Clijsters-Van der Horst M, Bakker AQ, et al. The human antibody repertoire specific for rabies virus glycoprotein as selected from immune libraries. Eur J Immunol. 2005;35:2131–45. doi:10.1002/ eji.200526134. 15. Marissen WE, Kramer RA, Rice A, Weldon WC, Niezgoda M, Faber M, et al. Novel rabies virus–neutralizing epitope recognized by human monoclonal antibody: fine mapping and escape mutant analysis. J Virol. 2005;79:4672–8. doi:10.1128/ JVI.79.8.4672-4678.2005. Laboratory techniques in rabies Fifth edition 137 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Chapter 39 Generation of anti-rabies single domain antibodies by display technologies Introduction Rabies virus (RABV)-specific, cross-neutralizing llama-derived heavy- chain antibody fragments (VHH, or nanobodies) can rapidly be generated from immunized llamas using phage display technology. Phage display is a well- established technique that uses bacteriophage to connect genotype with phenotype by expression and display of proteins that can be selected from large protein-encoding libraries. The technique was first described in 1985 (1). Proteins displayed may be peptides, antibody fragments such as single-chain antibody fragment (scFv), antigen-binding fragments (Fabs) or, as described here, variable heavy-chain fragments (VHH). The VHH are the antigen-binding, variable part of “heavy-chain only” antibodies present in Camelidae family members, such as llamas (2). The VHHs are small (12–15 kDa), biophysically stable molecules with good solubility characteristics and similar affinities to conventional antibodies (3). Llama-derived VHHs have proven to be powerful virus-neutralizers, including for RABV (4–6). Their single-chain nature allows construction and production of multimeric molecules using the same or different VHH building blocks joined by flexible Glycine4Serine (G4S) linkers, thereby targeting either one or two different epitopes on the same molecule (5, 7). By linking two VHH into bivalent (two identical VHH) or biparatopic (two different VHH) constructs, the neutralizing potency can be increased to the picomolar range. In mouse challenge models, the protective effect further improves significantly by increasing the half-life through linkage with a third VHH targeted against serum albumin. Although some interference with the antigenicity of rabies vaccine is observed, combined use of anti-rabies VHH and vaccine can act synergistically to protect mice after RABV exposure (8, 9). These properties make them promising molecules for prophylactic and therapeutic purposes, as well as for diagnostics and research. Ablynx (Sanofi) is developing VHH-based therapeutical proteins (trademarked as Nanobodies®). The principles of phage display and panning are illustrated in Fig. 39.1. Methods Immunizations Inactivated rabies vaccine Mérieux HDCV for use in humans contains the Wistar strain of the Pitman Moore RABV grown on human diploid WI38 lung cells (PM/ WI38 1503 3M). It contains human albumin, but no adjuvant. Intramuscular injec- tion of the vaccine suspension, divided over two spots (0.5 mL/spot, correspon- ding to 2.5 IU), was performed in the neck of llamas on days 0, 7, 28, 35 and 57. Blood was collected in tubes containing ethylenediaminetetraacetic acid (EDTA) Laboratory techniques in rabies Fifth edition 138 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals at time points as indicated in Table 39.1. The neutralizing potency of the immune serum from immunized llamas can be determined with the rapid fluorescent focus inhibition test (RFFIT) as described (10). A serum titre of 0.5 IU/mL indicates a seroconversion. The serum titre of neutrali- zing antibodies in two immune llamas is shown in Table 39.1. They both had a titre in the range of 15–35 IU/mL after repeated immunization with HDCV (Table 39.1). Immune variable heavy-chain fragment library construction for phage display Immune VHH library construction is divided into five parts: (i) isolation of total RNA, (ii) cDNA synthesis, (iii) polymerase chain reaction (PCR) amplifica- tion of VHH (variable domain fragments, derived from llama heavy-chain immu- noglobulins (2)), (iv) ligation into phagemid vectors and (v) expression of VHH containing phage for selections (caution: work on ice as much as possible). Isolation of total RNA Isolate peripheral blood lymphocytes (PBL) from total blood using routine ficoll gradients (PBL1-3 can be combined or used alone depending on the immune response). Total RNA from PBL can also be extracted using the RNeasy Midi Kit [Qiagen] following the manufacturer’s protocol. Lymph nodes may be indistingui- shably enlarged, which makes them difficult to find and therefore unsuitable for use as a source of lymphocytes. Determine the OD260/OD280 ratio as an indication of the quality of the puri- fied RNA (should be around 2). Estimated total RNA amounts from 150 mL blood are ~ 200–1000 µg. Determine the integrity of the sample on a 1% agarose gel in a tank (combs and tray) cleaned with 0.1 % SDS (at least for 1 h and rinse with ddH2O) to avoid degradation. Three bands of RNA should be observed: ~1500 bp, 800 bp and a band below 200 that corresponds to 28S, Fig. 39.1. Principles of phage display and panning Source: reference (12) Laboratory techniques in rabies Fifth edition 139 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 18S and 6S rRNA, respectively. Occasionally, a band of 70–100 bp can be visible representing tRNA. Possible DNA contamination will be above 10 000 bp. cDNA synthesis Use random primers and the SuperScript III First-Strand Synthesis System for RT-PCR according to the manufacturers’ recommenda- tions to amplify VHH encoding gene fragments. [The QIAquick PCR Puri- fication Kit can be used for clean up, but is not a necessary step.] PCR amplification This is divided into two amplifications: the first step amplifies conventional and heavy-chain antibody genes from cDNA, resulting in antibody fragments from FR1 to CH2 of VHH using two framework 1 (FR1) specific primers (051 and 052) and a CH2-specific primer (003). DNA fragments corresponding to 600 bp and sepa- rated from the conventional antibody-derived VH of around 900 bp are extracted from a 1% agarose gel and used as a template in the second nested PCR reac- tion using primers flanked with SfiI and BstEII restriction sites in the 5’ and 3’ end, respectively (primers 050 and 003). These fragments are cloned into a phagemid vector upstream of a c-myc tag and a His6-tag as well as gene3 for display on filamentous bacteriophage, as previously described (11). Electrocompetent Esche- richia coli TG1 are transformed, generating library sizes of around 108 and phage expressing VHH are prepared as described in Annex 2. Table 39.1. Immunizations, blood collection and sero-conversion Day Immunization (vaccine potency IU) Blood collection RFFIT titre* (50% dilution) Llama 1 Llama 2 0 2.5 10 mL pre-immune blood < 0.5 IU/mL (1/9) < 0.5 IU/mL (1/9) 7 2.5 – 27 10 mL immune blood 2 IU/mL (1/66) 6 IU/mL (1/179) 28 2.5 – 35 2.5 – 37 10 mL immune blood 22 IU/mL (1/674) 27 IU/mL (1/789) 42 150 mL immune blood (PBL1) 37 IU/mL (1/989) 33 IU/mL (1/896) 49 150 mL immune blood (PBL2) 23 IU/mL (1/674) 15 IU/mL (1/441) 57 2.5 – 62 150 mL immune blood (PBL3) 22 IU/mL (1/673) 35 IU/mL (1/1071) IU, international unit; RFFIT, rapid fluorescent focus inhibition test, virus-neutralization test Laboratory techniques in rabies Fifth edition 140 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Phage display for selection of RABV-specific llama variable heavy-chain fragments Selections for RABV glycoprotein (G protein)-specific VHH are performed on 8-well strips pre-coated with native G protein from the PV (Pasteur virus) strain (Platelia II Rabies plates). An overnight culture of E. coli TG1 is prepared from a single colony taken from a minimal M9 agar plate. Both the strips and the input phage, prepared using standard protocol (Annex 1), are blocked in superblock (Pierce) or 1% skimmed milk (Marvel) in PBS for 1 h at room temperature. Add 10  µL phage to 90 µL superblock per well and incubate with shaking for 2 h at room temperature. Remove the phage-containing solution in each well with clean filter tips and wash carefully 20 times with PBS + 0.05% Tween 80, followed by five times PBS. Use new tips for every well. Elute with 100 µL trypsin/well (1 mg/mL) for 15 min at room temperature with shaking. Stop the trypsin reac- tion by addition of 5 µL 4 mg/mL ABSF (adult bovine serum). Infect exponentially growing TG1 for 30 min at 37 °C and titrate for determination of output enrich- ment compared with control as described below. Infect 50 µL of eluted phage into 333 µL TG1 (OD600=0.5) + 666 µL 2×TY. Infect for 30 min at 37 °C without shaking. Add 10 mL 2×TY amp100 Glu2 % and grow overnight at 37 °C, 250 r/min. Store grown culture as glycerol stock at −80 °C. Output phage titration Prepare serial dilutions (10-1–10-5) in a 96-well culture plate (10 µL output phage in 90 µL PBS); add 5 µL of phage dilutions to 95 µL of exponentially growing TG1 (OD600=0.5). Infect for 30 min at 37 °C without shaking. Plate 5 µL drops in dupli- cate on LB/amp100/gluc2% plates and incubate at 37 °C overnight. Calculate the number of input phage when colonies have grown. Store remainder of eluted output phages as glycerol stock at −80 °C. For calculation of input phage Prepare serial dilutions of input phages in 96-well culture plate (10 µL output phage in 990 µL PBS); typically, 1E2, 1E4, 1E6, 1E8 and 1E10. Infect as described for output phage. Repeat the selections if needed to enrich for RABV-binding VHH expressed on phage. Use 1 µL of input phage in selection round 2. When enrich- ment is observed compared to the control (PBS or irrelevant coated protein), the overnight cultures of infected TG1 are diluted and plated on LB/amp100/gluc2% plates. Dilute enough to have individual colonies that are transferred to a 96-well plate (v-shaped) with 85 µL of 2×TY amp100/Glu2% and let them grow overnight at 37 °C. This is a master plate and is used for production of VHH and sequencing. The plate is stored at −80 °C in glycerol to be able to trace back the individual clones. Periplasmic expression of variable heavy-chain fragments From the overnight cultures in the 96-well plate, periplasmic extracts contai- ning VHH are prepared by induction of exponentially growing E. coli TG1 with 1 mmol isopropyl-ß-D-1-thiogalactopyranoside (IPTG) and continued cultivation overnight at 37 °C (can be performed in 1–400 mL scale) at 250 r/min for produc- tion of VHH. After centrifugation, the bacterial pellet is freeze-thawed and re-sus- pended in PBS. The His6-tag is used for purifications with Talon Metal affinity Laboratory techniques in rabies Fifth edition 141 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals resin [Clontech] according to the manufacturer’s instructions. The concentration of the purified VHH is determined by OD280 and the purity (1 µg) by SDS-PAGE under reducing (with DTT) and non-reducing conditions. A band of around 15 kDa corresponds to a VHH. Purified VHH can be characterized by enzyme-linked immunosorbent assay (ELISA), competition assays and virus-neutralization assays (RFFIT). VHH encoding genes can be fused into multimeric constructs with flexible G4S-linkers of different lengths to form bivalent or biparatopic molecules targeting one or more different epitopes. Enzyme-linked immunosorbent assay The RABV G pre-coated on 8-well strips (BioRad) can also be used to identify the G-specific VHH by addition of periplasmic extracts containing VHH, followed by incubation for 2 h at room temperature. After washing, add rabbit anti-VHH anti- body (MCA, The Netherlands) (1/5000 dilution) and incubate for 1 h at room tempe- rature. Add horseradish peroxidase-conjugated goat anti-rabbit IgG (1/10  000, Jackson) and incubate for 1 h at room temperature. Add 3,3’,5,5’-Tetramethyl- benzidine (TMB) substrate and read at 620 nm. Competition assays can be set up using ELISA to home in on specific epitopes or to evaluate if the selected VHH bind to the same or different epitopes. Label the first VHH (VHH1) with biotin as described by the manufacturer [Thermo Scientific], and determine the concentration at 50% binding. Incubate this fixed amount of VHH1-biotin with a dilution series of a second VHH (VHH2) and evaluate compe- tition by reduction in signal. Use cold unlabelled VHH1 as positive control for the competition assay. Virus-neutralization assay (rapid fluorescent focus inhibi- tion test) The RFFIT is a virus-neutralization assay using baby hamster kidney (BHK)-21 cells as susceptible targets. It is performed according to the OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals and as described in Chapter 19 of this manual. Serial three-fold dilutions of heat-inactivated serum samples are incubated with the CVS-11 strain of RABV in 8-well tissue culture chamber slides for 90 min at 37 °C. BHK-21 cells are then added to the serum– virus mixture and incubated for an additional 20–24 h at 37 °C and 5 % CO2. Slides are acetone-fixed and stained with an FITC-coupled anti-nucleocapsid conjugate and evaluated using a fluorescence microscope to score the number of virus-in- fected cells (foci) under 200× magnification. The number of positive fields (of 20) with RABV-infected cells per well is recorded. The neutralization end-point titre is defined as the highest sample dilution at which 50% of the observed microscopic fields contain no infected cells. The in vitro neutralizing potency is expressed in International Units (IU)/mL in reference to “The 2nd International Standard for Anti-rabies Immunoglobulin, Human” from the United Kingdom National Institute for Biological Standards and Control (NIBSC, Potters Bar, Herts, UK). Laboratory techniques in rabies Fifth edition 142 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Discussion VHHs have been shown to be excellent virus neutralizers, including of RABV. Part of this success is due to what is termed “targeting precision”. Antibodies should recognize their cognate epitope but not the adjacent amino acids of the epitope. Conventional antibodies often interact with these amino acids because they are large, whereas VHH often do not interact at all with adjacent amino acids. Moreover, due to their small size VHH often can interact with cavities of the para- tope. The monovalent nature of the molecules allows for multimerization to increase both potency and virus cross-neutralization (5, 8). The length of the flexible linker can be varied to optimize intramolecular binding within a trimeric protein such as the RABV G, or between two different trimeric proteins, potentially preventing viral escape. Experimental tips Critical parameters and troubleshooting All steps should be properly quality controlled before proceeding with the next steps. High-quality RNA is important. Always work RNase-free and on ice. TG1 must be kept on minimal M9 agar plates to maintain the sex pilus on TG1 for infection by the phage when grown to exponential phase. As a contamination control, always include TG1 both in culture medium and on plates when spotting. Alternatives Elutions can be performed with pH shock using 100 mmol triethylamine (TEA, pH 12) or 0.2 mol Glycine-HCl, pH 2.2 for 15 min at room temperature with shaking. Transfer eluted phage to a new well or tube and neutralize immediately. Blocking solution can be exchanged with 1% skimmed milk (Marvel), 2% casein or 2% BSA (all dissolved in PBS). Even if biotinylated antigens are used for selections, milk-derived blocking agents can still be used, but superblock is preferred. Precautions • Use gloves when working with RNA. • Clean bench and pipettes with RNase away [Molecular BioProducts]. • Use a separate set of pipettes for library constructions to avoid contaminations. • Use QIAquick PCR Purification Kit and QIAquick Gel Extraction Kit dedicated only for library construction. • Clean gel chambers with 0.2 mol NaOH and rinse well with deionized or sterile water. • Clean gels chambers with 0.2 mol HCl O/N and rinse well with deionized or sterile water before use. • Work on ice. Laboratory techniques in rabies Fifth edition 143 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals • Make sure that there is no excess chromosomal DNA after RNA isolation because it will bind the RNA upon precipitation. • To avoid contamination of phage, use filter tips for every step and clean care- fully the bench with bleach before and after use. Preferably work in dedicated laminar flows. • Never use pipettes for inoculation of TG1, but sterile stripettes to avoid conta- mination. Time considerations Immunizations take at least 6 weeks, RNA extraction and library preparation 1–2 weeks. Selections take 2–4 weeks dependent on complexity and rounds of selection. Limitations Displaying VHH by bacteriophage does not allow for affinity selections since more than one copy of VHH is displayed on each phage, with the exception of monomeric target proteins (should be kept in solution as a biotinylated protein). Laboratory techniques in rabies Fifth edition 144 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals References 1. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 1985;228:1315–7. PMID:400194. 2. Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, et al. Naturally occurring antibodies devoid of light chains. Nature. 1993;363:446–8. doi:10.1038/363446a0. 3. Harmsen MM, de Haard HJ. Properties, production, and applications of camelid single-domain antibody fragments. Appl Microbiol Biotechnol. 2007;77:13–22. doi:10.1007/s00253-007-1142-2. 4. Forsman A, Beirnaert E, Aasa-Chapman MnMI, Hoorelbeke B, Hijazi K, Koh W, et al. Llama antibody fragments with cross-subtype human immunodeficiency virus type 1 (HIV-1)-neutralizing properties and high affinity for HIV-1 gp120. J Virol. 2008;82:12069–81. doi:10.1128/JVI.01379-08. 5. Hultberg A, Temperton NJ, Rosseels V, Koenders M, Gonzalez-Pajuelo M, Schepens B, et al. Llama-derived single domain antibodies to build multivalent, superpotent and broadened neutralizing anti-viral molecules. PLoS One. 2011;6:e17665. doi:10.1371/ journal.pone.0017665. 6. van der Vaart JM, Pant N, Wolvers D, Bezemer S, Hermans PW, Bellamy K, et al. Reduc- tion in morbidity of rotavirus induced diarrhoea in mice by yeast produced mono- valent llama-derived antibody fragments. Vaccine. 2006;24:4130–7. doi:10.1016/j. vaccine.2006.02.045. 7. Roovers RC, Laeremans T, Huang L, De Taeye S, Verkleij AJ, Revets H, et al. Effi- cient inhibition of EGFR signalling and of tumour growth by antagonistic anti-EGFR Nanobodies. Cancer Immunol Immunother. 2007;56:303–17. doi:10.1007/s00262- 006-0180-4. 8. Terryn S, Francart A, Lamoral S, Hultberg A, Rommelaere H, Wittelsberger A, et al. Protective effect of different anti-rabies virus VHH constructs against rabies disease in mice. PLoS One 2014;9:e109367. doi:10.1371/journal.pone.0109367. 9. Terryn S, Francart A, Rommelaere H, Stortelers C, Van Gucht S. Post-exposure treat- ment with anti-rabies VHH and vaccine significantly improves protection of mice from lethal rabies infection. PLoS Negl Trop Dis. 2016;10:e0004902. doi:10.1371/journal. pntd.0004902. 10. Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabies neutra- lizing antibody. Bull World Health Organ. 1973;48:535–41. PMID:4544144. 11. De Haard HJW, Bezemer S, Ledeboer AM, Müller WH, Boender PJ, Moineau S, et al. Llama antibodies against a lactococcal protein located at the tip of the phage tail prevent phage infection. J Bacteriol. 2005;187:4531–41. doi:10.1128/JB.187.13.4531- 4541.2005. 12. Hoogenboom HR, de Bruïne AP, Hufton SE, Hoetab RM, Arends JW, Roovers RC. Antibody phage display technology and its applications. Immunotechnology. 1998;4:1–20. PMID:9661810. 13. Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 1991;19:4133–7. PMID:1908075. Laboratory techniques in rabies Fifth edition 145 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Annex 1. Materials Reagents For total RNA isolation • RNAeasy Midi kit [Qiagen] • 96% ethanol (RNase-free) • 2 M NaAc pH 4 (RNase-free) • RNase-free 1.5 mL microcentrifuge tubes • double autoclaved distilled water • RNase away solution [Molecular BioProducts, catalogue number 7002] cDNA synthesis: SuperScript III First-Strand Synthesis System [Invitrogen] Primers for amplification of VHH • 051 (homology to FR1) 21 bp: GGCTGAGCTGGGTGGTCCTGG • 052 (homology to FR1) 21 bp: GGCTGAGTTTGGTGGTCCTGG • 003 (homology to CH2) 23 bp: GGTACGTGCTGTTGAACTGTTCC • 050 (SfiI containing FR1) 55 bp: CATTTGAGTTGGCCTAGCCGGCCATGGCAGAGGTGCAGCTGGTGGAGTC- TGGGGG PCR reagents • 20 mmol dNTP • 10× buffer (+Mg) and Expand High Fidelity enzyme (3.5 U/µL) [Roche Diagnos- tics GmbH] • TAE buffer and agarose • DNA QIAquick PCR Purification Kit and QIAquick Gel Extraction Kit [Qiagen] Restriction enzymes and ligase • BstEII (10 U/µL) and SfiI (20 U/µL [Biolabs]) • T4 ligase (3 U/µL [Promega]) Antibodies coupled anti-RABV nucleocapsid IgG – FITC conjugate [Bio-Rad Laboratories, France] Platelia II Rabies kit [Bio-Rad Laboratories, catalogue number 355-1180], 8-well strips pre-coated with native RABV G Phagemid vector for fusion of VHH with c-myc-His6 and gene3 at sites BstEII 5’ and SfiI 3’ (11), which is identical to pHEN-1 (13), but contains a hexahistidine tail for immobilized metal affinity chromatography (IMAC). Laboratory techniques in rabies Fifth edition 146 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Equipment • spectrophotometer (UV: preferably 230–310 nm and 600 nm) and cuvettes (if necessary) • table centrifuge • PCR thermocycler • DNA electrophoresis systems cleaned with NaOH and HCl • UV/VIS camera for DNA gel and agar plate imaging • UV camera for slicing out DNA fragments • incubator at 50 °C and 60 °C and 16 °C (without shaking) • incubator at 37 °C with shaker • electroporator • fluorescence microscope [Olympus IX73] Biological materials • rabies vaccine Mérieux HDCV [Sanofi Pasteur MSD] • BHK-21 cells (ATCC CCL-10) • CVS-11, a reference laboratory strain of RABV, genus Lyssavirus, family Rhab- doviridae, ATCC VR959) • Escherichia coli TG1, electrocompetent Escherichia coli TG1 [Stratagene] • M13KO7 Helper phage Laboratory animals Two llamas (Lama glama) [purchased from N.V. Neerhofdieren Bocholt] were located at the animal facilities of the Belgian Scientific Institute of Public Health (WIV-ISP, authorization no. LA1230177). All experimental procedures were approved by the Ethical Committee of the WIV-ISP and the Veterinary and Agro- chemical Research Centre (CODA-CERVA). Laboratory techniques in rabies Fifth edition 147 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals Annex 2. Phage preparation, composition of solutions and preparation of helper phage Phage preparation Precipitate phage with 1/4 volume 20% PEG6000/2.5 mol NaCl, for 10–15 min on ice. Centrifuge 5 min, max speed, remove supernatant. The pellet contains your precipitated phage. Repeat the centrifugation, remove remaining supernatant and leave the tubes head down on a tissue to remove all PEG. Re-suspend the pellet in 1/2 volume PBS. Centrifuge 5 min, max speed, and take the supernatant into a new microcentrifuge tube. If there is still a pellet (cellular debris), repeat the centrifugation step and transfer the supernatant to a new microcentrifuge tube. Composition of media, buffers, solutions 2×TY media (1 L) 1. Dissolve 16 g tryptone, 10 g yeast extract, 5 g NaCl, deionized water to 1 L. 2. Autoclave. 3. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media has cooled down to 55°C. LB (Luria broth) media (1 L) 1. Dissolve 10 g tryptone, 5 g yeast extract, 5 g NaCl, deionized water to 1 L. 2. Autoclave. 3. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media have cooled down to 55 °C. LB agar (1 L) 1. Dissolve 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 950 mL deionized water. 2. Adjust the pH of the medium to 7.0 using 1N NaOH. 3. Autoclave. 4. Add antibiotics (100 µg/mL ampicillin or 50 µg/mL kanamycin) when the media have cooled down to 55 °C. Minimal (M9) agar plates (1 L) 1. Dissolve 15 g Difco Bacto agar in 888 mL H2O and autoclave. Laboratory techniques in rabies Fifth edition 148 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 2. Prepare 100 mL 10×M9 salts (60 g Na2HPO4, 30 g KH2PO4, 10 g NH4Cl, 5 g NaCl, final volume 1 L autoclaved and stored at 4 °C), 1 mL 1 mol MgSO4, 0.1 mL 1 M CaCl2, 1 mL 1% thiamine HCl (filter sterilized), 10 mL 20 % glucose and add to the autoclaved agar solution when the temperature reaches 60 °C. 3. Fill to final volume of 1 L with deionized water when the temperature reaches 60 °C, pour plates. 20 glucose (w/v) (100 mL) 1. 20 g glucose, add to 100 mL with deionized water. 2. Autoclave. 20% glycerol in 2×TY (90 mL) Add 30 mL 60% glycerol (autoclaved; do not autoclave 100% glycerol) to 60 mL sterile 2×TY. 1×TAE (1 L) 20 mL 50×TAE and fill to 1 L with deionized water. TE buffer (100 mL) 1 mL 1 mol Tris-HCl, 0.2 mL 0.5 mol EDTA pH 8.0, 98.8 mL deionized water. Preparation of M13KO helper phage 1. Grow an overnight culture of TG1 in LB media at 37 °C starting from a single colony grown on a minimal M9 plate. 2. Inoculate 1:100 in LB and grow to log phase (OD600: 0.6–0.9). 3. Make top agar (2×TY-agar 0.75 %) and let it cool to 50 °C in a water bath. 4. Streak 1 µL of a helper phage stock (e.g. ~3×1012 pfu/mL) and 1 µL of a 100× diluted stock onto the surface of a pre-warmed 2×TY plate. 5. Add 5 mL of the TG1 culture to 30 mL of top agar (at 50 °C). 6. Immediately pour 3 mL of TY top agar containing the TG1 culture across the plate from the end towards the start of the streak. Allow the top agar to solidify for a few minutes and incubate at 37 °C overnight. Do not forget to inoculate new TG1. 7. Pick four well-separated single plaques (small ones) with a glass pipette and drop into 4×4 mL of 2×TY with a 1:100 dilution of an overnight TG1 culture. 8. Grow for 2 h at 37 °C. 9. Dilute the 4 mL cultures into 100 mL of 2×TY in a 2 L flask, preferably baffled for good aeration. 10. Grow for 1 h at 37 °C. If baffled flasks are available, add 300 mL of 2×TY with kanamycin (final concentration: 25 µg/mL) and grow overnight. If baffled flasks are not available just add kanamycin (final concentration: 25 µg/mL). 11. Spin down the bacteria in 50 mL tubes for 15 min. Laboratory techniques in rabies Fifth edition 149 Generation of anti-rabies single domain antibodies Part 6. Production of biologicals 12. Pour 40 mL of the supernatant in tubes with 10 mL 20 % PEG6 000/2.5 M NaCl and incubate on ice for at least 30 min. Spin down for 15 min and discard the supernatant, leave the tubes head down on tissue paper to remove all PEG. 13. Re-suspend the pellet (for 4×400 mL: 4 times 8 pellets) in 1 mL of filter sterile TE buffer. Centrifuge the bacteria in microcentrifuge tubes to remove remai- ning cell debris for 5 min at 4 °C. 14. Combine all supernatants (approximately 32 mL) and add an equal volume of 100% sterile glycerol. 15. Determine the titre of the phages by making dilutions of 104 to 1014 in PBS and plate 100 µL of these dilutions on 2×TY plates and add top agar with TG1 (see above). Make aliquots and store at –80 °C. Laboratory techniques in rabies Fifth edition 150 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Chapter 40 Production of monospecific polyclonal rabies virus antibodies in birds Introduction An antigen-specific IgY was purified from egg yolk laid by intramuscularly immunized hens independently by Jensenius (1) and Polson (2) during the 1980s. Since then, numerous reports have demonstrated that IgY is the functional equi- valent of mammalian IgG to be used as an immunological tool in diagnosis as well as in passive immunization, administered either systemically or orally to indivi- duals for prevention of infectious diseases. Recent advances in molecular biology, together with a newly invented method of producing antigen-specific IgY, have created opportunities to develop a safe, convenient and inexpensive way of manufacturing various immunodiagnostics (3). These methods have already led to the development of orally administered agents for the prevention of enteric colibacillosis, dental caries and human rotavirus infection (4–6). The method of producing IgY antibodies has certain advantages over their production from mammals, in that: there is no need to bleed animals; it is easy to purify a large amount of antibody; and it is feasible to produce a specific antibody to a small amount of antigen that is poorly immunogenic in mammalian hosts (3, 7, 8). The technique of producing polyclonal antibodies in birds has great potential to advance rabies virus (RABV) diagnosis, research and use of biologicals, with the possibility of in-house production in developing countries (9, 10). Advantages of IgY compared with IgG Comparison of the methods for preparation of IgY and serum IgG and advan- tages in preparation of antibody using hens instead of animals are summarized in Table 40.1. Of note is that preparation of IgY requires only collection of eggs whereas preparation of serum IgG involves drawing blood or euthanasia of animals (Fig. 40.1). Egg yolk contains a considerable amount of IgY (around 100–150 mg/egg), and a laying hen produces an average of 240 eggs per year (11, 12). Therefore, one immunized hen could produce > 30 g of IgY a year, and > 60% of IgY in the egg yolk could be isolated with > 95% purity by a simple purification method. Conver- sely, exsanguination produces an antiserum of only 50 mL per rabbit wherein only 1400 mg of purified IgG could be isolated (6,13). Immunochemical differences between IgY and serum IgG are listed in Table 40.2. Of note is that IgY can be used in diagnosis because it is not asso- ciated with mammalian complement or rheumatoid factors (RF), and its binding Laboratory techniques in rabies Fifth edition 151 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals with human and bacterial Fc-receptors on cell surfaces is less than that of IgG. Also, IgY does not bind to protein A or G, as does IgG. These immunological properties are superior for IgY to avoid false–positive results due to human serum characteristics in diagnosis. Fig. 40.1. Preparation of specific polyclonal antibodies Rabbit immunization Immunity egg way 1. Extraction source of an antibody Blood of rabbit Hen egg yolk 2. A specific antibody preparation (1) Immunity to rabbit (2) Exsanguination (3) Serum separation (4) Purification of the IgG (1) Immunity to chicken (2) Egg collection and yolk separation (3) Water solubility, protein separation (4) Refinement of the IgY 3. Class of the antibody An IgG in addition to a IgA and a IgM are included in the serum Yolk includes only IgY and purification is easy. 4. Animal culture way Mass rearing is difficult It’s possible to raise in quantities (large-scale poultry farming). 5. Immunization Rabbit is fixed and performed An immunization way is systematized for the purpose of chicken disease prevention. 6. Antibody manufacturing scale The laboratory level Industrial scale mass production is possible. Table 40.1. Comparison of a specific antibody preparation Laboratory techniques in rabies Fifth edition 152 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Materials and methods Immunization Rhode Island Red hens were used in this experiment as the donor host of egg yolk. The anti-rabies IgY was purified from the egg yolk of hens immunized a part of the G gene encoding truncated protein (rG-F2), the recombinant nucleoprotein (rN) and the P protein (rP) of RABV, CVS-11 strain (9,10). Preparation of RABV antigens Preparation of rG-F2, rN and rP of RABV was carried out according to a protocol reported elsewhere (14,15). The rG-F2, rN and rP expressed in Escherichia coli DH5α after transformation by plasmid DNAs were purified using a nickel-nitrilotriacetic acid column [Qiagen] and the expected sizes of purified proteins were confirmed by SDS-PAGE (9,10,15). Preparation of water in oil emulsion of antigens Counter-Lock type glass syringes (5 or 10 mL volume) were connected to each other by specially ordered 0.5 cm length jointing stainless tube (0.5 mm inner diameter) and used to prepare a stable water-in-oil emulsion of antigens. For one immunization to a hen, an antigen solution (1 mL) containing about 0.3  mg of recombinant protein was emulsified with 1 mL of Freund’s Complete Adjuvant by passing the mixture in the syringes back and forth through the joint tube. One drop of the emulsion was dropped through a 23-gauge needle attached to the syringe on water to confirm its intactness. For booster shots, an antigen solution (0.5 mL) was emulsified with Freund’s Incomplete Adjuvant (0.5 mL) as described above. The emulsion prepared can be stored for several days in a refrigerator before use. Immunization of hens and collection of samples Two hens were used for each recombinant antigen (rGF-2, rN, and rP). The emul- sion (1–2 mL) was injected by a 23-gauge needle intramuscularly into several sites evenly under the hen’s wings. Booster shots were injected in a manner similar to the first shot twice, with an interval of 2 weeks. Blood samples (about 1 mL) were a. The molecular weight of IgY is about 180 000 and of IgG is about 15 000. The H chain is large, has a constant region and consists of four domains. The IgG has three domains. b. The isoelectric point of IgY is about 6.0, which is almost 1 pH unit lower than IgG. c. The thermal denaturation temperature of IgY is 73.9 °C; the IgG of rabbits is 77 °C. d. Something has radical glucose at the end in a sugar chain of IgY. e. IgY does not activate a complement of the mammals. f. IgY does not combine with proteins A and G (IgG binding protein). g. IgY does not combine with a rheumatic factor (autoantibody to an Fc radical of an IgG). h. IgY does not combine with the Fc receptor of a mammalian cell. Table 40.2. Comparison of yolk (IgY) and serum (IgG) in mammalian antibodies Laboratory techniques in rabies Fifth edition 153 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals drawn from the wing vein on every immunization day, and serum was separated by conventional methods and stored frozen until use for determination of antibody titres by an enzyme-linked immunosorbent assay (ELISA) using the recombinant antigens (rGF-2, rN, and rP) during the solid phase (16). Egg production after immunization The hens’ weight changed little from the first immunization for 18 weeks and maintained at around 2.0 kg. The egg-laying rates of the immunized hens dropped drastically from 80% to 20% during the 2 weeks after the first immunization; however, these rates recovered individually to 70–80 % after the third immuni- zation. The egg-laying rates of immunized hens were almost identical to those of unimmunized hens, starting at around 80% and maintaining at around 60% at 18 weeks after the first immunization. Total egg production per hen averaged 98 eggs in 18 weeks, resulting in 78% of the average egg-laying rate. Eggs were collected daily and stored in a cold room up to one month to sepa- rate egg yolk from egg white by using a yolk separator instrument, followed by breaking the eggs. The egg yolk was then rotated carefully on paper towels to remove excess egg white from the yolk membrane. An aliquot of yolk from an egg laid every 2 weeks after the first immunization was diluted with an equal volume of water containing 0.05% NaN3 as a preservative and stored in the cold room until titrated. The egg yolk samples were pooled in alternate weeks and frozen until IgY separation. The ELISA values of egg yolks obtained from individual hens against antigens (rGF-2, rN, and rP) generally increased after the second immunizations and reached a maximum at 6 weeks after the third immunization. The ELISA values decreased gradually after a maximum during the immunization period (16). Control egg yolk from unimmunized hens did not bind any antigens at all. Pooled egg yolks between 6 to 8 weeks of the individual hens were selected for further IgY purification. Purification of IgY The modified λ-carrageenan method was used, as summarized in Fig. 40.2. Briefly, the stored egg yolk (100 g) was mixed and homogenized with 700 mL of 0.36% NaCl. The homogenate was mixed slowly with 400 mL of 0.4% λ-car- rageenan solution to confirm generation of floating lipoprotein coagulum, while being gently stirred with a spatula. The mixture was then left for 1 h at 20 °C followed by centrifugation at 7000 × g for 30 min. The supernatant was filtered with filter-paper, precipitated with 15% (w/v) sodium sulfate three times, then dialysed against 10 mmol disodium hydrogen phosphate. Purified IgY fractions were stored at −80 °C until use after the dialysates were centrifuged and filtrated through 0.45 µm syringe filters. Egg yolk generally contains IgY of about 1% (w/w). λ-carrageenan precipitate most lipoproteins in egg yolk by the mode of the ionic binding in slightly acidic pH of around 6. Since the IgY is a water-soluble protein in egg yolk, it is recovered Laboratory techniques in rabies Fifth edition 154 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals in the supernatant after precipitating the λ-carrageenan-lipoproteins complex. The IgY recovery is generally 68% with 29% purity in the water-soluble fraction. A salting out procedure using sodium sulfate performed quite well to precipitate IgY. This procedure was repeated several times by monitoring IgY purity using analytical SEC-HPLC. The final dialysate contained quite pure IgY with 61% of recovery and 98% of purity (16). Fig. 40.2. Modified λ-carrageenan method Antibody titres of egg yolks The ELISA values of IgY obtained from individual hens against antigens (rGF-2, rN and rP) are shown in Fig. 40.3. The values generally increased after the second immunizations and reached a maximum at 6 weeks after the third immunization individually. The ELISA values decreased gradually after a maximum during the immunization period. Thus, an appropriate booster shot is needed to maintain high antibody titres. Control egg yolk from unimmunized hens did not bind any antigens. Pooled egg yolks between 6 to 8 weeks of the individual hens were selected for further IgY purification. Laboratory techniques in rabies Fifth edition 155 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Detection of RABV antigens by IgY Immunological staining of RABV antigens has been reported with rabbit IgY developed by the immunization of RABV proteins (rGF-2, rN and RP), as described previously, using brain tissues of mice infected with RABV and rabid dogs, which had been submitted and diagnosed by using fluorescence isothiocyanate (FITC)-conjugated anti-rabies monoclonal antibody at the Research Institute of Tropical Medicine in the Philippines (9, 15, 17–19). The specific binding to the N and P proteins of RABV was also detected by anti-rN IgY and anti-rP IgY, respectively (9, 10). The viral P antigens in the Ammon’s horn of two rabid dogs (No. 64 and No. 86) are shown in Fig. 40.4. Small transverse sections (2–3 mm in thickness) of Ammon’s horn, one a slide, were fixed with cold acetone overnight and incubated with anti-rP Ig Y for 30 min at 37 °C in a high-humidity chamber. After washing, the slides were further incubated with FITC-conjugated anti- chicken IgY rabbit IgG fraction for 30 min. The slides were examined using a fluorescence microscope. Fig. 3 Changes of Antibody Activities in Egg yolk (ELISA) A. Hens immunizedwithrGF-2 Ê o,i C 0,7 li) 0.'6 0 0"5 0,4 � 0.3 (/) ::J 0.2 w 0,1 0 0 2 4 • • week -.-eocrai ..... N'Cl..13 -.-No.14 10 12 14 B. Hens immunizedwithrN o"" Ê 0,7 C 0,6 li) 0"5 0 0,4 � 0.3 (/) 0.2 ::J w 0,1 0-0 .,. .... ...... .. . .............. . --·-···�·-· ....... � .............. : ........ :: ._ ......... ······· 0 2 4 " 10 12 14 week C. Hens immunized with rP 0..0 o"" -+-co,,trd -N'0.17 •••••No.18 Ê C 0.6' li) 0 0"5 � � 0,4 (/) :J 0..3 w 0.2 0,1 0.0 2 " 10 week • Egg yolk was diluted 800-fold for use in ELISA. • lmmunization t 12 14 Fig. 40.3. Changes in antibody activity in egg yolk Laboratory techniques in rabies Fifth edition 156 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals Discussion The anti-rN and rP IgY were shown to bind specifically to the respective proteins of the CVS-11 strain of RABV by western blotting, indirect fluorescent antibody test and immunohistochemistry, indicating that IgY to RABV recombi- nant proteins could serve as a reagent for diagnosis of RABV infection (9, 10). The progression of the signs in RABV-infected mice was also substantially delayed by the inoculation of anti-rG-F2 IgY as PEP at the proximal site of RABV inoculation (10). Therefore, anti-RABV IgY prepared following this method is suitable not only for diagnosis but also for potential therapeutic use instead of antibodies origina- ting from mammals. Trott and colleagues reported that older hens generally had higher IgY titres than younger hens (20). In our experience, older hens also tend to tolerate severe immunization. We used Rhode Island Red hens aged around 300 days for immu- nization. To avoid a reduction in egg production due to the inflammation in the hens, Freund’s Complete Adjuvant with recombinant antigens was applied for primary immunization and Freund’s Incomplete Adjuvant was applied for booster immunizations. Higher antibody activity and purity of the IgY would enable the application of IgY in diagnosis as well as a passive immunization therapy. The most common injection route is the intramuscular route. Chang and collea- gues demonstrated that intramuscular immunization results in higher levels of specific IgY when compared with the subcutaneous route (21). However, intramus- cular injections into the hen’s legs sometime cause limping and improper feed intake and therefore we chose to inject the muscle under the hen’s wing. Although egg-laying rates drastically dropped after the first injection for several weeks, immunized hens recovered well to achieve comparable egg-laying rates (around 80%) to those of the unimmunized hens, which lasted for 4 months. B y co ur te sy o f S at os hi In ou e, N at io na l I ns tit ut e of In fe ct io us D is ea se s, S hi nj uk i, To ky o, J ap an Fig. 40.4. IFA staining of rabies virus P proteins in Ammon’s horn of rabid-dog brain Laboratory techniques in rabies Fifth edition 157 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals IgY is one of the water-soluble proteins in egg yolk. Therefore, separation of the water-soluble IgY from abundant yolk lipoproteins is the first step of IgY purifica- tion. Many purification methods for IgY have been developed that involve preci- pitation of lipoproteins with polyethylene glycol or poly-anions, such as dextran sulfate, sodium alginate, xanthan gum, λ-carrageenan and pectin (1, 2, 20, 22–24). These lipoprotein-coagulating agents work effectively to retain the water-so- luble proteins in the supernatant after centrifugation. Thereafter, IgY is generally isolated in pure form by salting out using either ammonium sulfate or sodium sulfate. The λ-carrageenan method was further modified to improve IgY recovery (61%) and its purity (98%). Tan and colleagues developed a cost–effective and efficient IgY purification method to obtain IgY with high recovery and purity by employing the existing commercial IgY isolation kits (25). They obtained chicken IgY of high yields (60 mg) and high purity (about 80%) using pectin and λ-carrageenan in the presence of calcium chloride to precipitate egg yolk lipoproteins while retaining IgY in solu- tion followed by salting out IgY with higher purity. The modified λ-carrageenan method shown in this protocol might be superior to any other reported methods for obtaining the highest purity of IgY of > 90% in protein basis, and suitability for large-scale purification of chicken IgY. The method of producing antigen-specific antibodies in egg yolk (IgY) can provide new opportunities to develop a safe, convenient and inexpensive way of manufacturing various immunodiagnostics. Laboratory techniques in rabies Fifth edition 158 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals References 1. Jensenius JC, Anderson I, Hau J, Crone M, Koch C. Eggs: conveniently packaged antibodies. Method for purification of yolk IgG. J Immunol Methods. 1981;46:63–8. 2. Polson A, von Wechmar MB, van Regenmortel MH. Isolation of viral IgY anti- bodies from yolks of immunized hens. Immunol Commun. 1980;9:475–93. 3. Hatta H, Akachi S, Kim M. [Production of egg yolk antibody (IgY) and its use]. Nippon Nogeikagaku Kaishi 1994;68:1457–62 (in Japanese). 4. Yokoyama H, Peralta RC, Diaz R, Sendo S, Ikemori Y, Kodama Y. Passive protective effect of chicken egg yolk immunoglobulins against experimental enterotoxigenic Escherichia coli infection in neonatal piglets. Infect Immun. 1992;3:998–1007. 5. Hamada S, Horikoshi T, Minami T, Kawabata S, Hiraoka J, Fujiwara T, et al. Oral passive immunization against dental caries in rats by use of hen egg yolk antibodies specific for cell-associated glucosyltransferase of Streptococcus mutans. Infect Immun. 1991;11:4146–67. 6. Hatta H, Tsuda K, Akachi S, Kim M, Yamamoto T. Productivity and some properties of egg yolk antibody (IgY) against human rotavirus compared with rabbit IgG. Biosci Biotechnol Biochem. 1990;54:2531–5. 7. Carrol SB, Stollar BD. Antibodies to calf thymus RNA polymerase II from egg yolks of Immunized hens. J Biol Chem. 1983;258:24–6. 8. Lee K, Ametani A, Shimizu M, Hatta H, Yamamoto T, Kaminogawa S. Produc- tion and characterization of anti-human insulin antibodies in the hen’s egg. Agri Biol Chem. 1991;55:2141–3. 9. Motoi Y, Inoue S, Hatta H, Sato K, Morimoto K, Yamada A. Detection of rabies-specific antigens by egg yolk antibody (IgY) to the recombinant rabies virus proteins produced in Escherichia coli. Jpn J Infect Dis. 2005;58:115–8. 10. Motoi Y, Sato K, Hatta H, Morimoto K, Inoue S, Yamada A. Production of rabies neutralizing antibody in hen’s eggs using a part of the G protein expressed in Escherichia coli. Vaccine 2005;23:3026–32. 11. Rose ME, Orlans E, Buttress N. Immunoglobulin classes in the hen’s eggs: their segregation in yolk and white. Eur J Immunol. 1974;4:521–3. 12. Sim JS, Sunwoo HH, Lee EN. Ovoglobulin IgY. In: AS Naidu, editor. Natural food antimicrobial systems. New York: CRC Press; 2000:227–52. 13. Hatta H, Kim M, Yamamoto T. A novel isolation method for hen egg yolk anti- body “IgY”. Agri Biol Chem. 1990;54:2531–5. 14. Inoue S, Motoi Y, Kashimura T, Ono K, Yamada A. Safe and easy monitoring of anti-rabies antibody in dogs using His-tagged recombinant N-Protein. Jpn J Infect Dis. 2003;56:158–60. Laboratory techniques in rabies Fifth edition 159 Production of monospecific polyclonal rabies virus antibodies in birds Part 6. Production of biologicals 15. Inoue S, Sato Y, Hasegawa H, Noguchi A, Yamada A, Kurata T, et al. Cross-reactive antigenicity of nucleoproteins of lyssaviruses recognized by a monospecific antirabies virus nucleoprotein antiserum on paraffin sections of formalin-fixed tissues. Pathol International. 2003;53:525–33. 16. Inoue S, Park C-H, Hatta H. Production of polyclonal rabies virus antibodies in birds. In: Rupprecht C, Nagarajan T, editors. Current laboratory techniques in rabies diagnosis, research and prevention (Volume 2). Elsevier; 2015:305– 16. 17. Kojima D, Park CH, Satoh Y, Inoue S, Noguchi A, Oyamada T. Pathology of the spinal cord of C57BL/6J mice infected with rabies virus (CVS-11 strain). J Vet Med Sci 2009;71:319–24. 18. Boonsriroj H, Manalo DL, Kimitsuki K, Shimatsu T, Shiwa N, Shinozaki H, et al. A pathological study of the salivary glands of rabid dogs in the Philippines. J Vet Med Sci. 2016;78:35–42. 19. Shimatsu T, Shinozaki H, Kimitsuki K, Shiwa N, Manalo DL, Perez RC, et al. Localization of the rabies virus antigen in Merkel cells in the follicle-sinus complexes of muzzle skins of rabid dogs. J Virol Methods 2016;237:40-6. 20. Trott DL, Yang M, Utterback PL, Utterback CW, Koelkeback KW, Cook ME. Utility of spent single comb white leghorn hens for production of polyclonal egg yolk antibody. J Appl Poult Res. 2009b;18:679–89. 21. Chang HM, Ou-Yang RF, Chen YT, Chen CC. Productivity and some proper- ties of immunoglobulin specific against Streptococcus mutans serotype c in chicken egg yolk (IgY). J Agric Food Chem. 1999;47:61–6. 22. Hatta H, Sim JS, Nakai S. Separation of phospholipids from egg yolk and recovery of water-soluble proteins. J Food Sci. 1988;53:425–7. 23. Akita EM, Nakai S. Comparison of four purification methods for the produc- tion of immunoglobulins from eggs laid by hens immunized with an entero- toxigenic E. coli strain. J Immunol Methods. 1993;160:207–14. 24. Chang HM, Lu TC, Chen CC, Tu YY, Hwang JY. Isolation of immunoglobulin from egg yolk by anionic polysaccharides. J Agric Food Chem. 2000;48:995–9. 25. Tan SH, Mohamedali A, Kapur A, Lukjanenko L, Baker MS. A novel, cost-ef- fective and efficient chicken egg IgY purification procedure. J Immunol Methods. 2012;380(1–2):73–6. Laboratory techniques in rabies Fifth edition 160 Plant production of monoclonal antibodies Part 6. Production of biologicals Chapter 41 Plant production of monoclonal antibodies for rabies Introduction Virus neutralizing antibodies (VNA) are a key component of immunity against viral infections, and act by preventing or modulating viral disease progression. Polyclonal antisera are still widely used for the prevention and/or post-exposure prophylaxis (PEP) of many infections and are important products because they can provide immediate protection even in immunocompromised individuals. They can also be reasonably cheap to manufacture, allowing greater accessibility in low and middle-income countries (LMICs). In rabies, passive immunization with rabies immunoglobulin (RIG) is well established for PEP. RIG is a WHO essential medicine and the preventive method of choice in most countries where rabies is endemic (1). Polyclonal antisera have drawbacks however, being derived either from human donors or large animals with consequent risks related to the use of blood products. They are often costly and/or in scarce supply and are, by their nature, mixtures of active compounds that exhibit significant batch-to-batch variability. In addition, the active pharmaceutical ingredient, i.e. the neutralizing antibodies, is poorly defined. For these reasons, monoclonal antibodies (MAbs) have been explored as alternatives to RIG by many groups (1–4). Clinical MAbs are manufactured by mammalian cell fermentation (5). This is an established industry with a number of successful blockbuster antibody drugs. However, a monoclonal antibody RIG replacement product would impose specific constraints, which are not addressed by the commercial MAb sector. Firstly, to ensure adequate viral coverage and prevent viral escape a combination of at least two MAbs would likely be required (6). At present there are no commercial MAb products comprising more than one antibody. Secondly, antibody production would be needed at an abundant scale. Every year, more than 15 million people worldwide receive a post-bite vaccination and require PEP (WHO factsheet 2017), suggesting that production of hundreds of kilograms annually of rabies MAbs would be required. Thirdly, rabies is predominantly a disease of LMICs, so to ensure accessibility and availability of any RIG replacement product, the invest- ment cost for manufacturing and cost of goods needs to be low. Specifically, the disincentive of upfront costs for product and clinical development for a product primarily for LMICs has been an important reason why there has been virtually no interest from the pharmaceutical industry to address this unmet medical need. Molecular pharming – the use of plant biotechnology to manufacture phar- maceuticals – offers some potential solutions, particularly in relation to cost, scalability and technology transfer to under-developed regions (7, 8). The appli- cation of molecular pharming to rabies MAb production has been explored by different groups (9–11) and the antibodies produced in plants have demonstrated Laboratory techniques in rabies Fifth edition 161 Plant production of monoclonal antibodies Part 6. Production of biologicals viral neutralization equivalent to their counterparts produced in mammalian cells. For example, two MAbs identified by WHO rabies collaborating centres as poten- tial clinical candidates (6) have been successfully produced in plants (3, 12), one of which (E559) was also demonstrated to protect against rabies virus (RABV) in a hamster challenge model (12). There are two mainstream approaches to producing MAbs in plants. The pionee- ring work on expression of antibodies in plants was developed in transgenic Nicotiana tabacum (13). The rabies MAbs from plants that have been described in the literature to date have also been produced by generating stable transgenic N. tabacum plants (Fig. 41.1A), in which the heavy and light chain MAb genes were incorporated into the plant nuclear genome, transgenic plant lines were regene- rated and the plant lines underwent standard plant breeding to achieve homo- zygosity and genetic and phenotypic stability (14). This transgenic approach is relatively slow but has the advantage of resulting in transgenic seed that are easy to store, distribute and grow at massive scale at low cost. The second approach is to express recombinant MAbs transiently in plants. Although this rapid gene expression system was also initially developed in N. tabacum (15, 16), N. benthamiana (Fig. 41.1B) became more widely used because it allows the use of inhibitors of post-transcriptional gene silencing, such as p19 from tomato bushy stunt virus (17). In transient expression systems, vectors based on plant viral elements or the Ti plasmid of Agrobacterium tumefaciens (18) containing the MAb genes are introduced into plants by a process called agro-in- filtration  (19, 20). This results in transfection of all the cells in the agro-infiltrated plant tissue and short-term, or transient, expression of the MAb genes, within a few days. The ZMapp antibodies used in the 2014 West Africa Ebola outbreak were manufactured using this approach (21). The key advantages of transient expression lie in the simplicity of the technique, the speed of expression and the high antibody yield achievable at laboratory scale. This transient expression tech- nique for antibodies in plants could be extremely valuable to researchers in the rabies field, even at laboratory scale where only a few milligrams of antibodies are required for use as a reagent. This chapter describes the detailed methodology and how to get started. Fig. 41.1. Nicotiana tabacum cv. Petit Havana SR1 (A) and Nicotiana benthamiana (B) The plants were grown in the greenhouse and are shown at about 6–8 weeks old. Whereas N. benthamiana potentially reaches 0.5 m in height at maturity, N. tabacum may grow to 2 m at maturity in the greenhouse, and more in the field. B y co ur te sy o f J ul ia n K .C . M a, S t G eo rg e’ s H os pi ta l M ed ic al S ch oo l, Lo nd on , U K . Laboratory techniques in rabies Fifth edition 162 Plant production of monoclonal antibodies Part 6. Production of biologicals Key features of the stable transgenic (GM plant) and the transient gene expres- sion via agro-infiltration approaches are summarized in Table 41.1. Of note, the initial cloning work is virtually the same for both approaches and some vectors (e.g. pTRA) are well suited for both tasks. Rabies reagents produced in plant expression systems Several rabies antibodies and antigens have been expressed in plants using both stable transgenic approaches as well as transient gene expression via agro-infiltration. While the production of rabies antibodies has generally been very successful (Table 41.2), rabies antigens so far have been more challenging (Table 41.3). Specifically, high-level expression of the full-length ectodomain of the enve- lope glycoprotein has not been achieved. However, several small fragments such as the RVG peptide that binds to nAChR have been produced successfully. Expression vectors for Agrobacterium-mediated transformation For plant molecular pharming applications, the systems mostly used nowa- days are based on (i) a binary vector derived from A. tumefaciens (Rhizobium radio- bacter, A. radiobacter) and (ii) various genetic elements from plant viruses. Genetic elements from plant viruses are widely used because many plant viruses accu- mulate to very high levels in plant cells. To achieve this, plant viruses evolved different mechanisms, including highly efficient 5’ and 3’ untranslated regions (UTR) as translational enhancers, inhibitors of post-transcriptional gene silencing and amplification of genomic and subgenomic RNAs. Learning from nature, these genetic elements have successfully been harnessed in various ways to create the powerful plant expression strategies that are now available. Feature GM plant Agro-infiltration Level of integration High Mid Setup time 6 months to generation of first transformants 4–6 weeks from seed to plant ready for infiltration Scalability Agricultural Good to several kg biomass, then requires sophisti- cated facility Flexibility Limited High, particularly useful for product development Skills required Plant tissue culture Basic microbiology Protein accumulation Generally lower Generally higher Stress level Lower Higher, both biotic and abiotic stress factors Containment As for all GM plants. Deregulation may be approved. Plants can be grown anywhere; agrobacteria and infiltrated plants require containment; Robustness Very robust More input parameters, more variable Table 41.1. Comparison of key features of stable transgenic (GM plant) and transient gene expression (agro-infiltration) Laboratory techniques in rabies Fifth edition 163 Plant production of monoclonal antibodies Part 6. Production of biologicals A. tumefaciens is a natural genetic engineer with a type IV secretion system specialised to deliver genetic information to plant cells to cause crown gall disease (27). A particularly important feature of this system is that it has evolved to transfer single-strand DNA efficiently across the plant cell wall and the plasma membrane to shuttle it into the plant nucleus (28, 29). Fortunately, the only cis elements required are the left and right border 25 base pair (bp) repeat sequences, and all other necessary virulence genes can be provided in trans. This led to the develop- ment of T-DNA binary systems, where the natural tumour inducing Ti plasmid was disarmed by eliminating the transfer DNA region carrying the plant oncogenes and an artificial T-DNA was introduced into a shuttle vector that can replicate in both E. coli and A. tumefaciens. Such a pair of plasmids is called a T-DNA binary system. The disarmed Ti-plasmid is also referred to as helper plasmid and the shuttle vector as T-DNA plasmid. There are many different variants of the latter, inclu- Antibody Expression strategy / Host plant Reference ID Type SO57 Human IgG1 Transgenic N. tabacum cv. Xanthi Ko et al., 2003 (10) Suspension cells of transgenic N. tabacum cv. Xanthi Girard et al., 2006 (9) 62-71-3 Mouse–human chimeric IgG1 Transient N. benthamiana Both et al., 2013 (3) scFv-RVG fusion Transient N. benthamiana Phoolcharoen et al., 2017 (22) E559 Mouse–human chimeric IgG1 Transgenic N. tabacum cv. Petit Havana SR1 van Dolleweerd et al., 2014 (12) 8C5 Human IgG1 Transient N. benthamiana Unpublished 10H5 4H3 7A2 Table 41.2. Rabies virus antibodies produced in plants Protein Type Host Plant / Expression strategy Reference N Full-length Transgenic tomato, transient N.  benthamiana Perea Arango et al., 2008 (23) G, N G-N chimeric peptide fused to AIMV coat protein Tobacco and spinach / recombinant plant virus Yusibov et al., 2002 (24) G Full length Transgenic tomato Mc Garvey et al., 1995 (25) Full length chimeric Transgenic N. tabacum Ashraf, 2005 (26) Full-length G fused to B sub-unit of cholera toxin Transgenic N. tabacum Roy, 2010 Full-length Transgenic N. tabacum Yadav, 2012 Full length G fused to B sub-unit of ricin toxin Hairy root cell culture derived from transgenic tomato Singh, 2015 VLP, co-expression with M Transient N. benthamiana D’Aoust, Medicago, patent application Table 41.3. Rabies virus proteins produced in plants Laboratory techniques in rabies Fifth edition 164 Plant production of monoclonal antibodies Part 6. Production of biologicals ding pTRA (30), pEAQ (20), magnICON (31), pRIC, pORE, pGREEN, pCAMBIA and pBIN. Importantly, not every helper plasmid can be combined with every T-DNA plasmid and it is vital to ensure compatibility for the origin-of-replication and anti- biotic resistance genes. In the pTRA vector, gene expression is controlled by a duplicated CaMV-35S promoter, the 5’UTR from tobacco etch virus, a CaMV-35S 3’UTR and transcrip- tional terminator and scaffold attachment regions of the tobacco RB7 gene. An essential element is the inclusion of a leader sequence to target transgene expres- sion products to the plant secretory pathway. Leader sequences can be derived from either mammalian or plant sequences (34). Genes of interest are inserted using convenient restriction sites. For therapeutic antibodies, the accuracy of signal peptide cleavage is critical, whereas for research and diagnostic purposes, heterogeneity at the N-terminal end is not an issue. Details for the pTRA vectors currently used for producing human antibodies at high levels (32) are shown in Table 41.4 and Fig. 41.2. Group Element Description Backbone ColE1 ori High copy origin of replication for Escherichia coli RK2 ori Low copy origin of replication for Agrobacterium tumefaciens bla β-lactamase, resistance to ampicillin/carbenicillin T-DNA LB Left border, start of transfer-DNA (clockwise) RB Right border, end of transfer-DNA DsRed scorable marker gene expression cassette Pnos Nopaline synthase promotor CHS 5’UTR of the chalcone synthase gene from parsley DsRed-H6KDEL Red-fluorescent protein from Discosoma spp. with a His6 tag for IMAC purification and a KDEL tag for ER-retrieval pAnos 3’UTR and termination of transcription from the nopaline synthase gene Recombinant Antibody gene expression cassette 2x P35S Duplicated promotor from the 35S RNA of Cauliflower Mosaic Virus TL 5’UTR from tobacco etch virus SP Signal peptide HC Mature antibody heavy chain pA35S 3’UTR and termination of transcription from the 35S RNA of Cauliflower Mosaic Virus SAR SAR Scaffold attachment regions from the rb7 Table 41.4. Genetic elements used in pTRA plasmids Laboratory techniques in rabies Fifth edition 165 Plant production of monoclonal antibodies Part 6. Production of biologicals Fig. 41.2. Plasmid map for pTRA-Ds-g1 used for expression of human IgG1 antibodies The same plasmid is also used to express the human light chain by replacing the PstI–XbaI fragment. The elements comprising the expression cassette for the antibody are depicted in grades of green colours. The cassette for the DsRed marker gene is shown in grades of red. The region (clockwise) between the left border (LB) and the right border (RB) comprises the T-DNA that is transferred to the plant cell. Details of the various elements are given in Table 41.4. Setting up a plant expression system yourself The practical aspects of getting started with a plant-based transient expres- sion system for MAbs assumes that a standard molecular biology laboratory is available for conducting the basic recombinant DNA and protein analysis work. Consideration is given to a minimal setup scenario and estimate of the costs required to become operational. N. benthamiana seeds typically cost a few dollars only but shipping costs may apply and not every vendor will ship seeds to another country. It is often easiest therefore to identify a national collaborator who already has N. benthamiana seeds and can spare a few. As seed amplification has a lead-time of about 80 days, it is advisable to use the first seeds to grow plants for making more seeds. A single plant can produce seeds sufficient for a year or longer, and seeds are viable for many years if stored properly in dry, dark and temperate conditions. The next steps are to obtain the Agrobacteria with the helper plasmid and the corresponding T-DNA plasmid. The Leibniz Institute DSMZ – German Collection of Microorganisms and Cell Cultures – charges US$ 120–180 all-inclusive for freeze- dried R. radiobacter GV3101 (A. tumefaciens) carrying the helper plasmid pMP90RK. Laboratory techniques in rabies Fifth edition 166 Plant production of monoclonal antibodies Part 6. Production of biologicals Handling fees for the T-DNA plasmids can range from €50 to €500 largely depen- ding on the legal entities and collaborators often can receive the material free of charge from universities. Plants can be grown on a metal rack that can be obtained for less than US$ 100 from a do-it-yourself store and standard fluorescent lamps. This means that a growth rack with three levels can be setup for less than US$ 500. Plastic plant pots and good-quality compost can be purchased from a local garden centre. The cost for an entire basic setup would be less than US$ 800. Many other items that may be helpful are also inexpensive as many are sold as household goods. The running costs are also very favourable and include standard laboratory plasticware such as tips, gloves, Petri dishes, paper towels, plastic foil, cellophane, transparent tape, 1 mL syringes, and Eppendorf and Falcon tubes. The infiltration medium costs less than US$ 2 per litre at small scale, and is cheaper than the media used for growing E. coli and agrobacteria. The main cost drivers are the reagents and materials needed for analysis of expression, purification of the target protein and its characterization. This is highly specific to the target protein and therefore we do not consider this here any further. It is helpful – albeit optional – to co-express the MAb genes with a reporter gene that can easily be detected at low cost. We favour the red-fluorescent protein from Discosoma spp. for several reasons, including its high level of expression in diffe- rent cellular compartments and plant species, high stability and ease of non-inva- sive macroscopic and microscopic detection. Antibody purification by protein A affinity chromatography is a standard proce- dure that is used once the plant extract has been clarified and filtered. The overall setup and running costs for a minimal setup scenario that has a capacity for produ- cing > 20 antibodies at the 2–5 mg scale per year is summarized in Table 41.5. The apparatus for SDS-PAGE if not already available is the highest cost factor. Category Approximate cost (US$) Set-up Running Agro-infiltration 800 500 DsRed detection 100 – SDS-PAGE 1200 150 Protein-A matrix – 250 General consumables – 200 Total 2100 1000 Table 41.5. Summary of set-up and running costs for making more than 20 x 2 mg antibodies per year with the agro- infiltration technique Laboratory techniques in rabies Fifth edition 167 Plant production of monoclonal antibodies Part 6. Production of biologicals Methods Protocols for cloning antibody genes are extensively described in the litera- ture (33). The cloning of full length light and heavy chain genes is not difficult (12). Nowadays, if the gene sequences have been determined, we routinely purchase synthetic heavy chain variable regions (VH) and VL chain genes, link them to the heavy and light chain constant regions of choice, and clone the complete heavy and light chain genes into binary T-DNA vectors. Using synthetic genes is advan- tageous because it allows codon optimization, which may improve expression levels in some cases. Codon optimization is still somewhat of a dark art, and DNA synthesis companies are not usually transparent in their algorithm design (34). The Invitrogen GeneArt Gene Synthesis plant codon optimization service has been used with success by many plant groups. The recombinant plasmid is amplified in E. coli, isolated and used to trans- form A. tumefaciens. Commonly used laboratory strains of A. tumefaciens include LBA4404 [available from Clontech and ThermoFisher], EHA105 [available from LifeScience Market], GV3101 and GV3101:pMP90RK [(available from Leib- nitz Institute DSMZ – German Collection of Microorganisms and Cell Cultures, DSM-12364 and DSM-12365]. Recombinant agrobacteria carrying the expres- sion constructs are selected on agar plates containing appropriate antibiotics – for pTRA, this is carbenicillin. The host range of A. tumefaciens depends both on the Ti plasmid and the genetic background of the isolate. A description of the chromosomal backgrounds and Ti plasmid derivations for the strains LBA4404 and GV3101 can be found in  (35). These commonly used strains have a broad host range, meaning that many important crops such as beans, lettuce, pumpkin, carrot, rapeseed and members of the Solanaceae family, as e.g. tomato, potato and tobacco, can be used. Here we focus on two related species from the genus Nicotiana, i.e. N. tabacum and N.  benthamiana, which are the workhorses of Plant Molecular Pharming due to their ease of cultivation, rapid growth, prolific seed production, efficient transfor- mation and high accumulation of foreign proteins. Antibodies are expressed transiently in N. benthamiana by introducing the recombinant agrobacterium into leaf tissue by a process called agro-infiltration. At laboratory scale, this method is very simple and requires only basic skills and standard laboratory equipment (36). The only additional requirement to a standard molecular biology or protein biochemistry laboratory is a space to grow a few plants. As expression levels are usually high, 10 plants would likely be sufficient and, in good cases, even a single plant leaf can provide a milligram of reagent. The plants are not genetically modified, and the only laboratory safety requirements relate to the use of recombinant bacteria (E. coli and A. tumefaciens). Even when the plants have been agro-infiltrated and are expressing recombinant protein, they are not regarded as genetically modified. However, as recombinant A. tumefaciens is still present, normal containment regulations for genetically modified bacteria apply. The plants and compost are usually disposed of by the same process as for any biological waste. Laboratory techniques in rabies Fifth edition 168 Plant production of monoclonal antibodies Part 6. Production of biologicals The antibody expression steps (Fig. 41.3) are: 1. Grow N. benthamiana plants. 2. Produce a liquid culture of recombinant agrobacteria. 3. Agro-infiltrate by syringe or vacuum infiltration. 4. Allow transient expression to occur and protein to accumulate. 5. Extract and purify protein. An indicative timeline for antibody expression is shown also in Fig. 41.3. 2–4 3–101–2 Fig. 41.3. Antibody expression by the agro-infiltration method, with indicative timelines 1. Grow N. benthamiana plants N. benthamiana seeds can be obtained from commercial sources or through academic collaboration. Note that there are different ecotypes that differ in their susceptibility to plant viruses and in their performance in agro-infiltration (37), which depends on a natural loss-of-function in the RNA-dependent-RNA-polyme- rase 1 gene (38). Once obtained, seeds can be amplified easily and set aside in storage by keeping a few plants for flowering, self-pollination and seed-setting. Nicotiana seeds are grown in standard commercial compost for about 6 weeks. It is beneficial to have two growth phases. Germination and seedling growth until a size of about 1–2 cm is typically done in pots or trays at a high plant density. Strong seedlings are then replanted into individual pots or plant trays. We typically grow three times as many plantlets as we intend to use. The growth conditions for the wild type plants are flexible. Nicotiana species prefer warm climates and can be grown at temperatures of 18–30 °C. They also tolerate high humidity, but this may cause moulds to grow excessively on top of the soil. The plants are usually grown under long-day conditions, e.g. with lighting on an 18 h (day) and 6 h (night) cycle. Many laboratories use standard fluorescent tubes attached to a timer switch. By 6 weeks, the plants are generally 10–15 cm high, and each plant will occupy a circular space of approximately 10–15 cm diameter. Laboratory techniques in rabies Fifth edition 169 Plant production of monoclonal antibodies Part 6. Production of biologicals It should be emphasized that growing Nicotiana plants is entirely straight- forward, and within the grasp of anyone who has ever grown any kind of plant before. Although we recommend conditions for growth, in general it is difficult to get this stage wrong. For those without horticultural experience, the only require- ment is to remember to water the plants! 2. Produce a liquid culture of recombinant agrobacteria A. tumefaciens transformed with pTRA harbouring antibody genes is grown overnight on an orbital shaker (220 r/min) in complex media such as Luria-Bertani (LB) broth, YEB or PAM (39), 100 mg/mL rifampicin and 50 mg/mL kanamycin and 50 mg/mL carbenicillin at 26–28 °C. It is important to ensure that the temperature does not exceed 30 oC because the plasmids can be lost when the cells grow too quickly. Agrobacteria grows more slowly than E. coli. If starting from a single agrobacte- rium colony from an agar plate, this should be streaked onto an LB (Luria–Bertani broth) or YM (yeast minimal) agar plate and incubated at 28 °C for 2 days. Then 3 to 5 loopfuls of the culture are inoculated in liquid media to grow at 28 °C overnight. It is advisable to prepare a cell bank, i.e. aliquoted glycerol stocks of 50–500 µL stored at −80 °C. After centrifugation, the bacterial pellet is resuspended in infiltration solution containing 0.1 mmol acetosyringone (for low yield constructs), 10 mmol MES and 10 mmol MgCl2. The final OD600 of the bacterial suspensions should be adjusted to 0.5–1.0 for syringe infiltration, or 0.1–0.25 for vacuum infiltration (see below). Before scaling up, it can be worthwhile to run a titration experiment to determine the optimal OD600 for a particular gene of interest. Full length IgG antibodies derive from two gene products. While both trans- genes can be introduced on the same vector, this is not necessary. Individual heavy chain and light chain vectors can be prepared and simply mixed in a 1:1 ratio prior to Agro-infiltration, resulting in similar or sometimes even higher yields (32). The transfection process is highly efficient, so both genes will be co-transferred into a large proportion of the transfected plant cells. The same applies to the use of inhibitors of post-transcriptional gene silencing. A vector encoding, for example, the p19 silencing suppressor can also be co-infil- trated; however, this is typically done at lower levels, i.e. at a 1:5–1:10 ratio. 3. Agro-infiltrate by syringe or vacuum infiltration This is the process by which the agrobacterial suspension is introduced into the intracellular spaces of the plant leaves. The anatomy of a plant leaf is indi- cated in cross section in Fig. 41.4, illustrating the intercellular spaces that are present primarily within the spongy mesophyll cell layer. Agrobacteria are intro- duced through the stomata, which are normal structures in the lower surfaces Laboratory techniques in rabies Fifth edition 170 Plant production of monoclonal antibodies Part 6. Production of biologicals of leaves that allow gaseous exchange and transpiration. It is helpful to ensure that the plants are well watered before agroinfiltration. When the stomata are closed, it is almost impossible to infiltrate the leaves. In this case it can help to punch little holes into the leaf or make small scratches into the lower epidermis to facilitate entry of the bacterial suspension. These injuries should, however, be as small as possible as the affected tissue will ultimately die. The aim is to fill the air spaces with agrobacterium solution, and this is most simply done using a needle-less syringe on individual plant leaves. Alternatively, a whole plant can be agro-infiltrated at once using a simple vacuum device. There are numerous videos demonstrating these techniques online (search for “agroinfiltration”) or see (40). Using a 1  mL syringe pressed gently against the underside of the leaf (the abaxial surface), the bacterial suspension can be introduced directly into the leaf intercellular space. It is helpful to press a finger against the syringe nozzle from the other side of the leaf. The infiltrated area is evident by the growing “wet” patch that develops. Within a single leaf, the major veins often restrict the spread of the infiltration patch, so the procedure is repeated in different areas until most of the leaf is infiltrated. Expression of the gene of interest will be restricted to the area of infiltration, so it is possible to express multiple constructs on the same leaf. To infiltrate entire plants, a larger volume of recombinant agrobacteria is required, typically 1–2 L. The plant is immersed (upside down) in the bacterial suspension, within a dessicator vessel or pressure cooker attached to a vacuum pump. Precautions must be taken to prevent the compost from falling out of the plant pot, e.g. by wrapping the pot in plastic film. A vacuum is applied for 1–2 min at 100 mbar to draw out the air in the intracellular leaf spaces. On release of the vacuum, the agrobacterium solution is sucked back into the leaf. The plants are taken out of the suspension and excess liquid is allowed to drip off or be carefully removed with paper towels. Wax cuticule B y co ur te sy o f J ul ia n K .C . M a, S t G eo rg e’ s H os pi ta l M ed ic al S ch oo l, Lo nd on , U K . Fig. 41.4. Schematic representation of a leaf cross-section showing the general organization of the different cell types and the intercellular space targeted by agroinfiltration Laboratory techniques in rabies Fifth edition 171 Plant production of monoclonal antibodies Part 6. Production of biologicals 4. Allow transient expression to occur and protein to accumulate Following infiltration, the air space needs to be restored within the plant leaves to facilitate gas exchange (41). This also concentrates the Agrobacteria to the cell walls where they can initiate the gene transfer process. Usually no active interven- tion is necessary, but if problems arise, such as plant tissue death or rotting, it is usually helpful to incubate the plants for a couple of hours under low humidity or expose them to an airstream after agro-infiltration. The plants are then grown for 4–10 days at 22 °C. It has been shown that the transformation efficiency is temperature-dependent and drops sharply < 19 °C and > 23 °C (42). As before, lighting is typically maintained on a 16:8 h day:night cycle. Even though the infiltration medium contains a large amount of sugar and the leaf tissue does not depend on photosynthesis, incubation in the dark gene- rally results in poor expression because the leaves cannot get rid of the excess liquid as easily. Maximal recombinant antibody expression is usually seen at around 5 days, but this varies from target protein to target protein, so it is advisable to assay different plants daily starting from day 3. Detection of recombinant antibody can be performed either by ELISA or western blot or dot blot. A small sample of leaf (for example taken using a hole punch) is sufficient. The leaf tissue is homoge- nized in three volumes (volume/weight) of sodium phosphate (pH 7) buffer in a microcentrifuge tube, using a plastic or electric-pestle. After centrifugation, the supernatant can be applied to an ELISA plate pre-coated with a capture anti- serum (and further detected using a second appropriate enzyme labelled anti- serum), or 10 mL can be applied to SDS-PAGE and western blot using appropriate detection antisera. For ease of detection, we often co-express a fluorescent marker protein, such as DsRed, which provides a simple, non-invasive and cost–effective way to quickly assess the experiment. 5. Extract and purify protein Protein extraction involves homogenization of transfected leaf tissue in an extraction buffer. A simple buffer (e.g. sodium phosphate pH7) is commonly used (14), and the addition of antioxidants and/or protease inhibitors is at the discretion of the individual (43). Usually, provided the extraction is performed quickly and on ice, these are not required. Typically, 2–3 volumes of buffer are used to prepare the plant extract (volume/weight), using a micro pestle (manually), pestle and mortar or a standard kitchen blender. The resulting smooth homogenate is optionally passed through Miracloth before centrifugation at 18 000 r/min for supernatant clarification. The duration of centrifugation depends on the volume. At small scale (< 2 mL), 2 mins is sufficient, whereas at larger scale > 100 mL, up to 30 min may be necessary. The pH of the supernatant often needs to be re-adjusted, as the extract itself is slightly acidic and the buffer capacity may be insufficient, typically followed by another centrifugation step to remove further precipitates. The clari- fied extract can then either be applied directly to e.g. a self-packed disposable Laboratory techniques in rabies Fifth edition 172 Plant production of monoclonal antibodies Part 6. Production of biologicals column or the supernatant is then passed through a 0.45 µm filter followed by a 0.22  µm filter before being purified by affinity chromatography. Protein-G or Protein-A-sepharose is commonly used. Once the plant extract is loaded, the column is washed with three volumes of sodium phosphate buffer (pH 7.4), then the antibody is eluted with 100 mmol glycine (pH 2.5), followed by pH neutraliza- tion with 0.1 vol. 1 mol Tris base or 1 mol sodium acetate. Scale-up options The method described is adequate for most laboratory-based requirements for monoclonal antibodies and readily delivers high milligram quantities. Importantly, it is quick, economic and technically simple. Also important are the options for scaling up production, particularly for the development of potential products. This will, of course, require more specialist facilities, but it is useful to know that such facilities exist. For scaling up tran- sient expression, there are commercial facilities established around the world, for example in the UK (Leaf Expression Systems Limited), USA (e.g. Kentucky Bioprocessing, Inc. and Medicago) and Germany (Fraunhofer IME and Nomad Bioscience). One of the advantages of the pTRA vector system is that the recombinant agrobacteria can be used both for transient expression as well as for transforma- tion of tobacco tissue to produce stable transgenic plants. Although the process of generating and screening transgenic plants is relatively lengthy, this is the most appropriate solution for massive scale production of antibodies (as would be needed for MAbs used in rabies PEP for example). The path to the clinic for MAbs produced in transgenic plants has been made much clearer by the issuing of a Good Manufacturing Practice (GMP) licence to the Fraunhofer IME Institute (Aachen, Germany) for this process (44), and the approval of a first-in-human Phase I clinical trial for a plant derived antibody (14). While a GMP licence has yet to be issued for transient expression of MAbs in N. benthamiana, plant antibodies produced by agro-infiltration have entered clinical trials under FDA oversight. These include the patient-specific antibodies produced by non-Hodgkin’s lymphoma as an idiotype vaccine (45, 46), and ZMapp, a cocktail of three MAbs against Ebola Virus (47). With several more antibodies in the pipe- lines of academia and start-up companies and with the first big pharmaceutical company entering the scene, it is foreseeable that research manufacturing capa- city, regulatory guidelines and large-scale industrial plants will continue to grow. Production costs For those with a longer term interest in manufacturing antibodies in plants, cost aspects are considered in more detail below, starting with some general top-down considerations and then providing a bottom-up view of actual cost to establish plant antibody manufacturing. Several authors have analysed the costs of production for recombinant proteins from plants. Across all the reported studies and in agreement with the experiences Laboratory techniques in rabies Fifth edition 173 Plant production of monoclonal antibodies Part 6. Production of biologicals of many researchers in the fields, some generally accepted statements, if not dogmas, have arisen. The first and most important is that recombinant protein yield has the biggest impact on cost. In particular, low yields present additional problems such as degradation, low solubility and high losses during downstream processing. The second dogma is that upstream processing, i.e. growing the plant biomass, is generally inexpensive, immediately followed by the third dogma, which states that downstream processing represents the major bottleneck and up to 90% of the overall costs. Some 20 years ago, Kusnadi and colleagues reported the cost of producing a recombinant protein in plants, of US$ 5–60 per kilogram, assuming accumulation of 10% (w/w) of the total crop protein (48). As an example, soybean has a total protein content of 38% and the price per metric tonne was US$ 350 in May 2017, i.e. the cost of total soybean protein currently is about US$ 1/kg. Thus, at an accu- mulation rate of 10%, the recombinant protein would cost ~ US$ 10/kg. If only we could grow transgenic plants expressing valuable and lifesaving antibodies in open fields! An early techno-economic analysis was reported for MAb production in 2012, based on a production scale of 100 kg purified MAb annually in stable transgenic tobacco-based systems, assuming an expression level of 1 g/kg FW. Here, the cost of goods sold for production in greenhouses or in bioreactors was US$ 98/g and US$ 138/g respectively (49). In 2014, a similar analysis was performed for the agro-infiltration system including the investment and operating costs for the manufacturing facility (50). The  authors concluded that a 400 mg dose of a therapeutic enzyme would cost US$ 474, equivalent to US$ 1185 per gram. Adapting these numbers to the expression levels and purification yield of human MAbs suggests production costs of US$ 237 per gram. Most recently, a detailed techno-economic analysis for MAb production in a transient plant-based platform was published (51). The model analysis included evaluation of total capital investment, annual operating cost and cost of goods, and was based on published designs for a commercial-scale facility. At a production scale of 300 kg/year, the model predicted a total capital investment of US$ 122 M and cost of goods of 121 US$ per gram. Compared with the most recent data from the CHO manufacturing industry, this represents a significant reduction in capital investment and a > 50% reduction in the cost of goods (52, 53). The costs of a biological drug are also largely dependent on the required dose, i.e. the potency of the pharmaceutical protein. This is particularly true for virus-neu- tralizing antibodies and has been demonstrated impressively and documented for highly potent and broadly neutralizing HIV antibodies (54, 55). Compared with the early HIV-neutralizing MAbs, the required dose for the latest bnAbs (broadly neutralizing antibodies) is not only 100–1000 times lower, but their increased breadth of neutralization greatly facilitates the development of a cocktail antibody product. The situation is similar for rabies MAbs, where some of the more recently discovered human monoclonal antibodies have higher potencies than the murine MAbs that were the first available antibodies. A RIG product comprising a cocktail of at least three MAbs requires excellent and matching yields and potencies. The rapid and scalable transient gene expres- Laboratory techniques in rabies Fifth edition 174 Plant production of monoclonal antibodies Part 6. Production of biologicals sion by agro-infiltration of N. benthamiana provides unique opportunities for iden- tifying and developing such a challenging product. Again, the low entry barriers and costs are key enabling features. This chapter has described how recombinant proteins including antibodies can be expressed in tobacco plants and has summarized the state of the art in rela- tion to RABV-related reagents. Its main aim is to convey the message that plant expression of MAbs is technically and practically simplistic and within the grasp of any biologist. This can become a powerful tool for research laboratories to manufacture useful amounts of important reagents and candidate drugs for early in vivo studies. Laboratory techniques in rabies Fifth edition 175 Plant production of monoclonal antibodies Part 6. Production of biologicals References 1. Both L, Banyard AC, van Dolleweerd C, Horton DL, Ma JK, Fooks AR. Passive immunity in the prevention of rabies. The Lancet infectious diseases. 2012;12:397–407. 2. Bakker AB, Python C, Kissling CJ, Pandya P, Marissen WE, Brink MF, et al. First administration to humans of a monoclonal antibody cocktail against rabies virus: safety, tolerability, and neutralizing activity. Vaccine. 2008;26:5922–7. 3. Both L, van Dolleweerd C, Wright E, Banyard AC, Bulmer-Thomas B, Selden D, et al. Production, characterization, and antigen specificity of recombinant 62-71-3, a candidate monoclonal antibody for rabies prophylaxis in humans. FASEB J. 2013;27:2055–65. 4. Sloan SE, Hanlon C, Weldon W, Niezgoda M, Blanton J, Self J, et al. Identi- fication and characterization of a human monoclonal antibody that potently neutralizes a broad panel of rabies virus isolates. Vaccine. 2007;25:2800–10. 5. Kelley B. Industrialization of mAb production technology: the bioprocessing industry at a crossroads. MAbs. 2009;1:443–52. 6. Muller T, Dietzschold B, Ertl H, Fooks AR, Freuling C, Fehlner-Gardiner C, et al. Development of a mouse monoclonal antibody cocktail for post-exposure rabies prophylaxis in humans. PLoS Negl Trop Dis. 2009;3:e542. 7. Ma JK, Christou P, Chikwamba R, Haydon H, Paul M, Ferrer MP, et al. Reali- sing the value of plant molecular pharming to benefit the poor in developing countries and emerging economies. Plant Biotechnol J. 2013;11:1029–33. 8. Rybicki EP, Chikwamba R, Koch M, Rhodes JI, Groenewald JH. Plant- made therapeutics: an emerging platform in South Africa. Biotechnol Adv. 2012;30:449–59. 9. Girard LS, Fabis MJ, Bastin M, Courtois D, Petiard V, Koprowski H. Expres- sion of a human anti-rabies virus monoclonal antibody in tobacco cell culture. Biochem Biophys Res Commun. 2006;345:602–7. 10. Ko K, Tekoah Y, Rudd PM, Harvey DJ, Dwek RA, Spitsin S, et al. Function and glycosylation of plant-derived antiviral monoclonal antibody. Proc Natl Acad Sci U S A. 2003;100:8013–8. 11. Lee JH, Park DY, Lee KJ, Kim YK, So YK, Ryu JS, et al. Intracellular repro- gramming of expression, glycosylation, and function of a plant-derived anti- viral therapeutic monoclonal antibody. PLoS One. 2013;8:e68772. 12. van Dolleweerd CJ, Teh AY, Banyard AC, Both L, Lotter-Stark HC, Tsekoa T, et al. Engineering, expression in transgenic plants and characterisation of E559, a rabies virus-neutralising monoclonal antibody. J Infect Dis. 2014;210:200–8. 13. Hiatt AC, Cafferkey R, Bowdish K. Production of antibodies in transgenic plants. Nature. 1989;342:76–8. 14. Ma JK, Drossard J, Lewis D, Altmann F, Boyle J, Christou P, et al. Regula- tory approval and a first-in-human phase I clinical trial of a monoclonal anti- Laboratory techniques in rabies Fifth edition 176 Plant production of monoclonal antibodies Part 6. Production of biologicals body produced in transgenic tobacco plants. Plant Biotechnol J. 2015. PMID: 26147010. 15. De Jaeger G, Buys E, Eeckhout D, De Wilde C, Jacobs A, Kapila J, et al. High level accumulation of single-chain variable fragments in the cytosol of trans- genic Petunia hybrida. Eur J Biochem. 1999;259:426–34. 16. Vaquero C, Sack M, Chandler J, Drossard J, Schuster F, Monecke M, et al. Transient expression of a tumor-specific single-chain fragment and a chimeric antibody in tobacco leaves. Proc Natl Acad Sci U S A. 1999;96:11128–33. 17. Voinnet O, Rivas S, Mestre P, Baulcombe D. An enhanced transient expres- sion system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. Plant J. 2003;33:949–56. 18. Gelvin SB. Agobacterium-mediated plant transformation: the biology behind the “gene-Jockeying” tool. Microbiol Mol Biol Rev. 2003;67:16–37. 19. Gleba Y, Klimyuk V, Marillonnet S. Viral vectors for the expression of proteins in plants. Curr Opin Biotechnol. 2007;18:134–41. 20. Sainsbury F, Thuenemann EC, Lomonossoff GP. pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J. 2009;7:682–93. 21. Hiatt A, Pauly M, Whaley K, Qiu X, Kobinger G, Zeitlin L. The emergence of antibody therapies for Ebola. Hum Antibodies. 2015;23:49–56. 22. Phoolcharoen W, Prehaud C, van Dolleweerd CJ, Both L, da Costa A, Lafon M, et al. Enhanced transport of plant-produced rabies single-chain antibo- dy-RVG peptide fusion protein across an in cellulo blood-brain barrier device. Plant Biotechnol J. 2017 (https://core.ac.uk/download/pdf/82918929.pdf, accessed 1 October 2018). 23. Perea Arango I, Loza Rubio E, Rojas Anaya E, Olivera Flores T, Gonzalez de la Vara L, Gomez Lim MA. Expression of the rabies virus nucleoprotein in plants at high-levels and evaluation of immune responses in mice. Plant Cell Rep. 2008;27:677–85. 24. Yusibov V, Hooper DC, Spitsin S, Fleysh N, Kean RB, Mikheeva T, et al. Expression in plants and immunogenicity of plant virus-based experimental rabies vaccine. Vaccine. 2002;20:3155–64. 25. McGarvey PB, Hammond J, Dienelt MM, Hooper DC, Fu ZF, Dietzschold B, et al. Expression of the rabies virus glycoprotein in transgenic tomatoes. Bio-technology. 1995;13:1484–7. 26. Ashraf S, Singh PK, Yadav DK, Shahnawaz M, Mishra S, Sawant SV, et al. High level expression of surface glycoprotein of rabies virus in tobacco leaves and its immunoprotective activity in mice. J Biotechnol. 2005;119:1–14. 27. Nester EW, Gordon MP, Amasino RM, Yanofsky MF. Crown gall – a molecular and physiological analysis. Annu Rev Plant Phys. 1984;35:387–413. 28. Lacroix B, Citovsky V. The roles of bacterial and host plant factors in Agro- bacterium-mediated genetic transformation. Int J Dev Biol. 2013;57:467–81. Laboratory techniques in rabies Fifth edition 177 Plant production of monoclonal antibodies Part 6. Production of biologicals 29. Bourras S, Rouxel T, Meyer M. Agrobacterium tumefaciens gene transfer: how a plant pathogen hacks the nuclei of plant and nonplant organisms. Phytopa- thology. 2015;105:1288–301. 30. Sack M, Paetz A, Kunert R, Bomble M, Hesse F, Stiegler G, et al. Functional analysis of the broadly neutralizing human anti-HIV-1 antibody 2F5 produced in transgenic BY-2 suspension cultures. FASEB J. 2007;21:1655–64. 31. Gleba Y, Klimyuk V, Marillonnet S. Magnifection--a new platform for expres- sing recombinant vaccines in plants. Vaccine. 2005;23:2042–8. 32. Zischewski J, Sack M, Fischer R. Overcoming low yields of plant-made anti- bodies by a protein engineering approach. Biotechnol J. 2016;11:107–16. 33. Bialon M, Schellenberg L, Herzog N, Kraus S, Jorissen H, Fischer R, et al. Cloning murine antibody V-genes with non-degenerate primers and conver- sion to a recombinant antibody format. Monoclon Antib Immunodiagn Immu- nother. 2014;33:369–77. 34. Webster GR, Teh AY, Ma JK. Synthetic gene design – the rationale for codon optimization and implications for molecular pharming in plants. Biotechnol Bioeng. 2017;114:492–502. 35. Lee LY, Gelvin SB. T-DNA binary vectors and systems. Plant Physiol. 2008;146:325–32. 36. Kapila J, DeReycke R, Van Montagu M, Angenon G. An Agrobacte- rium-mediated transient gene expression system for intact leaves. Plant Science.122:101–8. 37. Bally J, Nakasugi K, Jia F, Jung H, Ho SY, Wong M, et al. The extremophile Nicotiana benthamiana has traded viral defence for early vigour. Nat Plants. 2015;1:15165. 38. Yang SJ, Carter SA, Cole AB, Cheng NH, Nelson RS. A natural variant of a host RNA-dependent RNA polymerase is associated with increased susceptibility to viruses by Nicotiana benthamiana. Proc Natl Acad Sci U S A. 2004;101:6297–302. 39. Houdelet M, Galinski A, Holland T, Wenzel K, Schillberg S, Buyel JF. Animal component-free Agrobacterium tumefaciens cultivation media for better GMP-compliance increases biomass yield and pharmaceutical protein expression in Nicotiana benthamiana. Biotechnol J. 2017;12:1600721 (https:// onlinelibrary.wiley.com/doi/epdf/10.1002/biot.201600721, accessed 1 October 2018). 40. Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, et al. Efficient agroinfiltration of plants for high-level transient expression of recombinant proteins. J Vis Exp. 2013;77:e50521. 41. Fujiuchi N, Matsuda R, Matoba N, Fujiwara K. Removal of bacterial suspen- sion water occupying the intercellular space of detached leaves after agroinfil- tration improves the yield of recombinant hemagglutinin in a Nicotiana bentha- miana transient gene expression system. Biotechnol Bioeng. 2016;113:901–6. Laboratory techniques in rabies Fifth edition 178 Plant production of monoclonal antibodies Part 6. Production of biologicals 42. Jin S, Song YN, Deng WY, Gordon MP, Nester EW. The regulatory VirA protein of Agrobacterium tumefaciens does not function at elevated temperatures. J Bacteriol. 1993;175:6830–5. 43. Hehle VK, Paul MJ, Drake PM, Ma JK, van Dolleweerd CJ. Antibody degrada- tion in tobacco plants: a predominantly apoplastic process. BMC Biotechnol. 2011;11:128. 44. Sack M, Rademacher T, Spiegel H, Boes A, Hellwig S, Drossard J, et al. From gene to harvest: insights into upstream process development for the GMP production of a monoclonal antibody in transgenic tobacco plants. Plant Biotechnol J. 2015;13:1094–105. 45. Tuse D, Ku N, Bendandi M, Becerra C, Collins R Jr, Langford N, et al. Clinical safety and immunogenicity of tumor-targeted, plant-made Id-KLH conjugate vaccines for follicular lymphoma. Biomed Res Int. 2015;2015:648143. 46. McCormick AA, Reddy S, Reinl SJ, Cameron TI, Czerwinkski DK, Vojdani F, et al. Plant-produced idiotype vaccines for the treatment of non-Hodgkin’s lymphoma: safety and immunogenicity in a phase I clinical study. Proc Natl Acad Sci U S A. 2008;105:10131–6. 47. Group PIW, Multi-National PIIST, Davey RT, Jr., Dodd L, Proschan MA, Neaton J, et al. A randomized, controlled trial of ZMapp for Ebola virus infection. N Engl J Med. 2016;375:1448–56. 48. Kusnadi AR, Nikolov ZL, Howard JA. Production of recombinant proteins in transgenic plants: Practical considerations. Biotechnol Bioeng. 1997;56:473– 84. 49. Wilken LR, Nikolov ZL. Recovery and purification of plant-made recombinant proteins. Biotechnol Adv. 2012;30:419–33. 50. Tuse D, Tu T, McDonald KA. Manufacturing economics of plant-made biolo- gics: case studies in therapeutic and industrial enzymes. Biomed Res Int. 2014;2014:256135. 51. Nandi S, Kwong AT, Holtz BR, Erwin RL, Marcel S, McDonald KA. Techno-eco- nomic analysis of a transient plant-based platform for monoclonal antibody production. MAbs. 2016;8:1456–66. 52. Petrides D, Carmichael D, Siletti C, Koulouris A. Biopharmaceutical process optimization with simulation and scheduling tools. Bioengineering (Basel). 2014;1:154–87. 53. Werner RG. Economic aspects of commercial manufacture of biopharmaceu- ticals. Journal of biotechnology. 2004;113:171–82. 54. Eroshkin AM, LeBlanc A, Weekes D, Post K, Li Z, Rajput A, et al. bNAber: database of broadly neutralizing HIV antibodies. Nucleic Acids Res. 2014;42(Database issue):D1133-9. 55. Stephenson KE, Barouch DH. Broadly neutralizing antibodies for HIV eradica- tion. Curr HIV/AIDS Rep. 2016;13:31–7. Laboratory techniques in rabies Fifth edition 179 Part 7. Potency determinations Part 7. Potency determinations Laboratory techniques in rabies Fifth edition 180 NIH test for potency testing of vaccines Part 7. Potency determinations Chapter 42 The NIH test for potency testing of vaccines Introduction The NIH test for potency was originally developed at the National Institutes of Health (Bethesda, MD, USA). The test measures the degree of protection conferred by inactivated rabies vaccines in immunized mice challenged with rabies virus (RABV). It is undertaken by vaccinating two groups of mice twice, 7 days apart, with dilutions of a reference vaccine and the vaccine being tested. Seven days after the last vaccination, the immunized mice and a control group of mice are challenged with the challenge virus standard (CVS) mouse-brain strain of fixed RABV. The mice are observed daily and the median effective dose (ED50) of the reference and test vaccines is determined based on the number of survivors. The relative potency of the test vaccine is then calculated by comparing the ED50 of the test vaccine with that of the reference vaccine. Methods Reagents • CVS stored frozen (at −80 °C or in liquid nitrogen) as a 20% mouse-brain suspension in a diluent containing a low percentage (2–5%) of heat-inactivated fetal calf serum (FCS), and distributed in aliquots of about 800 µL. • Reference vaccine Several reference vaccines are commercially available. For example, the Biolo- gical Reference Preparation (BRP) batch N°5, currently distributed by the Euro- pean Directorate for the Quality of Medicines (EDQM), is a freeze-dried vaccine derived from the Pitman Moore strain of RABV produced in Nil-2 cell line and inactivated with ß-propiolactone. This reference vaccine has an assigned titre of 10 International Units (IU) per vial (1). The sixth International Standard for Rabies Vaccine (07/162) is distributed by the National Institute for Biological Standards and Control (NIBSC, UK). This material was prepared from a bulk of Vero cell derived, Pitman Moore strain, produced by the same manufacturing process as that for the fifth International Standard for Rabies Vaccine. It has an assigned titre of 8 IU/vial (2). • Laboratories can prepare an internal reference vaccine provided it is calibrated against an International Standard (see above). • 3- and 5-week-old Swiss or NMRI (Naval Medical Research Institute) female mice, or equivalent • heat-inactivated FCS • phosphate buffered saline (PBS), pH 7.4 Laboratory techniques in rabies Fifth edition 181 NIH test for potency testing of vaccines Part 7. Potency determinations • injectable anaesthetics (tiletamine in combination with zolazepam as an example) or anesthetics for inhalation (isoflurane). Protocol Preparation of the working CVS 1. Thaw rapidly the content of an ampoule of frozen virus under cold running water and dilute in PBS supplemented with 2% heat-inactivated fetal calf serum (FCS) so as to obtain a suspension containing approximately 103 LD50/ mL. The dilution factor will be calculated according to the titre of the stock solution. 2. Anaesthetize 3-week-old female Swiss/NMRI mice (the number of mice will be adapted according to the amount of required CVS vials). 3. Inoculate the mice intracerebrally (Fig. 42.1) with 0.03 mL of the suspension containing 103 LD50/mL. 4. Observe the mice at least once daily to detect rabies clinical signs. Animal’s deaths occurring during the 4 days after the intracerebral inoculation are consi- dered nonspecific and cannot be attributed specifically to rabies. 5. Once paralyzed, euthanize the mice by acceptable standards (e.g. by cervical dislocation or CO2 asphyxia). 6. Collect the brains, freeze them immediately and store at −80 °C. 7. Once the collection is complete, thaw, weigh and reduce the harvested brains to pulp using a sterile pestle and mortar, a tissue grinder, a mixer or another appropriate device. This procedure should be carried out in a biosafety cabinet to prevent the release of the virus in an aerosol. Add a sufficient volume of PBS supplemented with 2% heat-inactivated FCS (plus antibiotics) to obtain a 20% suspension by weight. 8. Assign a batch number to the suspension, centrifuge at 3000 x g / +4 °C for 30 min and immediately distribute the supernatant into sterile ampoules. Store at −80 °C or in liquid nitrogen. Note: Each step in preparing the working CVS must be carried out promptly, and in an ice-water batch or equivalent, to ensure the survival of the maximum possible amount of virus. Fig. 42.1. Intracerebral injection into an anesthetized mouse B y co ur te sy o f A le xa nd re S er va t, A N S ES , M al zé vi lle , F ra nc e Laboratory techniques in rabies Fifth edition 182 NIH test for potency testing of vaccines Part 7. Potency determinations Determination of the LD50 of the working CVS Before use as a challenge virus, the median lethal dose (LD50) of each lot of the working CVS should be determined in 5-week-old mice as follows: Remove one ampoule of the pooled working CVS from storage at −80 °C and thaw rapidly under cold running water. Prepare serial 10-fold dilutions of the suspension in CVS diluent. Anaesthetize groups of 10 mice and inoculate them intracerebrally (Fig. 42.1) with each dilution of the working CVS, each mouse receiving 0.03 mL. Observe the mice for 14 days and record the number that die from rabies after the first 5 days and animals that are euthanized after evidence of stage 3 clinical signs (see Annex). Include any mice showing signs of rabies (e.g. paralysis, convulsions) on the 14th day. Calculate the LD50 of the working CVS using the Spearman–Kärber method or using an appropriate statistics software. A lot is generally considered satisfactory if the LD50 is between 10 −6 and 10−8 dilutions inclusive. The maximum variation from test to test in the titre obtained should not exceed one 10-fold dilution when the same lot of challenge virus is used. The lot of working CVS may be used for as long as full potency is maintained as shown by mouse titration. Immunization of mice A four serial 5-fold dilution range of test vaccines and reference vaccine are performed in PBS. The initial dilution generally corresponds to 1/5, but may be adapted depending on the potency of the test vaccine and the reference vaccine. Dilutions may be performed in 15 mL conical centrifuge tubes as follows: Dilution Volume of vaccine Volume of PBS 10−0.7 2 mL of neat vaccine 8 mL 10−1.4 2 mL of dilution 10−0.7 8 mL 10−2.1 2 mL of dilution 10−1.4 8 mL 10−2.8 2 mL of dilution 10−2.1 8 mL 1. Inject groups of sixteen 3-week-old female mice intraperitoneally (Fig. 42.2) with 0.5  mL of each dilution of the test vaccine and the reference vaccine. The mouse is manually restrained and is held in a supine position. The needle (23-gauge x 1”) and syringe (2.5 mL) are kept parallel to the vertebral column of the animal; the injection is made in the lower quadrant of the abdomen with an angle of about 10°. 2. Administer two doses of vaccine to each mouse one week apart. 3. Set aside enough mice for an adequate titration of the challenge virus to be made with at least 10 mice for each dilution of virus (a total of four dilutions, i.e. 40 mice). Laboratory techniques in rabies Fifth edition 183 NIH test for potency testing of vaccines Part 7. Potency determinations 4. Use a different needle and syringe to inoculate each group of mice. Where supplies are limited, use a single needle and syringe to inoculate the test vaccine and/or reference vaccine. In that case, mice receiving the most diluted vaccine should be inoculated first, followed by those receiving successively more concentrated vaccines. Mice receiving different vaccine concentrations should be housed separately. Challenge of control and test mice All mice are challenged intracerebrally (Fig. 42.1) 14 days after the first dose of vaccine as follows: 1. Take one ampoule of the pooled working CVS, put it on a bed of ice and thaw rapidly under cold running water. 2. Based on the previous titrations, dilute the CVS in PBS supplemented with 2% of heat-inactivated FCS to obtain the challenge dilution providing about 50 LD50 in 30 µL. From this challenge dilution, a three serial 10-fold dilution range is prepared to perform a titration of the virus as follows: Fig. 42.2. Intraperitoneal injection to lower quadrant of a mouse B y co ur te sy o f A le xa nd re S er va t, A N S ES , M al zé vi lle , F ra nc e Dilution Volume of vaccine Volume of PBS 10−0 Challenge dilution providing 50LD50/0.03 mL – 10−1 0.5 mL of dilution 10−0 4.5 mL 10−2 0.5 mL of dilution 10−1 4.5 mL 10−3 0.5 mL of dilution 10−2 4.5 mL All dilutions of CVS are held in an ice bath throughout the experiment. Laboratory techniques in rabies Fifth edition 184 NIH test for potency testing of vaccines Part 7. Potency determinations 3. Anaesthetize the mice to minimize or avoid the pain and distress associated with the intracranial inoculation procedure (following international regulations on animal experimentation). This anaesthesia has no adverse effect on the test results. 4. Challenge the immunized mice intracerebrally with 0.03 mL of the dilution containing 50 LD50 per 0.03 mL. Inoculate the control mice intracerebrally (syringe 1 mL, needle 26G / ½”) with 0.03 mL of each dilution of the challenge virus. It is preferable to use a different syringe for each dilution of the challenge virus; however, if only one syringe is used, the 10−3 dilution must be injected first, followed by the 10−2 dilution, the 10−1 dilution and then the 10−0 dilution. 5. Observe the mice daily for 14 days to detect the appearance of typical rabies clinical  signs. Generally shaky movements, trembling and convulsions (stage 3 of rabies  clinical signs) are suitable humane end-points instead of lethality, to reduce the  duration of animal suffering (3). Record animals that die from rabies and animals that are euthanized after evidence of stage 3 clinical signs (see Annex). Include mice showing rabies stage 3 clinical signs on the 14th day. Calculation of potency The NIH potency test is a titration method based on quantal or “all or none” responses. In such dilution assays, a comparison between the dose–response relationships of the reference vaccine and the test vaccine is necessary. Lineariza- tion of these dose–response curves may be obtained by different transformations, such as probit, angular or logit. Statistics software may be helpful to simplify the calculations. Potency and confidence limits can be calculated by comparing the ED50 of the reference vaccine with the ED50 of the test vaccine. When an in-depth statistical analysis is not possible (as described above), a volumetric method of calculation of potency should be used. This compares the 50% end-point dilution (vaccine dilution protecting 50% of mice) of the vaccine under test with that of the international standard (or equivalent national reference vaccine). The relative potency (RP) of the vaccine under test is determined by the formula: RP = Where TV = test vaccine RV = reference vaccine Dose = volume of a single vaccinal dose, as stated by the producer. For example, if the ED50 of the test vaccine is 1:90 and that of the reference vaccine is 1:70, the reciprocal values will be 90 and 70, respectively. If it is assumed that a single human dose of the test vaccine is 2 mL and that 1 mL of the reference vaccine represents a single dose for humans, then: RP = Laboratory techniques in rabies Fifth edition 185 NIH test for potency testing of vaccines Part 7. Potency determinations Minimum potency requirements The relative potency of rabies vaccines for veterinary use should be determined using a recognized rabies reference vaccine and the batch of rabies vaccine used in a valid vaccination challenge test in the target species. The test should be carried out at the end of the period of immunity claimed by the vaccine producer. The relative potency value obtained in the NIH test should become the minimum value for all subsequent batches of the vaccine. At its eighth meeting, the WHO Expert Committee on Rabies (4) suggested that inactivated veterinary vaccines with a potency of < 1.0 IU per dose, as measured by the NIH test, should not be licensed or released unless an adequately designed experiment has demonstrated a duration of immunity of at least 1 year in the species for which the vaccine is to be used. The Committee recommended that highly purified, modern rabies vaccines for human use should have a minimum potency of 2.5 IU per dose (5,6). Modified NIH test To comply with the 3Rs principle, which aims to replace or reduce animal use and refine experimental procedures, a modified NIH test, based on a single immu- nization instead of two, may be used as described in the European Pharmacopeia for rabies inactivated vaccines for veterinary use (7). For laboratories testing numerous batches of vaccine every year, and having a strong expertise and testing history, groups of 10 mice (instead of 16) may be used as well for the test vaccine and the reference vaccine (8). Single dilution test The single dilution test is a simplification of the NIH test. The aim of this test is to determine whether a rabies vaccine satisfies the minimum potency require- ment without assigning a precise value to it. The test provides qualitative results. It requires a homogeneous stock of challenge virus, well standardized methods of titration and laboratory animals of constant quality (consistent response to the vaccine and the challenge virus). This test is particularly useful for testing multiple batches of vaccine within a short time and for reducing the number of mice used in the NIH test. However, given its own lack of precision, the minimum requirement for vaccines tested by the single dilution test is higher than that for vaccines tested by the standard NIH test. Method Before performing the single dilution test, a laboratory must have determined the titre of the reference vaccine (sixth International Standard for Rabies Vaccine, Biological Reference Preparation batch N°5, or any national reference vaccine calibrated against an international standard) several times in order to determine its ED50. When the weighted mean of the ED50 of the reference vaccine has been calculated, the theoretical ED50 for a vaccine of the required potency can be deter- mined using the formula: D = Dm + log10 (n) – log10 (N)-log10 (v) Laboratory techniques in rabies Fifth edition 186 NIH test for potency testing of vaccines Part 7. Potency determinations Where: D = the minimum ED50 required for the vaccine under test (decimal logarithm of the inverse of the arithmetical dilution); Dm = the weighted mean of the ED50 obtained with the reference vaccine; N = the required potency of the vaccine under test (IU/mL); N = the required potency of the reference vaccine (IU/mL) – this information is provided in the insert supplied with the vaccine; and V = the volume (mL) of a single dose of the vaccine under test, as stated by the manufacturer. This dilution is then used for the vaccine under test. The standard NIH test protocol is followed using 10 mice vaccinated with the theoretical ED50 of the vaccine under test. To satisfy the minimum requirement, at least eight of the 10 vaccinated mice should survive after challenge. Discussion Potency tests of vaccines are quality control tests that provide manufacturers with information on the potency of their products before licensing. These tests are also widely used by regulatory authorities to ensure that marketed vaccines are sufficiently potent and effective. Many quality control tests for vaccines, notably the rabies vaccine potency test, are based on techniques described several decades ago and still rely on the use of laboratory animals. Nevertheless, the introduction of the 3Rs concept (9), and the growing concern about ethics and animal welfare, have convinced regulatory authorities to promote animal reduction and refinement of the NIH test: anaesthesia before injection of intracerebral virus, definition of humane end-points (10). Reduction of animal use in each dilution is now widely incorporated in guidelines and monographs and should be considered and applied by all laboratories carrying out the NIH test. Methods such as the single dilution test or the serological potency assay could also provide advances to go even further in the 3Rs approach. Laboratory techniques in rabies Fifth edition 187 NIH test for potency testing of vaccines Part 7. Potency determinations References 1. Daas A, Bruckner L, Milne C. EDQM biological reference preparation for rabies vaccine (inactivated) for veterinary use: collaborative study to establish batch no. 5. Pharmeur Bio Sci Notes. 2015;1:57–72. 2. WHO Expert Committee on Biological Standardization. Geneva: World Health Organization; 2008 (http://apps.who.int/iris/bitstream/handle/10665/70593/ WHO_BS_08.2087_eng.pdf, accessed 1 October 2018). 3. Bruckner L, Cussler K, Halder M, Barrat J, Castle P, Duchow K, et al. 3Rs approaches in the quality control of inactivated rabies vaccines. Atla. 2003;31:429–54. 4. WHO Expert Consultation on Rabies, 3rd report. Geneva: World Health Orga- nization; 2018 (WHO Technical Report Series, No. 1012; http://apps.who.int/ iris/bitstream/handle/10665/272364/9789241210218-eng.pdf, accessed 1 October 2018). 5. WHO Expert Committee on Biological Standardization, 37th report. Geneva: World Health Organization; 1987 (WHO Technical Report Series, No. 760; http://www.who.int/biologicals/publications/trs/en/, accessed 1 October 2018). 6. WHO Expert Committee on Biological Standardization, 31st report. Geneva: World Health Organization; 1981 (WHO Technical Report Series, No. 658; http://www.who.int/biologicals/publications/trs/en/, accessed 1 October 2018). 7. Rabies vaccine (inactivated) for veterinary use, monograph 0451. In: European Pharmacopoeia, 8th edition. Strasbourg: Council of Europe; 2013:1055–7. 8. Stockes W, McFarland R, Kulpa-Eddy J, Gatewood D, Levis R, Halder M, et al. Report on the international workshop on alternative methods for human and veterinary rabies vaccine testing: State of the science and planning the way forward. Biologicals, 2013;41:279–94. doi:10.1016/j.biologicals.2013.06.013. 9. Russell WMS, Burch RL. The principles of humane experimental technique. London: Methuen; 1959 [Reprinted by Universities Federations for Animal Welfare, 1992]. 10. Healy DM, Brookes SM, Banyard AC, Núñez A, Cosby SL, Fooks AR. Patho- biology of rabies virus and the European bat lyssaviruses in experimentally infected mice. Virus Res. 2013;172:46–53. Laboratory techniques in rabies Fifth edition 188 NIH test for potency testing of vaccines Part 7. Potency determinations Annex Progress of rabies virus infection in mice associated with stages of clinical signs Stage 1: ruffled fur and hunched back Stage 2: loss of alertness, slow and/or circular movements Stage 3: trembling and shaking movements, weight loss, convulsions Stage 4: paresis followed by signs of paralysis Stage 5: moribund animals, prostration Laboratory techniques in rabies Fifth edition 189 The serological potency assay Part 7. Potency determinations Chapter 43 The serological potency assay for batch potency testing of inactivated rabies Introduction The serological potency assay (SPA) uses groups of mice immunized with a prediluted test vaccine or the reference standard vaccine adjusted to the minimum potency of 1 International Unit (IU) per dose. Blood samples from all mice are taken 14 days after immunization and the amount of rabies virus (RABV)-neutrali- zing antibodies induced after vaccination is determined using a serum neutraliza- tion test. The vaccine complies if the antibody titres obtained with the test vaccine are greater than or equal to the antibody titres obtained for the reference vaccine. Laboratories willing to implement this alternative test are strongly encouraged to have a background in the mouse potency test and to conduct product-specific validations on rabies inactivated vaccines that they routinely control. This alter- native method offers significant progress for the batch potency testing of rabies vaccines by significantly decreasing the number of animals (20 vs 148 for the NIH test) for one test vaccine and by avoiding the pain and distress of the intracranial challenge along with the signs associated with a lethal RABV infection. Methods Reagents Reference vaccine Several reference vaccines are commercially available. The Biological Refe- rence Preparation (BRP) batch No. 5 is distributed by the European Directorate for the Quality of Medicines. It is a freeze-dried vaccine derived from the Pitman Moore strain of RABV produced in Nil-2 cell line and inactivated with ß-propiolactone. This reference vaccine has an assigned titre of 10 IU/vial (1). The sixth International Standard for Rabies Vaccine (07/162) is distributed by the National Institute for Biological Standards and Control (NIBSC), UK. This material was prepared from a bulk of Vero cell-derived, RABV Pitman Moore strain, produced by the same manufacturing process as the fifth International Standard, RAV. It has an assigned titre of 8 IU/vial (2). Laboratories can prepare an internal reference vaccine provided it is calibrated against an International Standard (see above). • Swiss/NMRI female mice, or equivalent, weighing 18–20 g • phosphate buffered saline (PBS), pH 7.4 • xylazine and ketamine-based anaesthetics Laboratory techniques in rabies Fifth edition 190 The serological potency assay Part 7. Potency determinations Protocol Immunization of mice For immunization of mice, the reference vaccine and the test vaccine are diluted as follows: 1. Prepare a 1 IU/mL suspension of the reference vaccine in PBS. 2. Test vaccines are diluted according to their minimum approved specifica- tion. Rabies vaccines with a minimum specification at 1 IU/mL are used neat. Vaccines with a minimum specification at 2 IU/mL or 3 IU/mL are diluted 1:2 and 1:3 respectively in PBS. 3. Inject groups of 8–10 female Swiss/NMRI mice, weighing 18–20 g, intraperi- toneally with 0.2 mL of each dilution of the test vaccines and the reference vaccine. Mice are manually restrained and are held in a supine position. The needle (23G x 1”) and syringe (2.5 mL) are kept parallel to the vertebral column of the animal and the injection is made in the lower left quadrant of the abdomen with an angle of about 10°. Blood sampling After 14 days, mice are anaesthetized using a combination of xylazine and ketamine. Blood is collected by heart puncture under thoracotomy to obtain a large amount a venous blood with certainty. 1. Restrain the mouse on its back on an operating board. 2. Cut the skin around the xiphoid cartilage to expose the muscular wall of the thorax and abdomen. 3. Incise the abdominal wall just below the xiphoid cartilage and cut the diaphragm and thoracic wall at both sides of the sternum. The thoracic wall is pulled upwards and gripped with forceps. 4. Prepare a 1 mL syringe with a needle (21–23 gauge), insert the needle into the right ventricle of the beating heart, and collect the blood slowly and conti- nuously by withdrawing the plunger. 5. Once bloods are collected from all mice, sera are extracted after centrifugation (2000 g, 15 min) and kept at −20 °C until determination of RABV neutralizing antibody. Determination of RABV neutralizing antibodies All sera from mice immunized with the reference vaccine and from mice immu- nized with test vaccine are tested individually for RABV neutralizing antibodies using a sero-neutralization assay such as the FAVN test (3, 4) or the RFFIT (5). Statistical analysis The SPA uses the one-sided limit test (the Wilcoxon–Mann–Whitney exact test) lying on the ranking of all titres obtained with mice immunized with the test vaccine and the reference vaccine. Calculations must be performed using appro- priate statistics software. Laboratory techniques in rabies Fifth edition 191 The serological potency assay Part 7. Potency determinations Validation of the SPA The assay is invalid if more than two non-responders (RABV neutralizing anti- body titre below the quantification limit) are observed in a group of 10 mice vacci- nated with the reference vaccine. A test vaccine complies with the SPA if the RABV neutralizing antibody titre is significantly higher (p ≤ 0.05) than the RABV neutralizing antibody titre obtained with the reference vaccine. Discussion The SPA was first included in the 8th edition of the European Pharmacopeia as an official alternative to the NIH test for the batch potency test of rabies inactivated vaccines for veterinary use (6). This test offers a real improvement in animal welfare by reducing significantly the number of animals used and decreasing the suffering entailed by the intracranial injection and the development of rabies clinical signs. The SPA for rabies vaccine batch potency testing, while not completely elimina- ting the use of experimental animals, contributes to the efforts to be made in the context of the 3Rs. Laboratories are strongly encouraged to switch from the NIH mouse challenge test to the SPA and to validate this test on each rabies vaccine that they routinely control for potency. References 1. Daas A, Bruckner L, Milne C. EDQM biological reference preparation for rabies vaccine (inactivated) for veterinary use: collaborative study to establish batch No. 5. Pharmeur Bio Sci Notes. 2015;1:57–2. 2. WHO Expert Committee on Biological Standardization. Report. Geneva: World Health Organization; 2008 (WHO/BS/08.2087; http://apps.who.int/iris/ bitstream/handle/10665/70593/WHO_BS_08.2087_eng.pdf;sequence=1, accessed 1 October 2018). 3. Servat A, Schereffer JL, Kempff S, Brogat V, Litaize E, Cliquet F. Validation and adoption of the FAVN test as an alternative method to replace the in-vivo potency tests of inactivated rabies vaccines for veterinary use. Altern Lab Anim. 2015;43:19–27. 4. Cliquet A, Aubert M, Sagné L. Development of a fluorescent antibody virus neutralisation test (FAVN test) for the quantification of rabies-neutralising anti- body. J Immunol Methods. 1998;212:79–87. 5. Krämer B, Bruckner L, Daas A, Milne C. Collaborative study for validation of a serological potency assay for rabies vaccine (inactivated) for veterinary use. Pharmeur Bio Sci Notes. 2010;2:37–55. 6. Rabies vaccine (inactivated) for veterinary use, monograph 0451. In: European Pharmacopoeia, 8th edition. Strasbourg: Council of Europe; 2013:1055–7. Laboratory techniques in rabies Fifth edition 192 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Chapter 44 In vitro tests for rabies vaccine potency testing Introduction For more than 50 years, the NIH test (1) has been used to evaluate rabies vaccine potency before batch release. The test involves immunizing groups of mice intraperitoneally with the vaccine to be tested and administering an intrace- rebral challenge 14 days later with the challenge virus standard (CVS) strain (see Chapter 42). Although still required to assess vaccine potency by WHO (2) and the European Pharmacopoeia (3), the NIH test has several drawbacks: results are highly variable (4); live rabies virus (RABV) is used and requires strict biosafety measures; and large numbers of animals are employed and the severity of the challenge raises ethical concerns (5). A less severe variation of this test has been developed: 2 weeks after intraperitoneal vaccination as above, mice are bled and RABV neutralizing antibodies (VNAs) are tested in an in vitro neutralization test (see Chapter 43). This test is already in use for veterinary vaccines (6, 7) and has been considered for human vaccines (8). However, it sacrifices a large number of laboratory mice. Today, both International (9) and European (10) recommendations encourage manufacturers and national control laboratories (Official Medicine Control Labora- tories; OMCLs) to implement the “3Rs strategy” for the “Replacement, Reduction and Refinement” of laboratory animal testing. European Directive 2010/63/EU (in force since 1 January 2013) related to the protection and welfare of animals has reinforced the rules for vaccine manufacturers and laboratories involved in quality control of rabies vaccines as well as in rabies research (11). Development, valida- tion and use of in vitro alternative approaches have now become a priority; they are not only ethically sound but can also reduce batch testing costs and shorten the time for results to hours instead of weeks (3). Several immunochemical methods, such as the antibody-binding-test (12, 13), the single radial immunodiffusion test (14) and the ELISA test (15–19) are recom- mended by the WHO Technical Report Series (2) and the European monograph (3) to quantify the antigen content in rabies vaccines. They are used by manufactu- rers to monitor the consistency of vaccine production and by the OMCL to assess the consistent formulation of batches of human vaccine (20), even if the NIH test is still retained for potency. At the surface of the RABV particle, the glycoprotein adopts a trimeric form (21–25). In rabies vaccine, this native trimeric form constitutes the major immu- nogen to induce VNAs (26), while the soluble or denatured glycoproteins are poorly immunogenic (27, 28). The single radial immunodiffusion test requires a pre-treat- ment which may alter the membrane-anchored trimers of the glycoprotein into soluble or denatured forms (14, 29). Hence, this test is less able to discriminate between immunogenic and non-immunogenic glycoproteins and thus less rele- Laboratory techniques in rabies Fifth edition 193 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations vant to appraise the immunogenicity of a vaccine lot. Conversely, the ELISA test is more sensitive (14), preserves the native structure of the glycoprotein, and is thus more appropriate to determine the content of the natively folded trimeric glyco- protein. Studies have demonstrated good concordance between the NIH test and the antigen content evaluated by ELISA in vaccines, concluding that ELISA methods were suitable for the in vitro potency test and advocating that such tests might partly replace or even supplement the NIH test (4, 18, 19, 30–33). The complete avoidance of animal use is an achievable objective, and the European Pharma- copoeia now recommends the use of validated serological or immunochemical assays as alternatives to the NIH test (3). Method The vaccine to be tested is incubated in a plate previously sensitized with anti-glycoprotein VNA, either polyclonal or monoclonal antibody. Bound antigens are subsequently identified by adding the same (or another) anti-glycoprotein anti- body labelled with peroxidase, which is revealed in the presence of substrate and chromogen. Comparison of absorbance measured for the tested vaccine and the reference vaccine allows the determination of the glycoprotein content. The assay is functional for both purified anti-glycoprotein polyclonal antibodies and mono- clonal antibodies concentrated with ammonium sulfate. The method to obtain and purify anti-glycoprotein polyclonal rabbit immunoglobulins G (IgG) or monoclonal mouse globulins has been extensively described in the previous edition of this manual (34), as has the method to conjugate antibodies with peroxidase (35). For the use of new reagents, such a defined and updated SOP may be available from commercial partners. The following protocol is based on an indirect ELISA sandwich immunocapture using a monoclonal antibody D1 clone (mAb-D1) which recognizes the antigenic sites III (aa 330 to 338) of the trimeric RABV glycoprotein (24, 36). This method was developed initially at the Institut Pasteur (18, 30) then optimized and validated by the Agence Nationale de Sécurité du Médicament et des produits de santé (ANSM) laboratory, i.e. the French OMCL (4, 33). The monoclonal antibody (MAb) D1 is used for both coating and detection, which allows only trimers of the glyco- protein to be to recognized, i.e. the immunogenic RABV antigen. However, the same method may be applied using different MAbs (e.g. Wistar Institute MAb 1112) recognizing different antigenic sites of the RABV glycoprotein (37). Protocol Microplate sensitization The microplate is sensitized by adding to each well 200 µL of an appropriate dilution of anti-glycoprotein purified polyclonal or semi-purified MAbs in carbo- nate buffer 50 mmol, pH=9.6. Different dilutions of antibody must be previously tested to determine the optimal concentration, as about 1 µg/well is generally required. Incubate the microplate for 3 h at 37 °C in a humidified atmosphere (or covered with a sealer sheet). Laboratory techniques in rabies Fifth edition 194 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 1. Aspirate carefully the well content, invert the microplate which is left drying on an adsorbant paper at laboratory temperature for 5 min. 2. Fill each well with 300 µL of test buffer: 0.3% bovine serum albumin (BSA), 5% sucrose dissolved in carbonate buffer 50 mmol, pH=9.6. 3. Incubate for 30 min at 37 °C. 4. Aspirate carefully the well content again, invert the plate which is left to dry on an adsorbant paper at laboratory temperature for 1 min. 5. The microplate can be immediately used or stored sealed at −20 °C until use. When the microplate is kept > 3 months, it must be tested before use. The assay 1. The sensitized plate is washed 5 times with PBS-Tween, pH7 (washing buffer). Between each washing, the microplate is inverted and dried for 1 min on adsorbant paper. 2. The first well 1A (or all wells of the line 1) receive(s) 200 µL of PBS-Tween-BSA, pH7 and serves as a blank control. 3. Distribute 200 µL of eight serial 2-fold dilutions in PBS-Tween-BSA, pH7 of the reference vaccine in duplicate in wells of the lines 2 and 3 of the microplate. The lowest dilution must have a content about 1 µg/mL of rabies virus glyco- protein. 4. Distribute 200 µL of serial 2-fold dilutions in PBS-Tween-BSA, pH7 of each vaccine sample to be tested in the remaining wells, each dilution in duplicate. 5. Cover the microplate with an adhesive film and incubate for 1 h at 37 °C. 6. Remove the film and aspirate carefully the content of each well. 7. Wash five times with PBS-Tween, pH7. 8. Distribute 200 µL of an appropriate dilution in PBS-Tween-BSA, pH7 of peroxi- dase-labelled antibodies in all wells. 9. Seal the microplate and incubate for 1 h at 37 °C. 10. Aspirate carefully the labelled antibodies, wash the microplate six times with PBS-Tween, pH7, invert and dry it for 1 min on adsorbant paper. 11. Distribute to each well 200 µL of substrate-chromogen solution. Seal the microplate and incubate in a dark at room temperature for 30 min. 12. A yellow–orange colour develops, and the reaction is stopped by adding in each well 50 µL of stopping solution (4 mol sulfuric acid). 13. Carefully wipe the bottom of the microplate and place it in a spectropho- tometer to determine the optical density at 492 nm of the negative control (blank), the reference vaccine and the tested vaccine.   Laboratory techniques in rabies Fifth edition 195 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Interpretation of the results The reference vaccine must have a well-known glycoprotein content (µg/mL); this can be determined either directly when using purified viral particles (deter- mination of total viral proteins then evaluation of the percentage of glycoprotein by SDS-polyacrylamide gel electrophoresis) or indirectly by ELISA when using a calibrated reference vaccine. This allows to design a reference curve showing the glycoprotein content in function of the optical density (OD), as seen in Fig. 44.1. The evaluation of glycoprotein content in the tested vaccine is expressed in µg/ mL by comparison to this reference curve. In the above example a vaccine diluted 1/32 which exhibits a mean OD for duplicate samples of 1.6 using MAb-D1 will content 32 x 500 ng/mL = 16 µg/mL of glycoprotein. As the reference vaccine has been previously tested for its activity expressed in international units (IU/mL), the comparison of the mean ODs allows the in vitro potency of the tested vaccine to be evaluated. The tested vaccine potency is expressed as glycoprotein content in equivalent international units (EIU/mL). Precautions • Vaccines or infected cell supernatants to be tested are often inactivated. Never- theless, samples are considered potentially infectious, and health and safety precautions must be observed as described in Chapter 3 on Biosafety. • All reagents must be adjusted to the laboratory temperature by waiting 10 min before use. • Before working, a plan for distribution and identification of samples must be established. Fig. 44.1. Reference curve showing the glycoprotein content in function of the optical density (492 nm) Laboratory techniques in rabies Fifth edition 196 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations • Reference antigen or vaccine and samples are diluted in tubes and not in the sensitized plate. • If crude infected cell supernatant is tested, a non-infected cell supernatant should be used to eliminate possible nonspecific reactions. • The quality of the results depends upon compliance with good laboratory prac- tices. The washings can be carefully carried out with an automatic washer or by distributing manually washing buffer and drying the plate after inverting it on an adsorbant paper after each washing. Discussion For more than 1003 batches of human rabies vaccine to be released in the market, the French OMCL (ANSM) has monitored the glycoprotein content using the ELISA method described above and the NIH test performed at the manufac- turer’s site (Fig. 44.2). Although no correlation has been demonstrated statistically between the two tests, mainly because of the high variability of the NIH test (hete- rogeneity in mice and challenge procedure (38), a concordance in the profile of results and the same pass or fail conclusions were obtained using in vitro and in vivo assays (4). This concordance is logical since the NIH test evaluates protec- tion of mice from an intracerebral challenge, i.e. the quantity of VNAs induced by vaccination, and the MAb D1 clone recognizes the native trimers of the glyco- protein that constitute the main RAVB immunogen (36, 39). The recognized epitope is located at the level of the antigenic site III which is not only immunodominant for the induction of VNAs but also involved in neurovirulence, pathogenicity (40–41) and receptor recognition (42). S ou rc e: re pr od uc ed w ith p er m is si on fr om re fe re nc e (4 ) IU, international units; IVRP, in vitro relative potency; NIH, National Institutes of Health Fig. 44.2. Comparison of the quantification of glycoprotein content by the ELISA method (blue line) and potency results by the NIH test (red line) for 1003 batches of human rabies vaccines Laboratory techniques in rabies Fifth edition 197 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations In summary, the in vitro ELISA method, which specifically quantifies a highly immunogenic epitope of correctly folded glycoprotein trimers, appears as efficient as the NIH test for measuring the capacity of a vaccine batch to induce VNAs that protect against a productive RABV infection. The glycoprotein quantification by ELISA thus mimics in vitro the capacity of rabies vaccine to induce humoral immu- nity. Additionally, it is able to discriminate sub-potent lots, in quality or in quantity, from potent ones (4). Before proposing that an in vitro ELISA assay measuring the immunogenic glycoprotein could replace the NIH test, it is desirable to organize an international collaborative study for its improvement and standardization. A workshop of the Interagency Coordinating Committee on the Validation of Alternative Methods (ICCVAM) entitled “International Workshop on Alternative Methods to Reduce, Refine, and Replace the Use of Animals in Vaccine Potency and Safety Testing” (Ames, September 2010) (43), concluded that the NIH test should be replaced by an alternative test showing agreement with the immune response and be able to discriminate between potent and sub-potent batches (4). During the following workshop of the European Partnership for Alternatives to Animal Testing (EPAA) in 2012 (44), it was decided that a standardized sandwich ELISA calibrated against the current international rabies reference standard would be an ideal alternative for rabies vaccine potency testing. An international colla- borative pre-validation study including both manufacturers and regulatory bodies further compared various ELISA designs used by manufacturers and their national control laboratories for batch release for their ability to discriminate sub-potent from potent batches from different vaccine brands (37). The most appropriate ELISA test remains to be formally validated under the umbrella of the European Directorate for the Quality of Medicines’ (EDQM) Biological Standardisation Programme. References 1. Seligmann EB. The NIH test for potency. In: Kaplan MM, Koprowski H editors. Laboratory techniques in rabies, 3rd edition. Geneva: World Health Organi- zation; 1973;279– 2. Recommendations for inactivated rabies vaccine for human use produced in cell substrates and embryonated eggs. In: WHO Technical Report Series, No. 941. Geneva: World Health Organization; 2007:83. 3. Rabies vaccine for human use prepared in cell cultures. European Pharma- copoeia; 04/2008:822. 4. Gibert R, Alberti M, Poirier B, Jallet C, Tordo N, Morgeaux S. A relevant in vitro ELISA test in alternative to the in vivo NIH test for human rabies vaccine batch release. Vaccine. 2013;31:6022–9. 5. Stokes W, McFarland R, Kulpa-Eddy J, Gatewood D, Levis R, Halder M, et al. Report on the international workshop on alternative methods for human and veterinary rabies vaccine testing: state of the science and planning the way forward. Biologicals. 2012;40:369–81. Laboratory techniques in rabies Fifth edition 198 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 6. Krämer B, Bruckner L, Daas A, Milne C. Collaborative study for validation of a serological potency assay for rabies vaccine (inactivated) for veterinary use. Pharmeur Bio Sci Notes. 2010;2:37–55. 7. Krämer B, Kamphuis E, Hanschmann KM, Milne C, Daas A, Duchow K. A multi-dose serological assay suitable to quantify the potency of inactivated rabies vaccines for veterinary use. Biologicals. 2013;41:400–6. 8. Fitzgerald EA, Gallagher M, Hunter WS, Seligmann EB Jr. Use of the antibody assay in immunized mice for the determination of rabies vaccine potency. Dev Biol Stand. 1978;40:183–6. 9. Milstien J, Grachev V, Padilla A, Griffiths E. WHO activities towards the three Rs in the development and control of biological products. In: Brown F, Cussler K, Hendriksen C, editors. Replacement, reduction and refinement of animal experiments in the development and control of biological products. Dev Biol Stand. 1996;31–9. 10. Behr-Gross ME, Spieser JM. Contributions of the European OMCL Network and Biological Standardisation Programme to Animal Welfare. Altex. 2006;23:21–8. 11. Directive 2010/63/EU of the European Parliament and the Council of 22 September 2010 on the protection of animals used for scientific purposes. Official Journal of European Union. 2010;L276:33–79. 12. Fitzgerald E, Green O, Seligmann E. Rabies vaccine potency testing: a comparison between the antibody-binding test and the NIH test. Symp Series Immunobiol Standard. 1974;21:300–7. 13. Barth R, Groβ-Albenhausen E, Jaeger O, Milcke L. The antibody-binding test, a useful method for quantitative determination of inactivated rabies virus antigen. J Biol Standard. 1981;9:81–9. 14. Ferguson M, Schild G. A single-radial-immunodiffusion technique for the assay of rabies glycoprotein antigen: application for the potency tests of vaccines against rabies. J Gen Virol. 1982; 59:197–201. 15. Atanasiu P, Perrin P, Delagneau JF. Use of an enzyme immunoassay with protein A for rabies antigen and antibody determination. Develop Biol Stan- dard. 1980;46:207–15. 16. van der Marel P, van Wezel A. Quantitative determination of rabies antigen by ELISA. Develop Biol Standard. 1981;50:267–75. 17. Adamovicz P, Aguillon F, David A, Le Fur R, Mazert MC, Perrin P, et al. The use of various immunochemical, biochemical and biological methods for the analysis of rabies virus production in tissue cultures. Develop Biol Standard. 1984;55:191–7. 18. Lafon M, Perrin P, Versmisse P, Sureau P. Use of monoclonal antibody for quantification of rabies vaccine glycoprotein by enzyme immunoassay. J Biol Standard. 1985;13:295–301. Laboratory techniques in rabies Fifth edition 199 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations 19. Thraenhart O, Ramakrishnan K. Standardization of an enzyme immunoassay for the in vitro potency assay of inactivated tissue culture rabies vaccines: determination of the rabies virus glycoprotein with polyclonal antisera. J Biol Standard. 1989;17:291–309. 20. Guideline for rabies vaccine. In: Official Control Authority Batch Release of Rabies Vaccines. Strasbourg: Council of Europe; 2014 (PA/PH/OMCL (11) 173 DEF; https://www.edqm.eu/en/human-ocabr-guidelines, accessed 1 October 2018). 21. Whitt MA, Buonocore L, Prehaud C, Rose JK. Membrane fusion activity, oligomerization and assembly of the rabies virus glycoprotein. Virology. 1991;185:681–8. 22. Gaudin Y, Ruigrok RW, Tuffereau C, Knossow M, Flamand A. Rabies virus glycoprotein is a trimer. Virology. 1992;187:627–32. 23. Roche S, Gaudin Y. Characterization of the equilibrium between the native and fusion-inactive conformation of rabies virus glycoprotein indicates that the fusion complex is made of several trimers. Virology. 2002;297:128–35. 24. Desmézières E, Maillard AP, Gaudin Y, Tordo N, Perrin P. Differential stability and fusion activity of Lyssavirus glycoprotein trimers. Virus Res. 2003;91:181–7. 25. Koraka P, Bosch BJ, Cox M, Chubet R, Amerongen G, Lövgren-Bengtsson K, et al. A recombinant rabies vaccine expressing the trimeric form of the glycoprotein confers enhanced immunogenicity and protection in outbred mice. Vaccine. 2014;32:4644–50. 26. Wiktor T, Gyorgy E, Schlumberger D, Sokol F, Koprowski H. Antigenic proper- ties of rabies virus components. J Immunol. 1973;110:269–76. 27. Gamoh K, Senda M, Itoh O, Muramatsu M, Hirayama N, Koike R, et al. Use of ELISA for in vitro potency test of rabies vaccines for animal use. Biologicals. 1996;24:95–101. 28. Dietzschold B, Wiktor T, Wunner W, Varrichio A. Chemical and immunological analysis of the rabies soluble glycoprotein. Virology; 1983:124:330–7. 29. Ferguson M, Seagroatt V, Schild G. A collaborative study on the use of single radial immunodiffusion for the assay of rabies virus glycoprotein. Develop Biol Standard. 1984;12:283–94. 30. Perrin P, Morgeaux S, Sureau P. In vitro rabies vaccine potency appraisal by ELISA: advantages of the immunocapture method with a neutralizing anti-glycoprotein monoclonal antibody. Biologicals. 1990;18:321–30. 31. Rooijakkers EJ, Uittenbogaard JP, Groen J, Osterhaus AD. Rabies vaccine potency control: comparison of ELISA systems for antigenicity testing. J Virol Methods. 1996;58:111–19. 32. Rooijakkers EJ, Uittenbogaard JP, Groen J, van Herwijnen J, Osterhaus AD. Development and evaluation of alternative testing methods for the in vivo NIH potency test used for the quality control of inactivated rabies vaccines. In: Brown F, Cussler K, Hendriksen C, editors. Replacement, reduction and Laboratory techniques in rabies Fifth edition 200 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations refinement of animal experiments in the development and control of biolo- gical products. Dev Biol Stand. 1996:137–45. 33. Fournier-Caruana J, Poirier B, Haond G, Jallet C, Fuchs F, Tordo N, et al. Inactivated rabies vaccine control and release: use of an ELISA method. Biologicals. 2003;31:9–16. 34. Lafon M. Techniques for the production, screening and characterisation of monoclonal antibodies. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organi- zation; 1996:133–44. 35. Perrin P. Techniques for the preparation of rabies conjugates. In: Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory techniques in rabies, 4th edition. Geneva: World Health Organization; 1996:433–44. 36. Sissoëff L, Mousli M, England P, Tuffereau C. Stable trimerization of recombi- nant rabies virus glycoprotein ectodomain is required for interaction with the p75NTR receptor. J Gen Virol. 2005;86:2543–52. 37. Morgeaux S, Poirier B, Ragan Cl, Wilkinson D, Arabin U, Guinet-Morlot F, et al. Replacement of in vivo human rabies vaccine potency testing by in vitro glycoprotein quantification using ELISA: results of an international collabora- tive study. Vaccine. 2017;35:966–71. 38. Barth R, Diderrich G, Weinmann E. NIH test, a problematic method for testing potency of inactivated rabies vaccine. Vaccine. 1988:369–77. 39. Jallet C, Jacob Y, Balhoul C, Drings A, Desmézères E, Tordo N, et al. Chimeric lyssavirus glycoproteins with increased immunological potential. J Virol. 1999;73:225–33. 40. Dietzschold B, Wunner W, Wiktor T, Lopes A, Lafon M, Smith C, et al. Charac- terization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc Natl Acad Sci USA. 1983;80:70–4. 41. Seif L, Coulon P, Rollin P, Flamand A. Rabies virulence: effect on pathoge- nicity and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J Virol. 1985;53:926–34. 42. Lafon M. Rabies virus receptors. J Neurovirol. 2005;11:82–87. doi:10.1080/13550280590900427. 43. Kulpa-Eddy J, Srinivas G, Halder M, Brown K. Alternative methods to reduce, refine, and replace the use of animals in vaccine potency and safety testing: state of the science and future directions. 14–16 September 2010, Bethesda (MD), USA. Procedia Vaccinol. 2011;5:106–19. doi:10.1016/j. provac.2011.10.007. 44. De Mattia F, Hendriksen C, Buchheit K-H, Chapsal J-M, Halder M, Lambrigts, et al. The Vaccines Consistency Approach Project: an EPAA initiative. Phar- meur Bio Sci Notes. 2015:30–56. Laboratory techniques in rabies Fifth edition 201 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Annex Buffers and reagents Coating (carbonate) buffer Sodium bicarbonate 50 mmol • NaHCO3 4.20 g • Distilled water up to 1000 mL Sodium carbonate 50 mmol • Na2CO3,10H2O 14.30 g • Distilled water up to 1000 mL Carbonate buffer 50 mmol pH=9.6 Add to the sodium bicarbonate 50 mmol, the sodium carbonate 50 mmol until the desired pH is reached. Prepare fresh as required. Other buffer • Bovine serum albumin (BSA) 0.3 g • Sucrose 5 g dissolved in 100 mL of carbonate buffer, 50 mmol pH 9.6 Phosphate buffered saline (PBS) pH=7 concentrated 10 times (PBS 10X) • NaCl 80.00 g          • KCl 2.00 g • Na2PO4,12H2O                  11.33 g            • KH2PO4 2.00 g • Distilled water up to 1000 mL Adjust pH=7 with 4N NaOH Washing buffer: PBS-Tween pH=7                                        • PBS 10X 100.0 mL • Tween 20 0.5 mL • Distilled water up to 1000 mL PBS-Tween-BSA pH=7 • PBS 10X 10.00 mL • Tween 20 0.05 mL • BSA (Fraction V) 0.50 g • Distilled water up to 100 mL Laboratory techniques in rabies Fifth edition 202 In vitro tests for rabies vaccine potency testing Part 7. Potency determinations Citrate buffer pH 5.6 for peroxidase substrate • Tri-sodium citrate, 2H2O (Na3C6H5O7, 2H20) 11.67 g • Citric acid, 1H20 2.17 g • Hydrogen peroxide 30% (110 vol) 1.00 mL • Distilled water up to 1000 mL Substrate–chromogen solution Ortho-phenylene diamine 50 mg Citrate buffer pH 5.6 25 mL Stopping solution: 4 N sulfuric acid Dilution must be carried out in an ice bath • Cooled distilled water 80.00 mL • H2SO4, 36N 10.00 mL Equipment • Class II Biosafety Safety Cabinet when use of non-inactivated infected super- natant is used • Laboratory fume hood for preparation of sulfuric acid solution • Appropriate virucidal solution • Classical laboratory equipment: refrigerated centrifuge, (multichannel) micro- pipettes • 96-well MaxiSorp flat bottom plates in clear polystyrene for immunological assays (ELISA) • Shaker/incubator for plates used at 37 °C Microplate washer • Microplate reader with multichannel absorbance reading (wavelength 492 nm) ISBN: 978-92-4-151530-6

Informations clés
Type de document Publications
Date d'adoption
Source Organisation mondiale de la santé