Organisation mondiale de la santé (OMS) · Technical Documents

The 4th Hands-on Training Workshop on the Laboratory Diagnosis of Measles and Rubella Focusing on Molecular Diagnosis, Hong Kong (China), 22-27 November 2010 : workshop report

31 décembre 2010 Organisation mondiale de la santé

Texte intégral

Training Workshop Report The 4th Regional Hands-on Training Workshop on the Laboratory Diagnosis of Measles and Rubella focusing on Molecular Diagnosis

Hong Kong (China) 22–27 November 2010

(WP)/ICP/IVD/1.1/001-A Report series number: RS/2010/GE/72(HOK) English only

REPORT THE 4TH REGIONAL HANDS-ON TRAINING WORKSHOP ON THE LABORATORY DIAGNOSIS OF MEASLES AND RUBELLA FOCUSING ON MOLECULAR DIAGNOSIS

Convened by: WORLD HEALTH ORGANIZATION REGIONAL OFFICE FOR THE WESTERN PACIFIC Hong Kong (China) 22–27 November 2010

Not for sale Printed and distributed by: World Health Organization Regional Office for the Western Pacific Manila, Philippines May 2012

NOTE The views expressed in this report are those of the participants of the Hands-on Training on the Laboratory Diagnosis of Measles and Rubella and do not necessarily reflect the policies of the World Health Organization.

This report has been prepared by the World Health Organization Regional Office for the Western Pacific for the participants of the Hands-on Training on the Laboratory Diagnosis of Measles and Rubella, which was held in Hong Kong (China) from 22 to 27 November 2010.

SUMMARY

The Hands-on Training on the Laboratory Diagnosis of Measles and Rubella in the Western Pacific Region was held at the Public Health Laboratory Centre (PHLC) in Hong Kong (China) from 22 to 27 November 2010. The training was organized by the Expanded Programme on Immunization (EPI) of the WHO Regional Office for the Western Pacific, and was hosted by the Virology Division, Centre for Health Protection, Hong Kong (China). The training was attended by 13 participants from the national measles/rubella laboratories of China, Japan, Malaysia, Mongolia, New Zealand, the Philippines, the Republic of Korea, Singapore and Viet Nam. In addition to support from the WHO Secretariat, the training was facilitated by temporary advisers from the United States Centers for Disease Control and Prevention (US CDC), Chinese Centers for Disease Control and Prevention (China CDC), and the National Institute of Infectious Diseases (NIID), Japan. The objectives of the workshop were: (1) to enhance knowledge and skills of national measles and rubella laboratory staff in: (a) molecular detection of measles and rubella viruses (RT-PCR and sequencing); (b) (2) laboratory quality assurance of measles and rubella diagnosis; and

to discuss regional data management using the new laboratory reporting format.

The hands-on training, which consisted of lectures, country reports and practical sessions, focused on understanding the needs and role of the measles/rubella laboratory network and learning and training in the use of IgM assay kits. Overall, the participants were positive in their feedback and they considered the workshop to have met its objectives and the schedule and administrative arrangements to be well organized. The workshop participants were encouraged to contact each other and the facilitators after the workshop to maintain the success of the measles/rubella laboratory network.

CONTENTS Page SUMMARY 1. INTRODUCTION ....................................................................................................... 1 1.1 1.2 1.3 Objectives ..................................................................................................... 2 Participants ................................................................................................... 2 Opening remarks........................................................................................... 3

2. PROCEEDINGS.......................................................................................................... 3 2.1 2.2 2.3 Lecture sessions ............................................................................................ 3 Country reports ............................................................................................. 4 Practical sessions .......................................................................................... 8

3. CONCLUSIONS ......................................................................................................... 8 3.1 3.2 3.3 3.4 General.......................................................................................................... 8 Workshop evaluation .................................................................................... 8 Outcomes of training .................................................................................... 8 Follow-up to the workshop........................................................................... 8

ANNEXES: ANNEX 1 - LIST OF PARTICIPANTS, TEMPORARY ADVISERS AND SECRETARIAT ANNEX 2 – TIME TABLE ANNEX 3 – LECTURES AND PRESENTATIONS ANNEX 4 – COUNTRY REPORTS ANNEX 5 – INSTRUCTIONS AND PROTOCOLS FOR THE PRACTICAL SESSIONS ANNEX 6 - PROTOCOL FOR THE WORKSHOP ANNEX 7 – INSTRUCTION FOR MEASLES MOLECULAR PROFICIENCY TEST ANNEX 8 – INSTRUCTION FOR RUBELLA MOLECULAR PROFICIENCY TEST Keywords: Measles-diagnosis/ Rubella-diagnosis/ Laboratory personnel-training/ Laboratory techniques and procedures/ molecular diagnosis/ sequencing

-1-

1. INTRODUCTION

The Region established a measles elimination goal in 2003 and set 2012 as the target year for elimination in 2005. Since then, the Regional Measles and Rubella Laboratory Network, consisting of one global specialized laboratory (GSL) and three regional reference laboratories (RRLs), has been developed, with 16 national and 362 subnational laboratories in China. The network plays a critical role in monitoring the progress of measles elimination and rubella control. It does this by confirming measles and rubella cases and providing genotyping or molecular data to understand the epidemiology of measles better. Timeliness in providing reliable laboratory data is critical to identify and respond to imported or endemic chains of measles transmission, particularly as countries approach measles elimination. Following the Global Poliomyelitis LabNet model, a WHO accreditation system for measles and rubella laboratories was developed at the global level to ensure the performance quality of network laboratories. As quality assurance measures, WHO proficiency testing and confirmatory testing programmes have been established. All network laboratories in the Region send a proportion of serum samples to network RRLs or GSLs that are accredited annually based on WHO accreditation criteria. Detection of measles or rubella immunoglobulin (IgM) in serum is the standard test for laboratory diagnosis of measles and rubella. There are several commercial IgM enzyme-linked immunosorbent assay (ELISA) kits available, many of which are used among WHO network laboratories. WHO has recommended the use of Siemens IgM kits for measles and rubella among WHO Global Network Laboratories, but other kits are also used in this and other WHO Regions. As the role of the Measles and Rubella Laboratory Network also extends to molecular surveillance, laboratories with the capacity for virus isolation, molecular diagnosis and sequencing are encouraged to perform those additional functions. Establishing baseline genetic data on measles viruses that are currently circulating in the Region will allow differentiation between importation and indigenous circulation of measles virus strains. Genotype and sequencing information are submitted to the WHO genotype and MeaNS database by national or regional laboratories. Genotype data on recent measles virus strains are available from most countries, except Pacific island countries (PICs). The Hong Kong (China) Measles/Rubella Laboratory was designated as a WHO RRL in 2007. This was to provide additional Regional support for confirming samples from other national laboratories and genotyping of measles and rubella viruses circulating in the Region. In 2009–2010, the Hong Kong (China) RRL provided excellent support in identifying genotypes of measles viruses circulating in Viet Nam, Cambodia, the Lao People's Democratic Republic, Mongolia, Macao, the Philippines and Malaysia using confirmatory serum or virus isolation samples. To strengthen the capacities of network laboratories for measles and rubella virus isolation and identification and to discuss the progress and challenges of the network, laboratory staff were invited for regional meetings or hands-on training workshops.

-2-

To improve country reporting of measles laboratory data to WHO’s Regional Office for the Western Pacific, a new case-based reporting format was developed. This has been in use since January 2008. By the end of 2010, 15 out of 17 laboratories that were supposed to send monthly laboratory data to WHO’s Western Pacific Regional Office were sharing data on a monthly basis. Laboratory data including measles genotypes identified from each country have been included in WHO’s Western Pacific Regional Office Measles and rubella bulletin since 2011. In 2009, the Third Regional Hands-on Training on the Laboratory Diagnosis of Measles and Rubella was organized at the Hong Kong RRL. This aimed to enhance laboratory capacities in priority countries in the Region. Participants included laboratory staff from Cambodia, China, Fiji, the Lao People’s Democratic Republic, Malaysia, Mongolia, the Philippines and Viet Nam. This 5-day course covered ELISA techniques using serum and dried blood spot (DBS) samples, virus isolation and molecular detection for measles and rubella. The Fourth Laboratory Hands-on Training workshop focusing on molecular detection of measles and rubella viruses was organized for 5.5 days. It aimed to enhance the genotyping capacity of national measles/rubella laboratories in the Region as a follow-up to the Third Hands-on Training. Network laboratories that could benefit from training on molecular detection and analysis were to be invited. At the end of the workshop, participants were provided with the Annual WHO Measles/Rubella Proficiency Panel samples prepared by the Victorian Infectious Diseases Reference Laboratory (VIDRL), Australia. All laboratories were requested to test these samples and report results to WHO’s Western Pacific Regional Office within 14 days of the samples being received. 1.1 (1) Objectives To enhance the knowledge and skills of national measles and rubella laboratory staff in:

(a) molecular detection of measles and rubella viruses by reverse transcription polymerase chain reaction (RT-PCR) and sequencing; and (b) (2) 1.2 laboratory quality assurance of measles and rubella diagnosis. To discuss Regional management using the new laboratory reporting format. Participants

The training session was attended by 13 participants from WHO-designated national measles/rubella laboratories in China (3), Japan (1), Malaysia (1), Mongolia (1), New Zealand (1), Philippines (2), Singapore (1), the Republic of Korea (1) and Viet Nam (Hanoi [1], Ho Chi Minh [1]). In addition to the WHO Secretariat, temporary advisers from the United States Centers for Disease Control and Prevention (US CDC), National Institute of Infectious Disease (NIID) Japan and Public Health Laboratory Centre (PHLC) Hong Kong attended as facilitators. A list of participants is included in Annex 1.

-3-

1.3

Opening remarks

Dr Wilina Lim, consultant and medical microbiologist at PHLC Hong Kong (China) welcomed the participants, opening the hands-on training workshop with an introductory speech. 2. PROCEEDINGS

2.1 2.1.1

Lecture sessions Update on Western Pacific Regional Office Measles and Rubella Laboratory Network

Dr Youngmee Jee gave a presentation on Regional progress of measles elimination, confirming that the number of measles cases in 2010 had dropped 58% in the Western Pacific Region. Measles incidence, immunization coverage, supplementary immunization activities (SIAs) and challenges to achieving measles elimination by 2012 were also presented. Updates on Regional Measles and Rubella Laboratory Network performances were provided. All GSLs and RRLs, 10/13 national labs – including Fiji but excluding three PIC labs, plus all 31 provincial labs in China – were accredited as of 22 November 2010. Results of confirmatory testing were presented and concordance rates of most laboratories were >90% in 2010. Ways of strengthening the quality of the performances of Measles/Rubella Laboratory Networks and enhancing the Regional capacity for virus isolation and genotyping were discussed. Recent measles outbreaks in the Region, including Viet Nam, the Philippines and New Zealand and increased measles activity in Cambodia, were discussed with country participants. Recommendations from the Second Laboratory Network meeting were reviewed and objectives of the training were introduced. 2.1.2 Importance of molecular epidemiology and timely reporting of genotype information

Mr David Featherstone presented the importance of molecular surveillance and how it can be used for identifying geographical origin and tracking transmission pathways of viruses. Indicators for determining measles elimination, variables of genotype/sequence database and current status of genotype and sequence database were discussed. Key messages were: (1) The timely reporting of information on sequences is critical to monitor the programme and determine elimination. (2) It is necessary to identify sequences from all outbreaks and chains of infection. (3) Timeliness of genetic information reporting will be monitored through the accreditation check-list. (4) Sequences of measles viruses can be recorded on the MeaNS database, while genotype data can be recorded on the WHO HQ database. 2.1.3 Molecular technique for measles virus detection/genotyping by RT and real-time PCR

Dr Paul Rota introduced a molecular technique for measles virus detection. He pointed out the importance, lessons learnt and limitations in virologic surveillance and virus detection. The algorithm for molecular testing and the use of conventional or real-time PCR for case classification (vaccine reaction, primary and secondary vaccine failure), molecular surveillance and how to interpret real-time RT-PCR results were explained. Reference strains of measles viruses and examples of measles virus surveillance in the United States of America were presented. A full explanation of measles genotyping kits prepared by US CDC and TaqMan realtime PCR and interpretation of results was given. Possible shipping of vial isolates on filter

-4-

papers and stability of measles RNA on fluorescent treponemal antibody (FTA) cards for one month were shown. The FTA cards could possibly make sample transportation between laboratories easy. 2.1.4 Molecular techniques for rubella virus: diagnostic and genotyping reverse transcription (RT) and real-time PCR Dr Joseph Icenogle introduced diagnostic and genotyping RT-PCR methods for rubella, and some challenges of direct sequencing of rubella virus from the sample. These were due to: (1) high guanine-cytosine (GC) content, (2) amplicon/sequence window size, (3) primer design, and (4) copy number in clinical samples. Currently available rubella genotypes from the countries concerned were presented. Genotypes 1E, 1G and 2B rubella strains are widely distributed. In this Region, genotypes 1E, 2B and 1j were detected in 2009–2010. 2.2 2.2.1 Country reports China

Dr Xu Song Tao from the Chinese Centers for Disease Control and Prevention (China CDC) presented the epidemiology of measles and rubella laboratory testing and quality control, virus surveillance and imported measles cases in China. The incidence of reported measles cases in 2009–2010 (January–October) was the lowest since the establishment of the reporting system. The monthly and age analysis of measles-positive cases shows April peaks and the highest incidence among infants under one year old. Nationwide SIAs were conducted from 11–20 September 2010. The aim was to increase rapidly the immunity level of the target population of more than 100 million, to prevent the spread of the virus and reduce its incidence. More than 80% of samples from sporadic cases and more than 95% of outbreak cases were laboratory-confirmed from January 2009 to May 2010. The Measles Laboratory Network in China tested 314 outbreak cases in 2009, and 293 were confirmed. From January to May 2010, 143 outbreaks were reported and 137 were laboratory-confirmed. Among 48 107 suspected sporadic cases in 2009, samples were collected from 39 459 cases, and 23 090 were confirmed as measles IgM-positive. Among 29 058 suspected sporadic cases from January to May 2010, samples were collected from 18 217 cases, and 12 323 were positive for IgM. For quality control, annual confirmatory testing, proficiency testing and on-site review for WHO accreditation are conducted. Each year, 10–13 provincial laboratories are assessed using the WHO measles/rubella laboratory check-list. Measles/Rubella IgM Proficiency Testing samples for 31 provincial laboratories were sent out by VIDRL, Australia. The results from 31 provincial labs were collected by China CDC and later sent to WHO and VIDRL. All provincial laboratories obtained excellent scores. On-site reviews of provincial laboratories were conducted by a WHO accreditation team and RRL. Twelve provincial labs passed on-site review/ accreditation in August 2010. The Tibet CDC Measles Laboratory passed an on-site review for the first time since WHO accreditation was initiated. The incidence of reported rubella cases increased from 2004 to 2008, but decreased in 2009. Most rubella outbreaks occurred in primary or middle schools, and more outbreaks were detected in rural schools than in cities. In terms of age distribution, the population of 5-10 year-olds had the highest incidence of measles. In 2010, from January to October, out of 40 762 reported cases, 6459 were laboratory-confirmed and the incidence rate was 3.07/100 000. In 2009, 118 rubella outbreaks were reported and 106 were laboratory-confirmed. In 2010 (from January to May), 25 outbreaks were reported and 24 were laboratory-confirmed. In addition, 25 877 sporadic rubella cases were reported in 2009; samples were collected from 8931 cases,

-5-

and 3148 were laboratory-confirmed. In 2010 (from January to May), 5723 suspected cases were reported; samples were collected from 2481 cases, and 1081 were laboratory-confirmed. In 2009 and 2010 (January–May), >89% and around 96% of rubella outbreaks respectively were laboratory-confirmed. From suspected rubella outbreak cases, 867 and 89 cases were confirmed as measles in 2009 and 2010 (January–May) respectively. A three-year WHO–Ministry of Health collaborative project on rubella and congenital rubella syndrome (CRS) surveillance was initiated in 2010. Many provincial laboratories as well as China CDC isolated measles and rubella viruses. From January–October 2010, 227 measles and 28 rubella virus strains were isolated. Measles isolates and genotyping results for 2010 were presented. In 2010, 224 H1, one D9 and one D11 strains were detected from January to October. From 1999 to October 2010, 208 rubella strains were identified, with the 1E genotype being the predominant strain, representing 85%. Rubella genotype 1E strains were isolated from 19 provinces throughout this period, while 2B strains were only detected in 2008. China CDC has trained provincial laboratories in RT-PCR, real-time PCR and RT-PCR-restriction fragment length polymorphism (RFLP). Challenges for China CDC include the integration of EPI data with laboratory data, improving collection of virus isolation samples from all chains of transmission and timeliness of shipping virus isolates from provinces. Some provincial laboratories that can sequence virus isolates by themselves also need to share their sequence results with China CDC and ship virus isolates to China CDC on a monthly basis for confirmation. 2.2.2 Japan

Dr Nakatsu Yuichiro from the National Institute of Infectious Diseases, Japan presented a measles vaccination schedule and confirmed the introduction of a newly revised reporting system for measles from 2008 and the 5- year SIA targeting teens from 2008 to 2012. Measles control strategies in Japan have included a 2-dose measles-containing vaccine (MCV) schedule. The second dose (MCV2) has been administered at age 5–6 years since 2006, in accordance with the recommended WHO Western Pacific Regional Office measles elimination strategy. With the introduction of measles SIAs from 2008, measles cases in 2009 and 2010 decreased to 741 in 2009 and around 400 in 2010, compared with 11 015 cases in 2008. The number of reported measles cases is decreasing and may drop to fewer than 500 cases/year in 2010 (<4.0/million). The reduction in measles cases in 2009 and 2010 is probably linked to the measles epidemic in 2007 and 2008 as well as to the new vaccination strategy started in 2008. The proportion of laboratory-diagnosed measles cases has gradually been increasing, from 38.2% in 2008 to 71.7% in 2010, with a dramatic national decrease in measles cases. While commercial laboratories where most measles testing is conducted are using IgM ELISA (Denka Seiken kit), public health laboratories are using RT-PCR. The problems in measles surveillance in Japan include: (1) sending samples to public health labs rather than commercial labs, and (2) differentiation of possible measles IgM false-positive cases when measles cases are deceasing, suggesting several tests should be conducted to identify false-positive cases. 2.2.3 Malaysia

Ms Wan Noraini Wan Yussof from the National Public Health Laboratory (NPHL) Malaysia presented the measles vaccination programme, national vaccination coverage and laboratory testing of measles and rubella conducted at NPHL. A vaccination schedule with single measles vaccine at six months, followed by two doses of measles/mumps/rubella (MMR) vaccine at 12 months and seven years, is used in Sabah state. Other areas have a two-dose vaccination schedule at 12 months and seven years. Reported vaccination coverage in 2008–2009 was 95%.

-6-

Three laboratories at NPHL – the Serology Lab, Virus Isolation Lab and Molecular Lab – are involved in measles serology and virus identification. Out of 2223 and 1156 suspected measles cases in 2009 and 2010, 51 cases were laboratory-confirmed in 2009 and 51 in 2010. In 2009, most cases were from Selangor and Kuala Lumpur, and in 2010 most were from Kedah and Selangor. Cases were mainly in children under seven years and the age group under one year showed the highest incidence in 2010. NPHL uses multiple testing algorithms for the laboratory diagnosis of measles/rubella for diverse epidemic situations. This laboratory tested 1176 samples in 2007, 3046 samples in 2008 and 2269 in 2009 for measles. It detected 44 measles-positive in 2007 (3.7%), 90 positive in 2008 (3%) and 56 positive in 2009 (2.5%) respectively. Nine hundred and forty-three samples in 2007, 2068 samples in 2008 and 3184 in 2009 were tested for rubella. Out of those, 468 samples were positive in 2007 (49.6%), 851 were positive in 2008 (41.2%) and 730 were positive in 2009 (13.6%) respectively. During 2007–2010, nine samples were genotyped and D9 strains (n = 6) were detected in 2008, while G3 strains were detected in 2009 (n = 1) and 2010 (n = 2). Confirmatory samples were sent to the RRL in Hong Kong in 2010, and good correlation was shown between the results from the two laboratories. Remaining challenges include collecting early virus isolation samples for genotyping. A new measles surveillance guideline is being developed. 2.2.4 Mongolia

Dr Rentsen Tuul from the National Center for Communicable Diseases in Mongolia gave a presentation on the laboratory testing algorithm and the results of IgM testing for measles and rubella from 2007 to 2010. The National Measles Laboratory uses standard enzyme immunoassay (EIA) techniques and is strengthening virus isolation and molecular detection capacities for measles and rubella. In 2007, 2030 samples were tested for measles and rubella. Only 13 were positive for measles (0.6%), while 964 were positive for rubella (47.4%). In 2008, 301 samples were tested for measles and 30 of these were positive (9.9%); 67 samples out of 279 tested for rubella were positive (24%). In 2009 and 2010 (January–October), 177 and 130 samples were tested for measles respectively. Only three were measles-positive and 11 were rubella-positive. 2.2.5 New Zealand

Mr Kevin Barratt from the Canterbury Health Laboratories in New Zealand presented laboratory testing results for measles and rubella, including serology and RT-PCR results in 2010. This laboratory uses Siemens kits for measles IgM, but uses Biomerieus for rubella IgM, measles IgG and rubella IgG. Real-time PCR and virus isolation are also performed using throat swabs, urine, blood cells and serum. In 2010, 133 and 57 samples were tested for measles and rubella IgM respectively. Five were measles-positive, six were measles-equivocal and one was rubella-positive. A total of 129 samples were tested using RT-PCR and 14 samples were positive for measles. Among those RT-PCR positives, D8 genotype strains were detected in March, April and August 2010. In Auckland, 32 measles cases were reported and five were laboratory-confirmed by LabPLUS Auckland. All cases were from a non-vaccinated family and an index case was a child returned from India. This laboratory receives external quality assurance panel samples as well as WHO Proficiency Panel samples.

-7-

2.2.6

The Philippines

Mr Rex Centeno from the Research Institute of Tropical Medicine (RITM) presented the results of laboratory diagnosis for measles and rubella and epidemiology of measles in the Philippines. In 2010, the highest number of samples (n = 2626) was referred in March and the highest number of positive samples was also detected in March (n = 785). Among 16 regions in the Philippines, the National Capital Region (NCR) showed the highest number of measles-positive cases in 2010. Children under three years had the highest incidence of measles in 2010. The incidence of measles saw a resurgence from 2007 after very low incidence during 2004–06. For internal quality control, the laboratory implemented in-house control samples for both measles and rubella IgM ELISA tests. Virus isolation was conducted for 119 samples, RT-PCR for 19 samples and immunofluorescence for 12 samples respectively in 2010. Confirmatory samples were sent to the Hong Kong RRL and results of confirmatory testing in 2010 showed good concordance. Genotyping of measles and rubella was performed at Hong Kong RRL and the genotypes detected were D9 and G3 (Region 6) for measles and 1j for rubella in 2010. 2.2.7 Republic of Korea

Ms Hee Sook Yoon from the Korea Center for Disease Control and Prevention (Korea CDC) introduced the laboratory testing methods and national laboratory data for 2008–2010. This laboratory performs not only IgM but also IgG ELISA for measles and rubella, viral isolation and RT-PCR. It also performs differential diagnosis of parvovirus B19 and HHV6 using IgM ELISA. Proficiency testing, confirmatory testing and the algorithm for testing suspected measles/rubella cases were also reviewed together with recent laboratory data. In 2008 and 2009, 22 out of 165 reported cases and 32 out of 132 reported cases tested positive for measles, while 112 out of 279 reported cases tested were positive for measles in 2010. In 2010, a measles outbreak was reported in one middle school located in Incheon metropolitan city. Among samples from 112 measles-positive cases, 96 were IgM-positive, 40 were RT-PCR-positive and virus was isolated from 18 samples. The genotyping result showed H1 strains in all cases from this outbreak. From 2008 to 2010, 23%–46% of samples were positive for HHV6 IgM and 9%–19 % for parvovirus IgM. For the quality assurance of laboratories involved in measles IgM testing, this laboratory also prepared and distributed Measles/Rubella Proficiency Panel samples for 12 provincial public health laboratories and four private diagnostic laboratories. 2.2.8 Singapore

Dr Lui Sook Yin from Singapore General Hospital’s Department of Pathology presented virological testing methods used in the laboratory. He also presented quality assurance measures including laboratory accreditation, use of in-house control and equipment monitoring and maintenance, plus the epidemiology of measles and rubella in Singapore. The number of reported measles cases has rapidly declined since the introduction of compulsory measles vaccination in August 1985. The incidence of measles has remained at a low level since 1998 since the catch-up immunization in 1997 and introduction of the two-dose MMR vaccination strategy in 1998. A national serosurvey in 2005 showed an overall seroprevalence of 96.7% for measles and 87.4% for rubella among adults of 18–74 years. It was noted that 15.8% of females of 18–44 years of age remained susceptible to rubella infection. There was no reported congenital rubella case and termination of pregnancy in 2009 due to rubella infection. During January–October 2010, this laboratory tested 159 samples for measles IgM and 701 samples for

-8-

rubella IgM. The WHO algorithm for measles and rubella testing is not followed due to a shortage of funding to support additional rubella or measles testing. From 2007 to October 2010, 24 measles strains were sequenced. D5 (2007 and 2008), D9 (2007, 2008, 2009, 2010), D4 (2008), H1 (2009 and 2010), D8 (2009) and G3 (2010) were detected. Two G3 cases in 2010 were related to travel to Indonesia. The remaining challenges for this laboratory were: (1) tests were performed based on clinicians’ requests, and (2) clinical and epidemiological information was not available for most cases. 2.2.9 Viet Nam

Ms Trieu Thi Thanh Van from the National Institute of Hygiene and Epidemiology (NIHE) presented the national measles immunization programme and laboratory testing of measles and rubella in northern Viet Nam. The country introduced two doses of measles vaccination for children of 9–11 months and six years in 2006. From 2010, the schedule of the second dose of measles vaccine changed to 18 months. From September–November 2010, a national measles vaccination campaign was conducted for children under six years old. This laboratory receives measles and rubella kits from both WHO (Siemens) and the Ministry of Health (Biorad). In 2009, 2187 (56%) out of 3890 samples tested were positive for measles IgM. In 2010, 225 (29%) out of 788 samples tested were measles IgM-positive. Out of 4050 samples tested for measles in 2009, 2315 were tested within seven days, and out of 1067 samples tested in 2010 (January–November), 930 (87%) were tested within seven days. Out of 2208 and 867 samples tested for rubella in 2009 and 2010, 545 (25%) and 389 (45%) respectively were positive for rubella. This laboratory performs virus isolation using throat swab samples. In 2009 and 2010, 23 out of 106 and one out of nine virus isolation samples were CPE-positive and confirmed by measles RT-PCR. Ms Dang Thanh Giang from the Pasteur Institute in Ho Chi Min City presented measles and rubella testing in southern Viet Nam. This laboratory performs viral isolation, IgM ELISA and RT-PCR sequencing for genotyping. Serum and throat samples are collected 4–28 days and 0–7 days after onset respectively. In 2009 and 2010, 2181 samples tested were positive for measles IgM and 877 samples tested were positive for measles IgM. Among samples tested for rubella IgM, 985 were positive in 2009 and 1523 were positive in 2010. Among measles-positive cases, 51% were 0–6 years old and among rubella-positive cases, 60% were 7–24 years old. 2.3 Practical sessions

The hands-on training session was conducted in the laboratory of the Virology Division, PHLC, Centre for Health Protection, Hong Kong (China). It included five days of practical sessions. Participants worked in six groups, and different rooms were used for different steps. Two groups shared one ABI 9700 Thermocycler for RT-PCR: (1) (2) (3) (4) (5) Group A – China (2) Group B – the Philippines (2) Group C – Viet Nam (2) Group D – Malaysia (1) and Singapore (1) Group E – the Republic of Korea (1) and New Zealand (1)

-9-

(6) (7)

Group F – Japan (1) and China (1) Group G – Mongolia (1) and Hong Kong (1)

The first day of practical sessions on 22 November 2010 included Session (1) RNA extraction of measles and rubella from infected cells. Each group was given five samples. For measles, two urine samples and one culture fluid sample, and for rubella, one urine sample and one culture fluid respectively were used. Qiagen QIAamp Viral RNA mini kits were used for extraction of RNA. Session (2): Rubella detection and genotyping RT-PCR was performed using templates provided by US CDC. Separate rooms were used for master mix preparation, adding RNA templates and handling PCR products. Qiagen One-Step RT-PCR kit and RNase inhibitor (ABI) were provided. The second day of practical sessions was in RT-PCR for measles genotyping and gel electrophoresis of rubella detection and genotyping RT-PCR, followed by PCR purification for measles and rubella. Qiagen One-Step RT-PCR kit was used for measles genotyping RT-PCR. Gel electrophoresis of RT-PCR products of rubella was conducted using 2% gels prepared and provided to participants. Gel electrophoresis for measles RT-PCR was also conducted. Qiagen QIAquick PCR Purification kit was used to purify the PCR products. Electrophoresis of post-purification products of measles and rubella was done to determine the amount of DNA templates to be added for cycle sequencing the next day. On the third day, master mix for cycle sequencing was prepared using Big Dye Terminator v3.1. Purification of cycle sequencing products was performed, followed by sequencing runs for measles and rubella. The fourth day of practical sessions focused on sequence analysis for genotyping of measles viruses. Dr Paul Rota gave a presentation on "Introduction to sequence analysis and quality control of molecular tests". He emphasized quality control for molecular tests including template quality and quantity, primer quality, reviewing of chromatogram and sequence data validation. Detailed explanations and tips were given to participants on reviewing sequence data, sequence quality control and data management. This included importing data from chromatograms, preparing alignment, determining genotypes and performing basic local alignment search tool (BLAST) search on GenBank. For laboratories without sequencing facilities, options to submit PCR products for sequencing were presented. PCR products (either purified or unpurified) can be shipped without drying and are stable for at least one month at room temperature. Precautions for working with RNA and avoiding template contamination were presented. Full explanation was given on molecular proficiency testing (PT) for measles. Genotype and sequence data reporting to WHO HQ and MeaNS was explained, followed by a practical session on using MeaNS. On the last day, a data management and reporting session discussed monthly reporting of laboratory data to WHO’s Western Pacific Regional Office using the newly revised Microsoft Access format. Genotype and sequence data submission to WHO HQ and MeaNS were also covered. Dr Joseph P. Icenogle gave a presentation on sequence analysis for rubella. This included detailed hands-on practice in sequence analysis for rubella virus genotyping, reviewing sequence data and sequence quality control. It also included importing data from chromatograms, preparation of alignment, determination of genotypes and performing BLAST search on GenBank.

- 10 -

- 11 -

3. CONCLUSIONS

3.1

General

The two main objectives of the training were fully achieved during 5.5 days of intensive hands-on practical sessions, lectures and group work. By the end of the workshop, the technical capacity and knowledge of all participants had been enhanced. They were able to understand and perform molecular detection of measles and rubella viruses by RT-PCR and sequencing and laboratory quality assurance of measles and rubella diagnosis. All participants were further familiarized with data management using the WHO measles and rubella laboratory data reporting format for reporting to the Western Pacific Regional Office. 3.2 Workshop evaluation

The participants were positive in their feedback; the workshop met its objectives. Administrative arrangements for the workshop by PHLC were excellent. A locker was allocated to everyone during the workshop and instructions to go to the laboratory or lecture room for each session were clearly given to the participants by PHLC staff. Participants were encouraged to contact each other, the facilitators and WHO’s Western Pacific Regional Office to follow up on practical issues such as quality assurance. This would include reporting of molecular PT results, in-house control samples, confirmatory testing, genotype data management and reporting, and how to strengthen the molecular detection capacities in each network laboratory. With full support from PHLC staff, the training ran smoothly throughout the practical and lecture sessions. Several PHLC staff provided full support for each group. Allocating different rooms for different procedures and moving to different rooms was well organized. The participants efficiently completed all the practical sessions and understood issues addressed during the training. Between practical sessions, calibrating micropipettes using the specific calibration programme at PHLC was demonstrated. Participants also had a chance to participate actively in calibration of micropipettes. The training schedule provided adequate time for performing practical procedures at a reasonable pace and for information sharing among the participants. The duration of each presentation also allowed adequate time for further discussion on theoretical and technical issues. 3.3 Outcomes of training

All participants were familiarized with the molecular detection of measles and rubella viruses by RT-PCR and laboratory quality assurance of measles and rubella diagnosis. By the end of the workshop, participants understood the procedures of molecular detection and data management and reporting using the new laboratory reporting format (Microsoft Access). Participants were familiarized with the requirements for reporting genotype and sequence data to WHO HQ and MeaNS. At the end of the workshop, the WHO Measles and Rubella IgM Proficiency Testing Panel samples and molecular proficiency samples for measles and rubella were distributed to participants.

- 12 -

3.4

Follow-up to the workshop

Participants were requested to report the results of IgM Proficiency Panel (PT) samples within 14 days of the samples arriving in the laboratory. Results of the molecular practice PT samples were requested to be submitted by 1 February 2011. Most laboratories that participated in the training reported results within the agreed time-frame. The results of the Measles Rubella IgM Proficiency Panel samples were received from participating network laboratories. Most laboratories used Siemens kits, and some used other kits such as Virion Serion, Haitai (China) or Denka Seiken (Japan). Results were finalized by VIDRL and feedback was immediately sent to all laboratories. All laboratories passed the WHO PT and all obtained 100% for measles, but seven laboratories obtained 95% and two 90%. The results of molecular PT samples were supposed to be received by 1 February, but some laboratories did not submit results within the agreed time-frame. As the Philippines and Malaysia did not have a DNA sequencer, the PCR products were sent to PHLC Hong Kong. Sequencing of those products was conducted at PHLC and sequence data were sent back to the two laboratories for editing and sequence analysis. After the data received from Hong Kong were further analysed by the two laboratories, they submitted dendrograms to US CDC. US CDC provided a summary of molecular PT results based on the results received from participating laboratories.

ANNEX 1

WORLD

HEALTH

ORGANISATION MONDIALE DE LA SANTE

ORGANIZATION

REGIONAL OFFICE FOR THE WESTERN PACIFIC BUREAU REGIONAL DU PACIFIQUE OCCIDENTAL

4th REGIONAL HANDS-ON TRAINING WORKSHOP ON THE LABORATORY DIAGNOSIS OF MEASLES AND RUBELLA FOCUSING ON MOLECULAR DIAGNOSIS Hong Kong, China 22-27 November 2010 ENGLISH ONLY

LIST OF PARTICIPANTS, TEMPORARY ADVISERS AND SECRETARIAT PARTICIPANTS

CHINA

Dr Chen Meng Assistant Researcher Beijing Center for Disease Control and Prevention #16 Hepiugli Zhongjie Dong Cheng District Beijing, 100013 Telephone: +86 10 64407106 Facsimile: +86 10 6447106 E-mail: chenmengx@hotmail.com Dr Du Hui Hebei Center for Disease Control and Prevention #97 East District, Huaian Road Shijiazhuang City, Hebei Province Telephone: +86311 86573409 Facsimile: +86311 86573434 E-mail: duh09hb@163.com

Dr Xu Songtao Assistant Researcher National Institute of Virology China Center for Disease Control and Prevention 155# Changbai Road, Chang Ping District Beijing 102206 Telephone: +86 10 5890 0187 Facsimile: +86 10 5890 0188 E-mail: xstlz886@sina.com

ANNEX 1

JAPAN

Dr Yuichiro Nakatsu Researcher Department of Virology III National Institute of Infectious Diseases Gakuen 4-7-1, Musashimurayama Tokyo 208-0011 Telephone: +81 425 61 0771 Facsimile: +81 425 65 3315 E-mail: ynakatsu@nih.go.jp Mdm. Wan Noraini Wan Yussof Science Officer National Public Health Laboratory Ministry of Health Malaysia Lot 1853, Kampung Melayu 47000, Sungai Buloh Selangor Telephone: +60 3 6126 1305; 60 19 354 3921 Facsimile: +60 3 6140 2249 E-mail: wnoraini66@moh.gov.my Dr Rentsen Tuul Head National Measles Laboratory National Centre for Communicable Diseases Bayanzurkh District, Nayanju Street Ulaabaatar Telephone: +976 11 9909 3674 E-mail: r_tuul@yahoo.com Mr Kevin Barratt Technical Specialist – Virology/Serology Canterbury Health Laboratories P.O. Box 151 Christchurch Telephone: +64 3 364 0354 Facsimile: +64 3 364 0238 E-mail: kevin.barratt@cdhb.govt.nz Ms Vina Arguelles Medical Technologists II Research Institute for Tropical Medicine 9002 Research Drive FCC Compound, Alabang Muntinlupa City 1781 Telephone: (632) 809 7120 Facsimile: (632) 809 7120 E-mail: vinsumins@yahoo.com

MALAYSIA

MONGOLIA

NEW ZEALAND

PHILIPPINES

ANNEX 1

PHILIPPINES

Mr Rex Centeno Science Research Specialist II Research Institute for Tropical Medicine 9002 Research Drive FCC Compound, Alabang Muntinlupa City 1781 Telephone: (632) 809 7120 Facsimile: (632) 809 7120 E-mail: rexcenteno@yahoo.com Dr Lui Sook Yin Scientific Officer Singapore General Hospital Department of Pathology #01-01B, Singapore 169608 Telephone: +63 2 65435 Facsimile: +63 2 34972 E-mail: lui.sook.yin@sgh.com.sg Ms Hee Sook Yoon Research Associator Division of Respiratory Viruses Center for Infectious Diseases National Institute of Health Korea Centers for Disease Control and Prevention 194, Tongil-lo, Eunpyung-gu Seoul 122-701 Telephone: +82 2 380 2945 Facsimile: +82 2 380 2289 E-mail: unis1010@lycos.co.kr Ms Trieu Thi Than Van Researcher National Institute of Hygiene and Epidemiology (NIHE) No. 1 Yersin Street Ha Noi

SINGAPORE

REPUBLIC OF KOREA

VIET NAM

Telephone: (844) 39726851 Facsimile: (844) 38210853 E-mail: trthvan2004@yahoo.com Ms Dang Thanh Giang Researcher Pasteur Institute 167 Pasteur Street District 03 Ho Chi Minh City Telephone: (84) 0989373176 Facsimile: (84-8) 8231419 E-mail: dtg0311@yahoo.com

ANNEX 1

TEMPORARY ADVISERS

Dr Paul Rota Chief Measles Virus Section Centers for Disease Control and Prevention Mailstop C-22, 1600 Clifton Road Atlanta, Georgia 3033 United States of America Facsimile: +404 639 4178 E-mail: par1@cdc.gov Dr Joseph Icenogle Rubella Virus Section Centers for Disease Control and Prevention Mailstop C-22, 1600 Clifton Road Atlanta, Georgia 3033 United States of America Facsimile: +404 639 4178 E-mail: jci1@cdc.gov Dr Katsuhiko Komase Head Rubella Laboratory National Institute of Infectious Diseases Toyama 1-23-1, Shinjuku-ku Tokyo 162-8640 Japan Telephone: +85 2 2319 8252 Facsimile: +81 3 5285 1356 E-mail: kkomase@nih.go.jp Dr Xu Wenbo Chief National Laboratory for Measles Institute of Viral Disease Control and Prevention China Center for Disease Control and Prevention 155# Changbai Road, Chang Ping District Beijing 102206 People's Republic of China Telephone: +86 10 5890 0187 Facsimile: +86 10 5890 0187 E-mail: wenbo_xu1@yahoo.com.cn

ANNEX 1

Dr Wei-ling Wilina Lim Consultant Medical Microbiologist Public Health Laboratory Center 9/F Public Health Laboratory Center 382 Nan Cheong Street, Shek Kip Mei Kowloon Hong Kong Telephone: +85 2 2319 8252 Facsimile: +85 2 2319 5989 E-mail: wllim@pacific.net.hk Mr Kei Sheng Gibson Woo Scientific Officer (Medical) Virology Division Public Health Laboratory Center 382 Nan Cheong Street, Shek Kip Mei Kowloon Hong Kong Telephone: +85 2 2319 8385 Facsimile: +85 2 2319 5989 E-mail: so_phls9@dh.goc.hk Mr Kwok Chu Peter Cheng Scientific Officer (Medical) Virology Division Public Health Laboratory Center 382 Nan Cheong Street, Shek Kip Mei Kowloon Hong Kong Telephone: +85 2 2319 8624 Facsimile: +85 2 2319 5989 E-mail: petercheng@dh.gov.hk

SECRETARIAT

Dr Youngmee Jee Scientist (Laboratory Virologist) Expanded Programme on Immunization World Health Organization Regional Office for the Western Pacific United Nations Avenue 1000 Manila Philippines Telephone: +63 2 528 9744 Facsimile: +63 2 526 0279 E-mail: jeey@wpro.who.int

ANNEX 1

Mr David Featherstone Scientist, Project Leader Global Measles Laboratory Network World Health Organization Headquarters in Geneva (HQ) Expanded Programme on Immunization Plus Avenue Appia 20 CH – 1211 Geneva 27 Telephone: +41 22 79 14405 Facsimile: +41 22 791 3111 E-mail: featherstoned@who.int

ANNEX 2

4th Regional Hands-on Training Workshop on the Laboratory Diagnosis of Measles and Rubella Focusing on Molecular Diagnosis 22-27 November 2010 Public Health Laboratory Centre Hong Kong (China)

Day 1, Monday, 22 November 2010 08:30 09:00 Registration Opening session • Opening remarks • Self-introduction of participants and administrative announcements

Dr Wilina Lim

Session 1: Global and regional update on measles, rubella and molecular epidemiology 09:30 Updates of Western Pacific Region's measles and rubella laboratory network and objectives of the training Importance of molecular epidemiology and timely reporting of genotype information Introduction of molecular technique for measles virus detection and genotyping by reverse transcription polymerase chain reaction (RT-PCR) and real-time RT-PCR Discussion Coffee break Introduction of molecular technique for rubella virus genotyping and RT-PCR and real-time RT-PCR Discussion and introduction to laboratory facilities Dr Joseph Icenogle Dr Youngmee Jee

09:45

Mr David Featherstone

10:00

Dr Paul Rota

10:30 10:40 11:00

11:30

ANNEX 2 12:30 Lunch break

Session 2: Practical – ribonucleic acid (RNA) extraction and RT-PCR for rubella genotyping 13:30 Practical 1: extraction of measles and rubella RNA from infected cells Coffee break Practical 2: RT-PCR for rubella detection and genotyping using templates provided by United States Centers for Disease Control (US CDC)

15:00 15:30

Day 2, Tuesday, 23 November 2010 Session 3: Practical - RT-PCR for measles genotyping and gel electrophoresis of rubella detection and genotyping RT-PCR 09:00 10:00 Practical 3: RT-PCR for measles genotyping Practical 4: gel electrophoresis of RT-PCR for rubella detection and genotyping Country reports - (China, Japan, Malaysia, Mongolia, New Zealand)

12:30

Lunch break

13:30 15:00

Practical 5: gel electrophoresis of RT-PCR for measles genotyping Coffee break

15:30

Practical 6: PCR purification of RT-PCR for measles and rubella genotyping Practical 7: gel electrophoresis of purified PCR products (measles and rubella)

16:30

ANNEX 2 Day 3, Wednesday, 24 November 2010 Session 4: Practical- Cycle sequencing, purification of cycle sequencing products and sequencing run 09:00 Practical 8: cycle sequencing Country reports - (Philippines, Korea, Singapore, Viet Nam NIHE and PI) 12:30 13:30 Lunch break Practical 9: purification of cycle sequencing products for measles and rubella Coffee break 16:00 Practical 10: sequencing run

Day 4, Thursday, 25 November 2010 Session 5: Practical - Sequence analysis for measles virus genotyping 09:00 Introduction to sequence analysis Practical 11: sequence analysis for measles virus genotyping – review sequence data, sequence quality control, import data from chromatograms, prepare alignment, determine genotype, perform basic local alignment search tool (BLAST) search on Genbank Lunch break 13:30 Practical 11: sequence analysis for measles virus genotyping (continued) Dr Paul Rota

ANNEX 2 Day 5, Friday, 26 November 2010 Session 6: Data management and reporting 09:00 Monthly laboratory data to Western Pacific Regional Office (WPRO) genotype and sequence data submission to WHO HQ and Means

Session 7: Practical: Sequence analysis for rubella virus genotyping 11:00 Practical 12: sequence analysis for rubella virus genotyping - review sequence data, sequence quality control, import data from chromatograms, prepare alignment, determine genotype, perform BLAST search on Genbank Lunch break Practical 12: sequence analysis for rubella virus genotyping (Continued)

13:30

Day 6, Saturday, 27 November 2010 09:00 10:30 12:00 Course assessment and quiz Next steps, summary of assessment and quiz Distribution of proficiency panels Closing ceremony and presentation of certificates

Rubella Virus RNA Assays: Rubella Diagnostic RT-PCR Kit (conventional RT-PCR) Rubella Virus Genotyping Kit (conventional RT-PCR, 2 Fragments) Joseph P. Icenogle Inter-country Hands-on Training on the Molecular Epidemiology of Measles and Rubella Laboratory WHO Western Pacific Region Public Health Laboratory Centre Hong Kong Cap

SEQUENCE WINDOW OF RUBELLA VIRAL RNA FOR MOLECULAR EPIDEMIOLOGY Positive strand RNA---9762 nucleotides P150 Nonstructural Proteins

P90

PolyA

Structural Proteins

6512

C 900

7412

E2 846

8258

E1 1443

9700

Increasing Variability Between Viruses

Plotsimilarity 100 nt window

601

8731 8869

9469 9469

SEQUENCE TYPICAL SEQUENCE WINDOW (739 NT) FOR REGION MOLECULAR EPI.

Basic Nomenclature for Wild-Type Rubella Viruses Basic Nomenclature for Wild-Type Rubella Viruses

Genetic characterization has identified 2 clades which differ by 8-10% at the nucleotide level. Clade 1 is divided into 10 genotypes (1a, 1B, 1C, 1D, 1E, 1F, 1G, 1h, 1i, and 1j), of which 6 are recognized and 4 are provisional (designated by lower case letters). Clade 2 contains 3 genotypes (2A, 2B, and 2C).

Structural protein coding region (3192 nucleotides) Reference viruses

Accepted Genotyping window (739 nucleotides in E1 coding region) Reference viruses

A Method for Detection of Rubella virus RNA by conventional RT-PCR • Starts with a two primer set from Bosma, et al. in Journal of Clinical Microbiology, 1995. • Produces a 185 nucleotide amplicon in the E1 protein coding region. • Sensitivity has been shown to be approximately 100 copies of RNA.

Original CDC Conventional PCR for Rubella Virus RNA Detection 739bp E1

RV11

8807 RV12

8991

RV12 Primer and Modifications • The primer RV12 binds to a region of the genome where there is variation, especially between Clade 1 and Clade 2 viruses.

Current 3 Primer Conventional PCR for Rubella Virus RNA Detection 739bp E1

RV11

• RV12:

CCA CAA GCC GCG AGC AGT CA

8807 RV12

8991

• RV12-2: CCA CGA GCC GCG AAC AGT CG

RV12-2

A modified RV12 primer was made containing the Clade 2 majority sequence.

Rubella Virus Synthetic RNA Positive Control Construct Diagnostic RT-PCR Kit

1 – Ladder 2 – Mock RNA 3 – Detection fragment 4 – Genotyping Fragment 1 5 – Genotyping Fragment 2 6 – Positive control (detection primers)

Lanes 3-5 contain products made with wild-type rubella RNA. Lane 6 contains a product made using synthetic RNA with a 30 bp Insertion.

Comparison of RT-PCR, serum IgM by 2 tests and OF IgM Analysis of specimens from 225 persons with suspected rubella 90 80 70

Percent Positive

Challenges for sequencing rubella viruses directly from sample • • • • High GC content : kit selection Amplicon/sequence window size Primer design: sequence conservation Copy number in clinical samples

60 50 40 30 20 10 0 1 2 3 4

Day of sample collection

Percent of suspected rubella cases confirmed by RT-PCR (combination of conventional and real time results) using oral fluid (•―•) serum IgM using Dade Behring (o…..o) serum IgM using Microimmune ( ) oral fluid IgM using Microimmune (∆-..-..∆ )

GC Content • Rubella virus has a high GC content – 69.6% for the whole genome – 73% for the C coding region – 71% for the E2 coding region – 66.5% for the E1 coding region

Amplicon/Sequence Window Size • Rubella sequence window is 739 nts in the E1 coding region (nts 8731-9469) • RT-PCR amplicon needs to be larger (e.g. 945 nts) to allow for primer binding sites and low quality sequence close to the primer sites • In general, the larger the amplicon, the higher the minimum copy number required for template production

• High GC content RNAs often contain stable intrinsic secondary structures that can inhibit reverse transcriptase and/or primer annealing • Q Solution

Sensitivity of 739 “sequence window size “fragments using the Qiagen kit Template is F-Therien RNA Order: Mock, 1x104, 1x103, 1x102 copies

Objective: Design a 2 Fragment System to Increase Sensitivity C 6512 945bp

E1 Poly A Tail 9762

Single large amplicon 2 overlapping amplicons

8633

9577

480bp 8633 8945 9112

633bp 9577

8656/9549 (894 bp)

8633/9577 (945 bp)

739bp Sequenced Region 3/9/10

Sensitivity of both primer sets is approximately 1000 copies of RNA.

8731

9469

2 Fragment System for Rubella Genotyping: Qiagen Kit Sensitivity Template is F-Therien RNA, 1X103 – 1x100 copies

Qiagen RT-PCRs on rubella viruses with changes in at least 1 primer binding site

1: 8633/9112 8 viruses 2: 8945/9577 6 viruses

M 3 2 1 0 8633F/9112R4 480 bp

M 3 2 1 0 8945F/9577R 633 bp All reactions were positive for both fragment 1 and fragment 2. 2/24/10

Sensitivity is approximately 100 copies of RNA for both fragments.

Rubella RNA copy numbers in 29 clinical samples Place Genotype Sample type Day of coll Copy #/2.5ul Single (945nt) Frag 1 (480nt) MI 2B TS 0 >10 Negative Negative Ghana 1G TS na >10 Negative Negative WI 2B ur 7 >10 Negative Positive Ghana 1G TS na 15 Negative Negative AZ 1G NP-2 6 20 Negative Negative MI 2B TS 4 21 Negative Negative Ghana 1G TS na 26 Negative Weak Positive MI 2B TS 1 30 nd Positive Ghana 1G TS na 34 Negative Negative ND 2B ur 2 34 Negative Positive WA 1E ur 1 47 Negative Negative Yemen 2B swab 2 49 Negative Negative WA 1E NP 1 57 Negative Positive Yemen 2B swab na 58 Negative Negative Yemen 1E swab 1 69 Negative Postitive Peru 1C oral fluid 0 86 nd Postitive Yemen 2B swab 4 88 Negative Negative MN 2B NP 1 143 Negative Positive CA 2B TS 3 mo (CRS) 267 Negative Positive Peru 1C oral fluid 0 267 nd Positive Peru 1C oral fluid 0 478 nd Positive Ghana 1G TS na 500 nd Positive Ghana 1G TS na 500 Positive Positive Peru 1C oral fluid 1 1080 nd Positive Peru 1C oral fluid 0 1250 nd Positive Yemen 1E swab 1 1686 Weak Positive Positive WI 2B NP 7 2000 Weak Positive Positive AZ 1G NP-1 1 4536 Positive Positive ME 1E TS 1 50,000 Positive Positive Frag 2(633nt) Negative Negative Negative Negative Negative Negative Negative Positive Negative Positive Negative Negative Weak Positive Negative Negative pos Negative Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive

Rubella Genotyping Procedure • Extract RNA from throat swab, oral fluid, or urine using Qiagen Viral RNA kit or equivalent • Screen for rubella RNA using real-time RT-PCR or high sensitivity conventional RT-PCR (e.g. RV11 RV12 RV12-2): 185 bp amplicon)

20% were positive for single amplicon 100% over 100 copies were positive for both smaller amplicons

Rubella Virus Synthetic RNA Positive Control Constructs

Rubella Genotyping Procedure, cont. • If either real-time or conventional RT-PCR is positive, set up 2 conventional RT-PCR reactions using primers 8633/9112 (480 bp) and 8945/9577 (633 bp). • Analyze the products on a gel and, if positive, clean the RT-PCR reactions and perform sequencing reactions.

8633 RT-PCR fragment for 739-nt window 185-nt (diagnostic RT-PCR)

8731

8812

8996

9469

9577

9762 RV E1 wt

Deletion 9093 9176 E1∆28 84 nts

8864 E1cMyc+∆28 cMyc (30 nts) 84 nts

Works with both 3’ and 5’ fragments.

E1cMyc cMyc (30 nts)

Insertion

Two Fragments for Rubella Genotyping The positive control (PC) contains a 30 nt insertion in fragment 1 and an 84 nt deletion in fragment 2

Table 1. 1a Cambodia 09 Japan 08 Kazakhstan 06

Global Distribution of Reported Rubella Genotypes#, 2005-2010@ 1B S.Africa 07,08

1C Chile05 Peru 05 Belarus05,06

1E Algeria07 Belarus 05

1G Belarus 05,06

1j Brazil 05^ Philippines 10~ Spain 05^ UK 06^ USA 10^

2B Argentina 08 Bangladesh 09 Bosnia Herz 09,10 Brazil 06,07,08,09 Chile 07 China 08 China HK SAR 08,09 Dubai 09* Egypt 07* France 09 India 05,07,08*,10* Italy 08* Japan 07^ Kazakhstan 08^* Mexico 08* Nepal 08,09,10 Russia 09^ South Africa 07,08 Spain 09 Sri Lanka 08 Sudan 06 UK 06,07,08,10 Ukraine 10 USA 07^,09^,10^ Viet Nam 06*,09 Yemen 08

2C Russia 05

China 05,06,07,08~,09,10~ China HK SAR 08,09,10 France 05~ Kazakhstan 06 Laos 09 Malaysia 05* Mongolia 10 Poland 07,08* Russia 05,06,07,08,10 South Africa 08 Sri Lanka 08 Sudan 05 Thailand 05, 09 Tunisia 08 UK 08 Ukraine 07 USA 08^ Viet Nam 07* Yemen 08

Kazakhstan 08~ Kyrgystan 09 Russia 05,06,07,08,09,10

Ghana 05,08 Côte d'Ivoire 05*,08 Kenya 05,10* Libya 09 Netherlands 05~ Russia 05*,06,08 Sudan 05 Uganda 07* UK 07 Ukraine 09

NC wt PC Fragment 1

NC wt PC Fragment 2

Genotypes 1D, 1F, 1i, and 2A were inactive during this period. @ Country(ies) and year(s) of report are indicated. ^ Probable import, but links unknown * Exported virus, importation countries are shown later.

Table 1. 1a Cambodia 09 Japan 08 Kazakhstan 06

Global Distribution of Reported Rubella Genotypes#, 2005-2010@ 1B S.Africa 07,08

Table 1. 2B Argentina 08 Bangladesh 09 Bosnia Herz 09,10 Brazil 06,07,08,09 Chile 07 China 08 China HK SAR 08,09 Dubai 09* Egypt 07* France 09 India 05,07,08*,10* Italy 08* Japan 07^ Kazakhstan 08^* Mexico 08* Nepal 08,09,10 Russia 09^ South Africa 07,08 Spain 09 Sri Lanka 08 Sudan 06 UK 06,07,08,10 Ukraine 10 USA 07^,09^,10^ Viet Nam 06*,09 Yemen 08

Global Distribution of Reported Rubella Genotypes#, 2005-2010@ 1B S.Africa 07,08

1C Chile05 Peru 05 Belarus05,06

1E Algeria07 Belarus 05

1G Belarus 05,06

1j Brazil 05^ Philippines 10~ Spain 05^ UK 06^ USA 10^

2C Russia 05

1a Cambodia 09 Japan 08 Kazakhstan 06

1C Chile05 Peru 05 Belarus05,06

1E Algeria07 Belarus 05

1G Belarus 05,06

1j Brazil 05^ Philippines 10~ Spain 05^ UK 06^ USA 10^

2C Russia 05

Kazakhstan 08~ Kyrgystan 09 Russia 05,06,07,08,09,10

Ghana 05,08 Côte d'Ivoire 05*,08 Kenya 05,10* Libya 09 Netherlands 05~ Russia 05*,06,08 Sudan 05 Uganda 07* UK 07 Ukraine 09

Genotypes 1D, 1F, 1i, and 2A were inactive during this period. 1E, 1G, and 2B, had a wide @ Country(ies) and year(s) of report are indicated. . geographic distribution and ^ Probable import, but links unknown were frequently found. * Exported virus, importation countries are shown later.

Genotypes 1D, 1F, 1i, and 2A were inactive during this period. 1a, 1B, 1C, 1h, 1j, and 2C were @ Country(ies) and year(s) of report are indicated. . reported sporadically or in ^ Probable import, but links unknown geographically restricted regions. * Exported virus, importation countries are shown later.

Rubella virus genotypes reported sporadically or in geographically restricted regions. (Probable imports with unknown links not shown)

Table 1. 1a Cambodia 09 Japan 08 Kazakhstan 06

Global Distribution of Reported Rubella Genotypes#, 2005-2010@ 1B S.Africa 07,08

1C Chile05 Peru 05 Belarus05,06

1E Algeria07 Belarus 05

1G Belarus 05,06

1j Brazil 05^ Philippines 10~ Spain 05^ UK 06^ USA 10^

2C Russia 05

China 05,06,07,08~,09,10~ China HK SAR 08,09,10 France 05~ Kazakhstan 06 Laos 09 Malaysia 05* Mongolia 10

Kazakhstan 08~ Kyrgystan 09 Russia 05,06,07,08,09,10

Ghana 05,08 Côte d'Ivoire 05*,08 Kenya 05,10* Libya 09 Netherlands 05~ Russia 05*,06,08 Sudan 05 Uganda 07* UK 07 Ukraine 09

1a 1B 1C 1h 1j 2C

Poland 07,08* Russia 05,06,07,08,10 South Africa 08 Sri Lanka 08 Sudan 05 Thailand 05, 09 Tunisia 08 UK 08 Ukraine 07 USA 08^ Viet Nam 07* Yemen 08

Ukraine 10 USA 07^,09^,10^ Viet Nam 06*,09 Yemen 08

Sample processing for RNA extraction and virus isolation

Acknowledgements CDC MMRHLB • • • • • Emily Abernathy Dr. Min-hsin Chen Dr. Ludmila Perelygina Ada Ogee-Nwanko Lijuan Hao

140 µl 0.5 ml

remainder

Store at -70 ° C Extract RNA Advantage: quick (1-2 days) Disadvantages: limited amount of RNA RT-PCR and sequencing can be difficult. Infect cells Disadvantage: slow (1-3 weeks) Advantages: unlimited amounts of RNA RT-PCR and sequencing is usually easy.

• Reference: Confirmation of Rubella within 4 Days of Rash Onset, Journal of Clinical Microbiology, 47(1), 2009.

Protocol information---Monday

a.Rubella Virus Genotyping Kit (We learned in preparing for this course that dried control RNA has instability in the Fragment 1 (5’, cmyc) region. (We are working on this!!!) i. So, we will use the Rubella Diagnostic RT-PCR Kit control for Fragment 1 ii.Positive controls 1.Fragment 1 2.USE 1ul of positive control of master stock from Diagnostic RT-PCR kit 3.Fragment 2 4.Resuspend Rubella Virus Genotyping Kit positive control in 100 ul of nuclease free-water. 5.USE 1 ul as positive control for rubella virus genotyping kit. 6.NOTE: in your home labs, you should made 10 ul aliquots and store at – 70 C. Remove 1ul from one of these aliquots. iii.Wild-type rubella virus 1.USE 5 ul of redissolved RNA (made in Rubella Diagnostic RT-PCR kit procedure).

•We will carry through the RNA from rubella virus infected cells and control 1. Templates volumes and identity are; a.Diagnostic i.5 ul negative control extracted RNA ii.5 ul virus positive extracted RNA iii.5 ul control RNA (wt-rubella RNA) from CDC iv.1 ul Diagnostic Positive control from CDC (insert) + 4 ul nuclease free water b.Sequencing Fragment 1 i.5 ul negative control extracted RNA ii.5 ul virus positive extracted RNA iii.5 ul control RNA (wt-rubella RNA) from CDC iv.1 ul of master stock from Diagnostic RT-PCR kit + 4 ul nuclease free water c.Sequencing Fragment 2 i. 5 ul negative control extracted RNA ii.5 ul positive extracted RNA iii.5 ul control RNA (wt-rubella RNA) from CDC iv.1 ul of Positive Control RNA from Sequencing kit + 4 ul nuclease free water

Updates of WPRO measles and rubella laboratory network

Outline • Regional EPI goals • Measles and rubella incidence and vaccination, challenges and plans • Achievements and Monitoring of performances of WPR measles labnet • Genotyping data in WPR • Training, meetings and plans • Objectives of the training World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Youngmee Jee (M.D. Ph.D.) Expanded Programme on Immunization Western Pacific Regional Office World Health Organization World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Regional goals • 2003: RC resolution WPR/RC54.R3: established regional goals of measles elimination, Hep B control and maintaining polio-free status – Urged Member States to “use measles elimination and hepatitis B control strategies to strengthen EPI and other public health programmes, such as prevention of congenital rubella syndrome” • 2005: RC resolution WPR/RC56.R8 established 2012 as the target date to achieve the “twin goals”: agreed by all member states – Achieve measles elimination – Reduce chronic hepatitis B infection rates to < 2% in 5 year old children as an interim milestone towards final goal of < 1% • 2010: to achieve and maintain control of rubella and prevention of congenital Rubella Syndrome in the WPR by 2015 (19th TAG) – Rubella: ≤ 10 / 1 million population, excluding imported cases – CRS: ≤ 10 / 1 million LBs, excluding imported cases World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Measles Elimination Progress Measles Drops 58% in the Western Pacific Region! Measles Down an Incredible 93% Two Years after Japan Launches Its Measles Elimination Plan! China’s SIA Intensification Yields a Decrease of 60% in Measles Cases and 64% in Deaths! Nationwide SIA in 2010 25 Countries and Areas in the Western Pacific May Already Have Eliminated Measles! WHO Announces Regional Verification Commission for Measles Elimination to be Formed! Technical Consultation on Verification of Measles Elimination World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Measles Cases, by Month, China, 20052005-2010*

Measles Incidence* Western Pacific Region, 2009 * per million population

Cumulative no. provinces conducting catch-up or follow-up (F) SIAs C F 35000

10½

16 3 98.4

26½ 5

31 26

Incidence rates (per million)

104.0 30000

25000 N um ber of cases

60% 60% 81.4 88.8 39.0

18%** 18%**

20000

15000

10000

LEGEND < 1.0 (22) 1.0 – 4.9 (6) 5.0 – 9.9 (2) 10.0 – 49.9 (3) 50.0 – 99.9 (3) World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization Source: WPRO surveillance database, 2009

5000

0 2005 2006 2007 2008 2009 2010

Total cases per year:

136,594

107,538

*Data as of 19 August 2010 **Comparison in number of cases in January-July 20010 with the same period 2009

118,031

131,441

52,461

40,198

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Measles Cases by Month Japan, 20082008-2010* 2500

Reported MCV1 and MCV2 Coverage by Country/Area, Western Pacific Region 2009 A=8 MCV1 > 95% MCV2 > 95%

SIA – 13 & 18 y

B=7 either MCV1 or MCV2 > 95%

C= 21 MCV1 < 95% MCV2 < 95% MCV1 MCV2

2000

100 90 80

number of cases

1500

Coverage (%)

94% 94% 1000

56%** 56%**

70 60 50 40 30 20

SIA - 13 & 18 y

500 *Data as of 19 August 2010 **Comparison in number of cases in January-July 20010 with the same period 2009

10 0 R U N IU TO K TO N C H N VT N H O K M A A N R U FR P N EC SI N K O M R O G W A F* JP N A U C S A M M A C TU V N EZ PH C L N M I M I A C M S* K G IR U M * VA N M SI C O K B LA FI J SO L LA O PN G SM A B

0 Jan Feb Mar Apr MayJun Jul Aug Sep Oct Nov Dec Jan FebMar Apr MayJun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr MayJun Jul

Country

Total cases By year:

2008 10,944

2009 705

2010 312

* For five countries with 2009 data not available, historic coverage data were used, including AMS (2008), WAF (2007), GUM (MCV1 in 2005, MCV2 in 2008) Source: WHO/UNICEF JRFs, 2009 World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

School-entry Immunization Requirements for Measles Western Pacific Region, 2009

Measles “Catch-Up” SIAs Western Pacific Region, 1994-2010

LEGEND: 1994 – 2002 LEGEND

2003 – 2007 School entry requirement (16) No School entry requirement but school entry check in practice (6) No school entry requirements and vaccination check (13) No data (1)

2008 2009 2010 None

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization Source: WHO/UNICEF JRFs, 2008-2009

1990-1995: measles control 1996-2002: accelerated measles control World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization 2003-2012: measles elimination Source: country SIAs reports

Rubella Vaccination History, WPR Rubella Incidence* Western Pacific Region, 2009 • • • Long standing RCV programs, protecting F & M (≥ 20 yrs) (16) • • HOK, KOR, MAC, NEZ, SIN, 11 PICs AUS, JPN, 2 PICs (COK, FIJ), possibly Brunei Darussalam

Long standing programs, protecting F (≥ 20 yrs) (5): Average incidence in 2007-2009: 2.3/million Using RCV > 10 years, protecting F and M up to 15 but < 20 years of age (4) • 4 PICs (FRP, NEC, NIU, WAF)

•

Recent introduction of RCV (no protection for F and M up to 15 yrs) (N=5) • 2 PICs (TOK, NRU), CHN, MOG, PHL Average RCV incidence Yet to introduce (N=6) in 2007-2009: 59/million

LEGEND: < 1.0 (21) 1.0 – 9.9 (8) 10.0 – 19.9 (3) 20-99.9 (4) * per million population Source: WHO-UNICEF Joint Reporting Forms (data for 2009); National surveillance data submitted to WPRO in 2009 World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

•

CAM, VTN (MCV1 > 80%) LAO, PNG, SOL, VAN World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

MR at 8 months MMR at 18-24 months

Rubella Routine Immunization Western Pacific Region, 2009 30 (83%) already use RCV

Suspected Measles Case Classification by Country Western Pacific Region, 2008 - 2010* 12,000

10,000

Suspected measles cases

8,000

6,000

4,000

2,000

Type of vaccine: 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010 2008 2009 2010

Not Offering (6) MR (7) MMR (23) World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

AUS

BRU

CAM

HOK

JPN

KOR

LAO

MAA

MAC

MOG

NEZ

PHL

PIC

PNG

SIN

VTN

Discarded

Clinically confirmed

Lab-confirmed

Epi-linked

Pending

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

* Data for January – August 2010

Challenges to Measles Elimination • Coverage and surveillance performance is not homogenously high across the countries and within countries – Low sensitivity of surveillance at sub-national levels – Accumulation of susceptibles – Large proportion of clinically confirmed cases in some countries • Obtaining accurate epidemiologic data – Incomplete case investigation data – Discrepancies between lab reports and national reports • Changing epidemiology and unexpected outbreaks – Age distribution shifting to infants and adults – Increased risk in densely populated areas • Importations within the WPR and from other regions, floating populations • Resource mobilization (funding for SIAs) and political commitment • Monitoring genotype changes • Complexity of case classification World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Plans for Measles Elimination in the Western Pacific Region by 2012 • SIAs in CHN, PHL, PNG, VTN in 2010; CAM & LAO in 2011 • Optimize routine schedules and approaches to minimize immunity gaps and maximize coverage • Strengthen epidemiologic and laboratory surveillance and communication • Engage partners and political leaders • Establish regional and national verification committees for measles elimination by early 2011 • Advocacy for high level political commitment to mobilize human and financial resources World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

EPI Laboratory Network in WPR Polio (AFP) Global specializ ed Regional referenc e 1 - NIID, Japan 2 -VIDRL, Australia - CDC, China

Measles/rubella 1 - NIID, Japan 3 - VIDRL, Australia - CDC, China - Public Health Laboratory Center, HK 16 Including 4 PIC labs in Fiji, FP, NC, Guam 31 provincial + 331 prefectural laboratories in China IgM ELISA (Siemes etc) RT-PCR Sequencing Virus culture

JE 1 NIID, Japan 2 -China CDC -Korea CDC

Rota

HPV

HBV

IBD

Total No. 3

WPR Measles and Rubella Laboratory Network

2 -Royal Children’s Hospital, Australia - Korea CDC

2 -NIID Japan - Royal Women's Hospital, Australia

VIDRL, Austral ia

Australi a - Korea CDC

+331 prefectural labs

National

Sub national

31 provincial laboratories in China Virus culture/ Neutralization, ITD PCR, sequencing Real time PCR

Some provincial labs in China(?) IgM ELISA (Panbio and in house assays) PRNT, HI RT-PCR, virus culture Ag capture ELISA and RT-PCR sequencing Molecular method Various DNA typing

393

Technique s used

Accreditation 382 laboratoires 48 labs 1 2 441

Total No.

382

b a

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

1 GSL 3 RRLs 16 National (13 fully functional) 31 provincial World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization + 331 prefectural

IgM testing Workload (except China and Japan) based on lab reports: 20062006-2010* Measles IgM 20,000 18,000

WPR Measles/rubella LabNet Updates • Accreditation status All GSL and RRLs, 10/13 national labs including Fiji excluding three PIC labs, all 31 provincial labs in China are accredited as of Nov 22, 2010 • Monthly case-based laboratory reporting Introduced in 2008, As of Nov 2010, 15/17 labs except China and Japan • Confirmatory testing in all NMLs: twice a year from 2010, concordance rates in 2009: >90%-100% • All 49 laboratories receiving WHO global PT samples passed WHO proficiency test. Most lab scored 100% (100% for 16/18+31/31=47/49 labs, 95% two labs for both measles and rubella) • Genotyping data on recent measles virus strains available from most countries except PNG, Fiji and other PICs World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Vietnam outbreak 16,000

Rubella IgM

Philippines outbreak

14,000

16,000

12,000 14,000 N o .o fs pe cim e n s

Pending/Unknown

Pending/Unknown No. of sp ecim ens 10,000

Positive 12,000

Positive Equivocal Negative

Equivocal Negative

10,000

8,000

6,000

4,000 4,000

2,000

2006

2007

2008

2009

2010*

2006

2007

2008

2009

2010*

China 2008: 96,664 samples tested for measles from sporadic cases 2009: 39,459 samples 2010; 18,217 samples (Jan-May) World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

* Data for January – October 2010

WPR Measles/rubella LabNet Updates • Regional Laboratory Training/Hands-on workshop in October 2009 for priority countries :ELISA/DBS, virus culture, molecular detection • Financial support to cover operational costs (TSA) and kits and some equipment support for the NMLs in priority countries from 2008 • China labnet – implemented excellent QA programme including PT and confirmatory testing for prefectural labs as well as for provincial labs :WHO global PT samples to 31 provincial labs from 2009 and all scored 100% – Most provincial labs perform virus isolation using Vero/SLAM cells and RT-PCR – In 2009-2010, all provincial labs implemented real time PCR for measles, rubella and mumps – Annual meetings and hands on training courses for 31 provincial labs organized by China CDC – Tibet has been on site reviewed in 2010 for the first time in 2010-> all 31 provincial labs in China has been accredited! World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Summary of 2010 Measles/Rubella Lab testing

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Confirmatory testing Measles

Genotypes

Rubella 2007: 39/45 (86.67%) 2008: 102/110 (92.72%) 2008-9: 68/70(97.1%) 2009-2010: 64/70 (91.4%) 2006: 13/14 (92.86%) 2009: 37/37(100%) 2006: 11/15 (73.33%) 2008: 72/80(90%) 2009: 48/50(96%) 2006: 9/15 (60%) 2008: 62/70 (88.57%) 2009: 72/72 (100%) 2009-2010:50/50(100%) 2009:17/20(85%)

Genotypes 2

RRL HK

Completeness and Timeliness* of Measles Lab Reporting Western Pacific Region, 2008 – 2010**

Cambodia

2007: 45/50 (90%) 2008: 77/86 (89.53%) 2008-9: 65/65 (100%) 2009-2010: 156/156(100%) 2006: 12/14 (85.71%) 2009:35/37 (90%) 2006: 14/20 (70%) 2008: 80/80(100%) 2009: 68/70(97.1%) 2006: 12/15 (80%) 2008: 75/80 (93.75%) 2009: 60/60 (100%) 2009-2010:70/70 (100%) 2009:18/20(90%) 2007: 7/15 (46.67%) 2008: 8/15(53.34%) 2009: 61/61(100%) 2009-2010: 29/31(93.5%) 2005-2006: 9/10 (90%) 2007: 17/18 (94.44%) 2008: 56/62 (90.32%) 2009: 50/50(100%) 2010: 60/60(100%) 2007: 30/30 (100%) 2009: 10/10 (100%0 2007: 56/57 (98.24%) 2008: 15/15 (100%) 2009: 9/10 (90%) 2008-2010: 65 (100%) 2009: 15/16 (93.75%) 2008: 6/6 (100%) 2007: 9/9 (100%) 2006: 7/7 (100%) 2010: 80/80(100%) 2009:29/30(96.7%) 2008: 45/45 (100%) 2007: 9/10 (90%) 2006: 3/4 (75%) 2008: /1616 (100%) 2007: 11/12 (91.67%) World Health 2008: 20/22 (95.23%) 2009:14/15(93.3%)

D9 H1

Fiji Vietnam Hanoi Vietnam HCM city PNG Laos

Australia HK 2 2 HK 2 2B 2B Australia HK 2 1 1E Australia

H1 H1

H1 D9 H1

2007: 7/8 (87.5%) 2008: 7/8 (87.5%) 2009: 62/65 (97%) 2009-2010:58/58(100%)

Malaysia

D9(2) VI samples G3(1) VI samples G3

2007: 20/20 (100%) 2008: 57/60 (95%) 2009:47/48 (98%) 2010”60/60(100%) 2007: 10/10 (100%) 2009: 10/10 (100%) 2007: 32/48 (66.67%) 2008: 15/20 (75%) 2009: 10/10% 2008-2010:82(97.6%) 2007: 7/7 (100%) 2006: 19/19 (100%)

HK Australia HK Japan HK Australia

Korea Mongolia

H1(2008 and 2009) H1, D4 D9 G3 D9,, G3

1E (2010)

New Zealand

Philippines * Deadline for submission is on the 10th of the following month ** Data for January – October 2010, as of Nov 16 2010 World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

2010:60/60(100%) 2009: 30/30(100%) 2008: 44/45 (97.78%) 2007: 8/10 (80%) 2006: 4/6 (66/67%) 2008: 35/35(100%)

1j(2) VI samples

HK Australia

Macao Singapore

D9, H1

2007: 14/21 (66.67%) HK Organization •D9(2) Western Pacific Regional Office • Expanded Programme on Immunization D4 (2), D9(1) G3(1) 2008: 42/51 (82.35%) 2009(100%)

Mongolia

H1, 1

H1 Mongolia (2008-9) B3 importation from Lybia 2009, 2010 H1

Country

Accreditati on in 2010 2007

MeaslesGenotypes 2008 2009 D5, D9, D8 D8, D4, D9, H1 H1, (D4, D9, d11) H1, (D9, D8, B3) D9, H1 2010 D5, H1, D9, D8 B3, D4,D8, H1, D9 H1, d11, D9 D9, H1, D8, B3, D5 D9 2007

RubellaGenotypes 2008 2009 2010

Monthlylab Reporting

Genotype reporting NIID receives data from prefectures

D11; 1

D9; 1 From Thailand: Sichuan

Korea H1; 1 Hong Kong H1; 5 A ; 4 D9; 1 B3; 1 D8; 1 G3, 2

D4; 1

B3; 1

Japan H1, 1 D5, 1

Japan D5, H1, D9 (2010)

China

From France: Shanxi

HK D9 (Philippines), D8, B3 (South Africa) in 2010

H1; 232

Vietnam H1. 20 Singapore H1, G3, D8, 2 3 1 D9, 8

D9, 6

Philippines

Philippines D9 strains (9)in 20092010, G3 (2) from 2009 samples

A B3 D4 D5 D8 D9 D11 H1 G3

Japan (NIID) Australia (VIDRL)

GSL

Accredited

D5 D4, D5, D8 H1 H1, D9

D5, D4 D4, D5, D8, D9, H1 H1 H1, D9

RRL

Accredited

Yes

China (CDC)

RRL

Accredited

1E 1E 2

1E 1E 1a 1E

Yes

HK (PHLC) Cambodia Fiji Korea Laos Macao

RRL NL NL NL NL NL NL NL

Accredited Pending Accredit Accredit Pending Accredit Accredit Accredit

Yes Yes (stopped &restarted ) Yes

Yes Yes (HK) Yes(Aus) Yes (starting) Yes(HK) Yes (HK) Yes (starting) Yes (HK)

H1, D5 H1 H1, D9 D9 H1 D9

B3 D9

H1 H1

Yes

Laos G3, 1 D9, 2

Cambodia H1; 1 D9; 3

D9, 9

Yes (started in 2010) Yes

Cambodia-one H1 imported from Vietnam (1)

Malaysia Mongolia

D9, G3 H1 D4, B3, H1

Yes

Malaysia

1E D8

Yes

Malaysia 2 D9 and 1 G3 (2009)

A ustralia A; 3 H1; 12 D9; 1 D4; 9

New Zealand PNG Philippines

NL NL NL

Accredit Pending Accredit

Yes Yes (started in 2010)

Partly(Aus) NA Yes(HK)

Singapore G3(1),D9(1), D8(1), H1(1) in 2009 G3(2), D9 (7), H1 (1) in 2010

D9, G3 D5, D9 H1 D4, D9 H1 H1

D9, G3 D9, D8, H1, G3 H1 H1

D9 D9, G3, H1 H1 H1

Yes

Singapore

NL NL NL NL NL NL

Accredit Accredit Accredit PT only not participating PT only

Yes

Yes Yes (HK) Yes(Hk)

New Zealand D8; 18

Vietnam, Hanoi Vietnam, HCMC French Polynesia New Caledonia Guam

2 2B

Yes Yes

H1; Genotypic Distribution of Measles 3 World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization viruses in WPR (2009-10) D4, H1, B3 and D8

D8; D4; 1 2

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Unpublished data, Not for Circulation

Summary of Virologic Surveillance and genotyping of Measles in WPR • Recent genotype information is available for most countries in the region and HK, China, Singapore, Australia and Japan share genotype information with WHO, Genotype information for other countries (Cambodia, Laos, Mongolia, Philippines, Vietnam) reported by Hong Kong RRL • Many national and China sub-national labs as well as RRL, GSL have laboratory capacities to perform PCR, sequence analysis and virus isolation • HK RRL conducted genotyping/sequencing of measles and rubella viruses using confirmatory serum samples for Vietnam, Cambodia, Laos, Philippines, Mongolia, Malaysia and Macao. • Endemic transmission of H1 strains in China and Vietnam • D9 strains detected in many countries including Malayisa, Singapore, Philippines, Cambodia and Laos in 2009-2010 • Measles outbreaks in 2009-2010: H1 from 2009-2010 outbreaks in Vietnam and D9 from 2010 outbreaks in Philippines World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Monitoring of Annual Accreditation

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

3rd Regional Hands on training for measles and rubella labs in Oct 2009 • Laboratory Hands on training course in HK China in October 2009 for priority countries – Participants from China, Cambodia, Laos, Malaysia, Mongolia, Philippines, Vietnam, Fiji – ELISA/DBS, cell culture, molecular detection of measles and rubella viruses – Facilitators from US CDC, NIID and WHO

Measles Rubella Session during 2nd VPD Labnet meeting • Two day meeting in Feb 25-26 2010 • All NML, RRL, GSL attended: participants from 17 network laboratories and National surveillance/EPI officers • Discussed how to strengthen the quality of the performances of measles/rubella laboratory networks and to enhance the regional capacity for virus isolation and genotyping

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Recommendations from 2nd Labnet meeting, 2010 Feb 3) Molecular surveillance As recommended by the Global Measles Laboratory Network Meetings (Sep 2008 and Oct 2009), laboratories are encouraged to submit representative genotype/sequence information on their measles and rubella viruses to the WHO genotype and MeaNS databases, preferably on a “real-time” basis, but at least by the end of the month in which the genotyping was completed. A copy of the information should be sent also to the regional laboratory coordinator. a. Laboratories which participated in the regional hands on laboratory training in 2009 and other sequencing laboratories, are encouraged to perform virus isolation and/or molecular detection of measles and rubella viruses to identify the genotype and obtain sequence information on circulating measles and rubella viruses. b. Efforts should be made to collect sequence data from all chains of infection, especially in those countries where no baseline sequence data exists. c. The LabNet should utilize the well validated tools and samples available for enhancing molecular surveillance where appropriate, such as; i. Oral fluid, throat swabs, urine and PBMC as samples for virus detection ii. Detection of viral RNA in archival sera iii. Standardized PCR methods including the use of a validated, unique PCR control. World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Priority indicators for components of the verification process for measles elimination in WPR: Laboratory Technical Consultation meeting for verifying measles elimination -June 2010 Criterion All WHO measles labs accredited >80% cases confirmed at WHO accredited labs >80% outbreaks with virologic and genotypic analysis 100% concurrence of lab-confirmed cases between surveillance and lab units Baseline virologic (genotype) surveillance data available Timely sharing laboratory testing data with WPRO and genotype data within 2 months with WPRO & WHO HQ Core √ √ √ √ Complementary

√ √

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Acknowledgements Plans for Labnet in 20102010-2011 • Building up further capacity for virologic surveillance in the region: Follow up Hands on training in Nov 22-27, 2010 • Encourage collection of virus isolation samples from all chains of transmission, both sporadic and outbreaks • Regular collection of measles (and rubella) genotypic information from all countries in the region by 2010 • Collection of measles virus genotype information from remaining countries: baseline genotype information using stored serum samples • Review and accreditation of 3 pending laboratories by early 2011 • Quality assurance: confirmatory testing at least twice a year • Reporting, communication, information sharing – WPRO Measles/rubella bulletin to include laboratory testing data including genotype data – Improve completeness and timeliness (10th) of case based laboratory reporting and genotype reporting for measles/rubella viruses – Meeting and training workshop World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Measles Global Specialized National Institute of Infectious Diseases, Japan Regional Reference Victorian Infectious Diseases Reference Laboratory, Australia CDC, China Public Health Laboratory Center, HK

WHO HQ David Featherstone US CDC Paul Rota US CDC Joe Icenogle Xu Wenbo and CCDC team Wilina Lim and HK PHL team WPRO EPI Measles team WHO country EPI officers

National 1. National Centre for Communicable Diseases (NCCD), Mongolia 2. National Institute of Health, Korea CDC, Republic of Korea 3. National Institute of Hygiene and Epidemiology, Hanoi, Vietnam 4. Pasteur Institute, Ho Chi Minh City, Vietnam 5. National Public Health Laboratory, Malaysia 6. National Institute of Public Health, Cambodia 7. National Center for Laboratory and Epidemiology, Laos 8. Singapore General Hospital, Singapore 9. Research Institute for Tropical Medicine, Philippines 10. Canterbury Health Laboratories, New Zealand 11. Laboratory de Saude Publica, Macao 12. Central Public Health Laboratory, PNG 13. Public Health Laboratory-Mataika House, Fiji 14. Institute Louis Malarde, French Polynesia 15. Department of Public Health and Social Sciences, Guam 16. Institute Pasteur de Nouvelle-Caledonie, New Caledonia & 31 Provincial and 331 prefectural labs in China World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Objectives of training • To enhance knowledge and skills in: (a) molecular detection and genotyping of measles and rubella viruses (RT-PCR and sequencing) (b) sequence analysis of measles and rubella viruses • To discuss the regional data management using the new laboratory reporting format and sharing and reporting genotype and sequence data World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Day 1, Monday • Session 1: Lectures on Global and regional update on measles, rubella and molecular epidemiology

Lunch • Session 2: two practicals - 1) RNA extraction and 2) RT-PCR for rubella detection and genotyping World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Day 2, Tuesday • Session 3: Practicals 1) RT-PCR for measles genotyping and 2) gel electrophoresis of rubella detection & genotyping RT-PCR 3) gel electrophoresis of RT-PCR for measles genotyping 4) PCR purification of RT-PCR for measles and rubella genotyping 5) gel electrophoresis of purified PCR products (measles and rubella) Country reports (China, Japan, Malaysia, Mongolia, New Zealand) -Can be moved to Thursday World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Day 3, Wednesday • Session 4: Practicals- Cycle sequencing, purification of cycle sequencing products and demonstration of sequencing run

Country reports (Philippines, Korea, Singapore, Viet Nam NIHE and PI)

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Day 4, Thursday • Session 5: Practical - Sequence analysis for measles virus genotyping

Day 5, Friday Session 6: Data management and reporting - Monthly laboratory data to Western Pacific Regional Office (WPRO) - Genotype and sequence data submission to WHO HQ and Means Session 7: Practical: Sequence analysis for rubella virus genotyping

Country reports

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Day 6, Saturday • Course assessment and quiz • Next steps, summary of assessment and quiz • Distribution of MR IgM ELISA proficiency test panel samples (reporting within 14 days) and filter paper proficiency test panel (reporting within 2 months) • USB with all presentation files and reference materials • Closing and presentation of certificates

Measles outbreaks and importations in 20092009-2010 Vietnam, Philippines New Zealand, Australia… Australia….

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

North

Viet Nam Measles Cases by Month 2007 – 2010* num ber of cases

2,500

Measles Cases in Viet Nam Oct 2008 – July 2010* Jan-Jun09 Jul-Dec09 Jan-Jul10

2,000

Oct-Dec08 1,500

1,000

500

0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul 2007 (N=26) 2008 (N=113) 2009 (N= 6473 ) 2010 (N= 1034 )

700 700 600 600 500 500 number of cases number of cases 400 400 300 300 200 200 100 100 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 ≥ 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 ≥40 40

Measles Cases by Age Oct 2008 – Jul 2010**

*Data as of 19 August 2010. World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization age in years age in years Source: Measles cases refer to laboratory or epi-linked confirmed cases.

South

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization * Measles cases refer to laboratory or epi-linked confirmed cases. Data as of 20 August 2010.

Measles IgM Positive Cases by Epidemiologic Week, Viet Nam, 20092009-2010* 450 400

Confirmed Measles Cases, by Week of Rash Onset (2009-2010) ORI 450 400 350

Philippines 2010*

300 n u m b er o fc a s es

250

200

150

1 dot = 1 case

100

350

300 Number of cases

250

Lab Confirmed and Epi-linked Measles Cases, by Age 950 900 850 800 750 700 650 600 550 500 450 400 350 300 250 200 150 100 50 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ≥30

200

150 Number of Cases

100

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 2009 2010

North

South

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Source: Measles-Rubella Lab Reports

* Data received as of 21 June 2010

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 2009 2010

epidemiologic week Laboratory Epi-linked Clinically

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization age in years

* Data as of 12 August 2010

Confirmed Measles Cases, by Month of Rash Onset, Philippines 2003 - 2010* 1600

Measles Cases,* by Month of Onset, New Zealand 2007 - 2010† 80 70

1400

1200

imported imported

D9 number of cases

60 number of cases 50 40 30 20

1000

Reintroduction 800 National SIA, Feb and Mar 04 (9m-7yr) 600

D9, G3 National SIA, Oct -Dec 07 (9m-4yr)

400

D9 200

10 0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr

0 J F M A M J J A S O N D J F M A M J J A S O N D J F M AM J J A S O N D J F M A M J J A S O N D J F M A M J J A S O N D J F M A M J J A S O N D J F M A M J J A S O N D J F M A M

2007 (N=7)

2008 (N=8)

2009 (N=190)

2003

2004

2005

2006

2007

2008

2009

2010

2010 (N=25)

Year and Month World Health Organization • Western Pacific Regional Office • Expanded Programme on through Immunization * Reports 2 June

Unpublished Data from MOH, New Zealand (David Wansbrough) 2010 World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

* Lab confirmed and epidemiologically linked

†

Data as of 11 June 2010

Genotyping Results of Measles viruses in 2009: New Zealand Sample Urine Throat NP Pernasal NP Nasal NP + Throat Nasal + Throat NP+Throat Nasal NP NP NP NP Urine NP TS+NP NP Nasal

Measles Virus Importation, Australia 2008-2009 Virus has entered Australia from at least 13 countries in all 6 Regions Vietnam H1, H1*

Virus No. P4325 P4504 P4811 P5943 P6601 P6645 P6695 P6808 P7084 P7168 P7178 P7292 P7364 P7377 P7435 P7816 P7820 P8053 P8106

Date 28.01.09 12.02.09 10.03.09 08.06.09 15.07.09 19.07.09 21.07.09 25.07.09 08.08.09 12.08.09 10.08.09 19.08.09 21.08.09 22.08.09 25.08.09 09.09.09 09.09.09 21.09.09 24.09.09

Genotype H1 H1 D8 D4 D4 D4 D4 D4 D4 A ND D4 A ND A ND A D4 ND

Sequence run 5/08/2009 5/08/2009 5/08/2009 5/08/2009 5/08/2009 5/08/2009 5/08/2009 5/08/2009 20/08/2009 25/08/2009 PCR Negative 25/08/2009 27/08/2009 PCR Negative 9/09/2009 PCR Negative 16/09/2009 1/10/2009 PCR Negative

Comments Dunedin outbreak Dunedin outbreak ChCh ChCh outbreak ChCh outbreak ChCh outbreak ChCh outbreak ChCh outbreak Auckland Most likely Edmonston (vaccine) strain Invercargill (unable to type) ChCh outbreak Most likely Edmonston (vaccine) strain Weak positive on Realtime PCR Most likely Edmonston (vaccine) strain Weak positive on Realtime PCR Most likely Edmonston (vaccine) strain CHCH outbreak strain Weak positive on Realtime PCR

Thailand D4, D5

Malaysia G3, D9

China Philippines D9 H1

Indonesia D9

India D8 ,D4, D4*

Iran H1

USA D8

UK D4 D8 WA

NT ?? Qld D8, H1

S. Africa D9

SA NSW D9, D5

Vic Tas

D9, D8, D4, H1

NEZ H1, D4

103 measles IgM positive cases in 2009, 19 genotyped World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization Courtesy Dr. Anja Werno and New Zealand Crown Public Health

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Measles Cases, Australia 2009* 30 New Zealand

2 India

104 cases = 4.9/million -34 importations from 13 countries in 6 WHO Regions 70 cases = 3.3/million -62 import-related cases 8 sporadic cases = 0.4/million UK Viet Nam

Measles Cases, by Month of Rash Onset and Method of Confirmation, Cambodia 2003 – 2010* Expectedsuspected suspectedmeasles measlescases: cases:>>296 296 Expected No.AFR AFRcases casesreported: reported:4,779 4,779in in2009 2009 No.

Reporting AFR cases

1 UK

2009 Phased national SIAs Dec 2000-May 2004 (9m – 14yr)

20 1 Viet Nam

Discarded measles rate: 26.4 per 100,000 population 86.5% measles cases confirmed clinically

1 New Zealand

15 24

Viet Nam Thailand

3 19 Viet Nam S. Africa Philippines

Indonesia/Kor ea

Indonesia

India

1 India France India India

0 D4 D8

Philippines

Iran

China

Unknown * Data through May

ImportedWorld cases Health Organization Import-related cases • Western Pacific Regional Office • Expanded Programme on Immunization * Data as of 11 June 2010

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

2010 Cambodia Country Month Total Number of samples received Samples tested for measles IgM Measles IgM (+) Measles IgM (-) Measles equiv ocal Sample Tested for Rubella IgM Rubella IgM (+) Rubella IgM (-) Rubella IgM equivo cal Cambodia January February March April May June July August September October November December 2350 2252 377 1950 23 2350 57 2280 13 215 398 402 230 317 261 192 236 88 11 215 398 402 230 317 261 192 138 88 11 36 23 62 69 80 37 23 32 11 4 179 375 340 161 230 221 166 194 77 7 0 0 0 0 7 3 3 10 0 0 215 398 402 230 317 261 192 236 88 11 5 10 9 2 2 6 6 3 13 1 210 388 393 228 315 255 183 229 70 9 0 0 0 0 0 0 3 4 5 1

Atypical Measles outbreak (H1) among students with high vaccination coverage in one middle school in 2010 in Incheon, Incheon, Korea 69 vaccinated out of 71 lab confirmed cases

Unpublished Data from Korea CDC World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Progress Towards Measles Elimination Western Pacific Region 2007-2010* Category Incidence (per million population) Confirmed measles cases (confirmed by lab, epidemiologic linkage or clinically) High Quality Surveillance National reporting of discarded measles cases % of districts reporting ≥ 1/100 000 discarded measles cases % of suspected cases with adequate investigation % of suspected cases with adequate blood specimens Proportion of clinically confirmed measles cases High Population Immunity National MCV1 coverage National MCV2 coverage > 95% > 95% 92% 86% 93% 88% 96% 94% NA NA > 2 per 100 000 > 80% > 80% > 80% <10% 2.5 31% 27% 65% 83% 47% 62% 48% 43% 72% 25% 27% 70% 47% 1.6 27% 2.8 43% 2.3** 31% 73.7 81.6 34.0 43.5** Target 2007 2008 2009 2010*

Technical Consultation on Verification of Measles Elimination • Recommendations from this consultation referred to the 19th TAG in Aug 2010 • TAG requested RD to seek Regional Committee endorsement of – Renewed commitments by Member States to achieve measles elimination by 2012 – Establishment of regional and national verification committees for measles elimination – Use of measles elimination activities to accelerate rubella control and CRS prevention

* Data as of 19 August 2010. ** Annualized rates Source: WPRO surveillance database World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Completeness and Timeliness of Country Reporting to the Western Pacific Regional Office, 2007-2010* 100.0% 90.0%

Recommendations from 2nd Labnet meeting, 2010 Feb 1) Data reporting Case based measles and rubella laboratory data reporting should be fully implemented in all network laboratories. Data should be reported to the regional office on a monthly basis by the 10th day of the month. The new data reporting format in MS Access discussed at the meeting should be adopted by all network laboratories. . Countries where case based reporting is not feasible should also make every effort to share aggregated data with WPRO in a format and frequency agreed upon with the regional office. 2) Confirmatory testing The confirmatory testing mechanism of serum samples established in the region should be maintained and it is recommended that national laboratories send a representative 10% of samples or a minimum of 15 samples to the designated regional reference or global specialized laboratories, at least annually but preferably twice a year. A table including a linelist of the samples and the raw data (OD readings) obtained by the national laboratory should be included with the shipment. Before sending samples, the national laboratories should notify and consult with the regional laboratory coordinator to confirm the number and selection of samples to be sent. World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

94% 85% 81% 78% 61%

80.0% 70.0% 60.0%

51% 50.0% 40.0% 30.0% 20.0% 10.0% 0.0% 2007 2008 2009 2010 2007 2008 2009 Timeliness 2010 Completeness

47%

19%

World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization •Data as of 19 August 2010. Source: WPR surveillance database

Recommendations from 2nd Labnet meeting, 2010 Feb 4) Quality assurance of commercial laboratories In countries where most measles and rubella IgM testing is performed in private/commercial laboratories, it is vital that the performance of private/commercial laboratories be monitored. Performance of these laboratories may be assessed through an external quality assurance programme and pre-existing quality assurance data should be assessed by the national laboratories, where possible. 5) Communications Laboratory and immunization/surveillance colleagues are encouraged to have regular interactions and meetings to ensure classification of suspected cases and to harmonize laboratory and surveillance data. 6) Trainings Follow-up hands on training courses focusing on molecular detection of measles and rubella viruses are encouraged in the region. World Health Organization • Western Pacific Regional Office • Expanded Programme on Immunization

Power of molecular surveillance Importance of Molecular Epidemiology and Timely Reporting of Genotype Information The 4th Regional HandsHands-On Training Workshop On The Laboratory Diagnosis Of Measles And Rubella Focusing On Molecular Diagnosis 22 to 27 November 2010 Public Health Laboratory Centre, Hong Kong (China) David Featherstone EPI / IVB WHO/HQ

Sequence information, in combination with epidemiological data can: – Allow mapping of transmission pathways – Identify possible source of virus and determine whether it is indigenous or from an imported source – Determine whether suspected case due to vaccine or wild virus – Assist with confirmation of true positives – Improve diagnostic resolution in first few days after rash onset in combination with IgM (especially for rubella) WHO Vaccine Preventable Disease Lab Network

WHO Vaccine Preventable Disease Lab Network

Capacity for Molecular testing increasing Molecular capacity has become accessible to more labs – National and even some subsub-national labs have PCR equipm't – RealReal-time and conventional PCR

Identifying the geographical origin and tracing the transmission pathways of a virus Building comprehensive knowledge of global distribution of virus molecular data – Source of virus in new outbreaks may be determined

Specific training workshops focusing on molecular techniques held in all WHO regions Kit based RTRT-PCR systems increase ease of use Oral fluid samples may permit detection of measles and rubella RNA up to several weeks after disease onset WHO Vaccine Preventable Disease Lab Network

Sequence information alone may not be sufficient to identify source or transmission pathways – Epidemiological investigations can also identify possible source of origin and/or transmission pathways

Combination of epidemiological and molecular data ideal – Outbreak investigation with comprehensive laboratory analysis WHO Vaccine Preventable Disease Lab Network

Measles D4 (Enfield strain) distribution March 2007 – June 2010 As of 23 July 2010

(Stars may not represent exact location of the case) Aug 07 Dec 08 (MA)

Indicators for determining Elimination* DEFINITIONS: Measles eradication. Worldwide interruption of measles transmission in the presence of a verified, wellwellperforming surveillance system. system. Measles elimination. The absence of endemic measles transmission in a defined geographical area (e.g. region) for a period of at least 12 months or more, in the presence of a wellwell-performing surveillance system. system. Endemic measles transmission. transmission. The existence of continuous transmission of indigenous or imported measles virus that persists for a period of 12 months or more in any defined geographical area. * WER 3 Dec 2010

Jun 08 (CA) Jan 09 (CA) Nov 07 Feb 08 Apr 08 x3 Dec 08

Mar 07June10 Oct 08

Apr 07 Jan 08 Feb 08

Jun-Jul 08 Aug 08

Mar-May 08

Aug 08

XX 08 (JAM) Dec 08 (IL)

May 2010 Acknowledgements: WHO Measles LabNet esp HPA, Lux, RKI & CDC Measles Surveillance Programmes The boundaries and names shown and the designations used on this map do not imply the expression of any opinion whatsoever on the part of the World Health Organization concerning the legal status of any country, territory, city or area or of its authorities, or concerning the delimitation of its frontiers or boundaries. Dotted lines on maps represent approximate border lines for which there may not yet be full agreement.  WHO 2008. All rights reserved

Indicators for determining Elimination ReRe-establishment of Re-establishment of endemic transmission. transmission. Reendemic measles transmission is a situation in which epidemiological and laboratory evidence indicates the presence of a chain of transmission of a virus strain2 that continues uninterrupted for a period of twelve months or more in a defined geographical area where measles was previously eliminated. goal. . When Measles outbreak in countries with an elimination goal two or more confirmed cases are temporallytemporally-related (with 77-21 days between dates of rash onset), and are epidemiologically and/or virologically linked. linked. A measles imported case. Is a case exposed outside the region/country during the 7 to 21 days prior to rash onset, as supported by epidemiological and/or virological evidence. 2

Rationale behind development of genotype/sequence databases Labs with sequence data not always aware of importance of sharing with surveillance programme – Data sometimes released months or years after sample collected – Data sometimes kept until publication finalized – Countries and regions at different stages of control/elimination Elimination countries need to know whether cases detected are due to imported or indigenous virus ASAP Control countries need to know their baseline sequence data

Viruses with N gene (450) sequences that are at least 99.7% identical identical (1 nt change)

– Centralised databases will allow ready access to all reported viruses WHO Vaccine Preventable Disease Lab Network

Decision to develop database for Sequences/Genotypes 2006 WHO Genotype Database Genotype and epi data GenBank access No. Restricted Access 2008 MeaNS Sequence Database (HPA) GenBank

Databases Decision for two databases at 2006 Global meeting: – Genotype database WHO database – Simple, Excel based – Sequence database MeaNS

Sequence and epi Sequence data data

Issues – Accessibility to sequence database – Accessibility to nonnon-public domain sequence data – Frequency of updating data More timely = more useful for programmatic application, Preferably real time access

Restricted Access

Open Access

WHO Vaccine Preventable Disease Lab Network

Variables for WHO Genotype Database ISO country code and country name Date of case: (month, year) WHO name of virus: e.g. MVi/Guizhou.CHN/47.09/1[H1] Genotype Epi link (if known) Submission data (who, when) GenBank accession number –access to sequence data

WHO Vaccine Preventable Disease Lab Network

Viruses contributed to WHO database or GenBank

WHO Global genotype database: Current Status Viruses submitted dating from 1954 to 2010 WHO region EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR EMR ISO3_countryCode AFG DJI EGY IRN IRQ JOR BHR KW T LBN LBY MAR OMN PAK QAT SAU SOM SDN SYR TUN ARE YEM Country Name Afghanistan Djibouti Egypt Iran (Islamic Republic of) Iraq Jordan Kingdom of Bahrain Kuwait Lebanon Libyan Arab Jamahiriya Morocco Oman Pakistan Qatar Saudi Arabia Somalia Sudan Syrian Arab Republic Tunisia United Arab Emirates Yemen

Data as of 21 Nov 2010

Number of viruses

Genotypes

Countries

WHO Regions

Proportion with GenBank entries

Measles Rubella

8553 749

23 11

118 40

6 6

37% 36%

18 18

WHO Vaccine Preventable Disease Lab Network

Measles Viruses by Year of Detection 19991999-2010 1600

As of Sept 2010 57* * = No. of countries 124 Countries in total

1400

1200

55 53

No. of viruses submitted

1000

800

600

30 39 29 23 26

400

200

18 14

0 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010

Year of Virus Detection 19 19

WHO Vaccine Preventable Disease Lab Network

20 20

WHO Vaccine Preventable Disease Lab Network

WPR Country Submissions to Measles Databases Country Name Australia Cambodia China China, Hong Kong SAR China, Macao SAR Japan Lao Malaysia Marshall Islands Mongolia New Zealand Palau Papua New Guinea Philippines Republic of Korea Singapore Viet Nam Grand Total 8 8 6 11 6 1 63 29 286 13 39 90 5 16 2 2 2 1 16 4 16 15 6 37 2 33 791 9 15 2 1 8 38 176 2 1 6 6 1 B3 7 C1 C2 6 D1 11 d11 D2 1 D3 3 D4 26 D5 24 72 8 1 1 D7 12 D8 35 D9 19 3 5 2 2 12 8 7 1 3 2 4 3 G2 2 G3 5 H1 33 1 1986 97 2 22 3 5 H2 1

Grand Total 187 76 2032 101 4 264 11 8 3 2 5 2 16 22 39 27 42 2841

Countries With No Measles Genotype Information Reported Region WPR WPR WPR WPR WPR WPR WPR WPR WPR WPR WPR WPR

No Report Brunei Darussalam Cook Islands Fiji Kiribati Micronesia (Federated States of) Nauru Niue Samoa Solomon Islands Tonga Tuvalu Vanuatu

Sequence Info but no Report

Laboratory confirmed cases 2010 2 NR 4 NR NR NR NR NR NR NR NR NR

21 21

22 22

WHO Vaccine Preventable Disease Lab Network

MeaNS Measles Sequence Database

Current status of database Data manually submitted or automatic downloads from GenBank • N - 450 – 4900 sequences • N – full – 5 sequence • H – full – 486 sequences

Ability to sort if large number of identical hits

Mapping feature – not available/working

Submission to GenBank - 450 or 456 nt all fields automatically filled for you (you can edit if wish) e-mail confirmation etc sent to you (not MeaNS)

MeaNS database http://www.who-measles.org – live

Practice site – for meeting http://www.hpa-bioinformatics.org.uk/gnani/Measles/Public/Web_Front/main.php

User name: labnet1……labnet10 Password: labnet99 Acknowledgments: Richard Myers, S (Gnani) Gnaneshan, Jon Green, David Brown, All those who have submitted data

Recommendations from Global LabNet Meeting 2010 Timely submission of sequences to MeaNS allows all reporting criteria to be met in one action as these data are automatically submitted to the WHO database and optionally to GenBank. MeaNS also assists with characterization and QC of the virus sequence. At a minimum, measles virus genotypes are to be submitted to the WHO database, either through MeaNS or directly. For all rubella virus genetic information, the WHO database should be used with sequence data preferably also submitted to GenBank.

Summary & Recommendations Reporting of timely sequence information critical for programme monitoring and determining elimination Need to identify sequences from all outbreaks and chains of infection Timeliness of genetic information reporting monitored through Accreditation checklist Recommended that measles viruses are deposited in MeaNS database (with sequence) Rubella viruses should continue to be deposited in WHO database

WHO Vaccine Preventable Disease Lab Network

Acknowledgements HPA and CDC All labs who have contributed timely data Youngmee Jee Jee for following up on labs

Thank You !!

WHO Vaccine Preventable Disease Lab Network

Day 1, 22 November Grouping arrangement for practicals Group A (China x 2) Group B (Philippines x 2) Group C (Vietnam x 2) Group D (Malaysia & Singapore) Group E (Korea & New Zealand) Group F (Japan & China) Group G (Mongolia & Hong Kong)

Practical: RNA extraction for measles and rubella Each group will be given 5 samples Measles: 2 urine samples and 1 culture fluid Rubella: 1 urine sample and 1 culture fluid

Qiagen QIAamp Viral RNA Mini kit Reconstitute carrier RNA with buffer AVE (310µl) Prepare buffer AVL by adding reconstituted carrier RNA (100µl reconstituted carrier RNA to 10ml buffer AVL-provided) Absolute ethanol and buffers AW1 & AW2 (with ethanol added), 1.5ml snap cap vials (caps cut away by scissors) will be provided

Participants will take turns to add samples to buffer AVL in safety cabinet (Rooms 906 & 907)-white gown Subsequent extraction steps will be performed in Room 907

After elution, keep RNA on ice and go to Room 809 Take off white gown before leaving Room 809

Practical: Rubella detection & genotyping RT-PCR Separate rooms will be used Room 811: Master mix preparation (blue gown) Room 809: RNA template addition (white gown) Room 817: PCR product handling (yellow gown)

Participants will take turns to prepare master mix in safety cabinet or PCR workstation in Room 811-blue gown Qiagen One-Step RT-PCR kit + RNase inhibitor (ABI) Primers in working concentration (20µM) will be provided 3 sets of PCR Rubella detection: 3 primers (RV11, RV12 & RV12-2) Rubella genotyping: 2 sets of primers (8633F & 9112R; 8945F & 9577R) RNA samples to be tested: 2 extracted RNA + 1 wild type RNA from CDC; all three add 5µl to PCR tubes

Keep PCR master mixes on ice and move to Room 809 Take off blue gown before leaving Room 811 Put on white gown in Room 809 Three rubella RNA controls will be provided for Detection RT-PCR: add 1 µl to PCR tube Genotyping fragment 1 RT-PCR: add 1 µl to PCR tube Genotyping fragment 2 RT-PCR: add 1 µl to PCR tube

Day 2, 23 November Practical: Measles genotyping RT-PCR Take turns to prepare master mix in Room 811-blue gown Qiagen One-Step RT-PCR kit + RNase inhibitor (ABI) Primers in working concentration (20µM) will be provided Two primers (MeV216 and MeV214)

Keep the PCR tubes on ice Carry the PCR tubes to Room 817 Take off white gown before leaving Room 809 Two groups will share one ABI 9700 thermal cycler Both detection and genotyping RT-PCR share the same PCR conditions

Keep PCR master mix on ice Take off blue gown before leaving Room 811 Put on another blue gown in Room 809 Measles control RNA will be provided: add 1µl Keep the PCR tubes on ice Take off blue gown before leaving Room 809 Put on yellow gown in Room 817 Two groups will share one ABI 9700 thermal cycler

Practical: Gel electrophoresis for rubella RT-PCR 2% gels will be provided (one gel tank per group) 96-well plate for mixing samples and loading dye Samples: 2µl 6X loading dye + 5µl samples Marker: 2µl 6X loading dye + 2µl 123bp ladder + 8µl 1X TBE

Practical: PCR purification for measles & rubella Qiagen QIAquick PCR Purification kit Buffer PE (with ethanol added) and 1.5ml snap cap vials (caps cut away by scissors) will be provided Purify all positive samples, including wild type RNA from CDC

Load mixtures to the gel (Remember the sample order!) Power supply will be shared (140V, 25-30min) Avoid taking things into & out of Room 817 Take off yellow gown and wash hands before leaving Room 817

Put on yellow gown in Room 817 Avoid taking things into & out of Room 817 Take off yellow gown and wash hands before leaving Room 817

Practical: Gel electrophoresis of purified PCR products

Practical: Gel electrophoresis for measles RT-PCR Similar to gel electrophoresis for rubella RT-PCR

Similar to previous gel electrophoreses Determine amount of DNA templates to be added for cycle sequencing the next day

Day 3, 24 November Practical: Cycle sequencing Prepare cycle sequencing master mix in Room 811 BigDye Terminator v3.1, sequencing primers (3.2µM) and water will be provided Keep cycle sequencing mix on ice Add the sequencing primers in Room 817 Two groups will share one ABI 9700 thermal cycler Avoid taking things into & out of Room 817

Practical: Purification of cycle sequencing products Qiagen DyeEx 2.0 Spin kit Put on yellow gown in Room 817 Speedvac (~1hr) BigDye + 5X sequencing buffer + H2O

1. Prepare cycle sequencing master mix

2. Aliquot 18µl into 0.2ml PCR tubes

Practical: Sequencing run Fill in sample ID in worksheet and computer of sequencers Add Hi-Di formamide in safety cabinet (Rooms 839 & 840) Separate sequencers will be used for measles and rubella ……

3. Add 1µl of sequencing primer to each tube according to worksheet

……

…… 4. Add 1µl of corresponding purified PCR product to each tube

……

4th REGIONAL HANDSHANDS-ON TRAINING WORKSHOP ON THE LABORATORY DIAGNOSIS OF MEASLES AND RUBELLA FOCUSING ON MOLECULAR DIAGNOSIS Public Health Laboratory Centre, Hong Kong (China) 22 to 27 November 2010

Introduction to Molecular Techniques for Detection of Measles Virus and Genotyping by RTRT-PCR and RealReal-Time RTRT-PCR

Paul A. Rota, Ph.D. Measles, Mumps, Rubella and Herpes Viruses Laboratory Branch Division of Viral Diseases, DEPARTMENT OF HEALTH AND HUMAN SERVICES CENTERS FOR DISEASE CONTROL AND PREVENTION

Importance of Virologic Surveillance and Viral Detection Molecular techniques can provide a valuable tool to: • Differentiate between ongoing transmission of endemic virus from new, imported source of virus • Aid in the classification of unusual or severe cases • Confirm suspected vaccine reactions • Molecular techniques have an increasing roles case confirmation especially in low incidence settings and/or when serologic results are difficult to interpret

Lessons Learned from Nearly 20 Years of Virologic Surveillance for Measles VirusVirus-1 •Molecular epidemiologic studies are a key component of verification of measles elimination •One indicator for verification of elimination will be absence of an endemic genotype for one year •Genetic data can be used to track transmission patterns and identify sources of infection •There is rapid global transmission of measles viruses. For example, viruses associated with outbreaks in Africa are soon detected in association with imported cases in the Americas •It is impossible to predict how/when a virus will spread from an endemic area to other parts of the world •Vaccination programs frequently interrupt transmission of measles lineages, but reintroduction of measles is a problem (sometimes with an apparent switch in genotype)

Lessons Learned from Nearly 20 Years of Virologic Surveillance for Measles VirusVirus-2 Transmission patterns •All measles vaccines are in genotype A •Vaccination has been effective globally despite the presence of different endemic genotypes (provided the vaccine is administered properly) •Molecular epidemiolgic data clearly show that it is possible to maintain elimination of measles transmission despite constant importation of multiple genotypes of virus •Sporadic cases and small outbreaks will continue to occur depending on the distribution of susceptible individuals •Rapid confirmation of vaccine reactions (through molecular techniques) is important in elimination settings in cases where there was vaccination in response to a recent exposure or potential exposure

•Endemic: Multiple transmission pathways lead to multiple lineages within endemic genotype(s) •Elimination: Few cases and multiple imported genotypes with no endemic genotype •Reintroduction: Rapid spread of genetically homogenous viruses

What Virologic Surveillance Data Tell Us About Measles Transmission Patterns

Limitations of Virologic Surveillance •Endemic transmission of measles: Multiple transmission pathways lead to multiple lineages within endemic genotype(s) •Example: China

•Molecular studies can confirm independent sources of infection if different genotypes or clearly distinct lineages are detected.

•Elimination of measles: Few cases and multiple imported genotypes with no endemic genotype •Examples: Western Hemisphere, Australia, New Zealand, Hong Kong

•Molecular studies alone cannot differentiate between continuous circulation of virus and multiple introductions from the same source.

•Reintroduction following interruption: Rapid spread of genetically homogenous viruses •Example: Burkina Faso, Philippines

•Therefore, it is extremely important to conduct high quality case investigations and to classify cases after all of the epidemiologic and laboratory data have been reviewed.

Global Status of Laboratory Support Virologic Surveillance for WildWild-type Measles Viruses •All regions and most countries have conducted baseline virologic surveillance for measles •Most Regional Reference Labs in the WHO LabNet are capable of PCR and sequence analysis •Most LabNet labs use Vero/hSLAM for isolation •PCR and viral isolation are included in all WHO intercountry training courses •Timely reporting of sequence information (within 2 months) is an accreditation requirement in all regions •Two global databases have been established •WHO (genotypes only) •HPA-MeaNS (approaching 8000 sequences) enable almost real time analysis

Requirements for Virologic SurveillanceSurveillance-1 •Testing should be performed in an accredited laboratory •In a pre or post elimination settings, the goal is to obtain genetic information from every chain of transmission •This can be difficult with sporadic cases, usually because of failure to collect adequate samples in a timely manner •Typically, there is greater success with obtaining adequate samples from outbreaks •Specimens must be taken at first contact with suspected case •Good specimens for virus detection or virus isolation: throat swab, nasal wash or aspirate, oral fluid, white blood cells (not recommended for safety reasons) • Other samples in which viral RNA can be detected at lower frequencies: dried blood spots, IgM positive serum

Standard Methods for Measles Molecular Epidemiology of Measles Requirements for Virologic SurveillanceSurveillance-2 •An important pre-requisite is to conduct baseline virologic surveillance in all countries to document endemic genotype(s) that are present before the accelerated control measures required for elimination are initiated •Testing archival samples may be useful if these specimens are available

P/C/V

RT-PCR and Sequence targets: •N and H genes are the most variable regions on the measles genome. •Amplify and sequence the 450 nt. Coding for the COOH terminal 150 amino acids of the N protein from all specimens (Minimum amount of sequence needed for reporting genotype). •Amplify and sequence the entire coding region of the H gene from selected isolates

WHO Measles Reference Sequences and Accession Numbers Genotype A B1 B2 B3 C1 C2 D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 d11 E F G1 G2 G3 H1 H2 Status Active Inactive Active Active Active Active Inactive Active Active Active Active Active Active Active Active Active Active Inactive Inactive Inactive Active Active Active Active Reference strains (MVi) Edmonston-wt.USA/54 Yaounde.CAE/12.83 “Y-14” Libreville.GAB/84 “R-96” New York.USA/94 Tokyo.JPN/84/K Maryland.USA/77 “JM” Bristol.UNK/74 (MVP) Johannesburg.SOA/88/1 Illinois.USA/89/1 “Chicago-1” Montreal.CAN/89 Palau.BLA/93 New Jersey.USA/94/1 Victoria.AUS/16.85 Manchester.UNK/30.94 Victoria.AUS/12.99 Kampala.UGA/50.00-1 Menglian.Yunnan.CHN/47.09/1 Goettingen.DEU/71 “Braxator” MVs/Madrid.SPA/94 SSPE Berkeley.USA/83 Amsterdam.NET/49.97 Gresik.INO/17.02 Hunan.CHN/93/7 Beijing.CHN/94/1 H gene U03669 AF079552 AF079551 L46752 AY047365 M81898 Z80805 AF085198 M81895 AF079554 L46757 L46749 AF247202 U29285 AY127853 AY923213) GU440572.1 Z80797 Z80830 AF079553 AF171231 AY184218 AF045201 AF045203 N gene U01987 U01998 U01994 L46753 AY043459 M89921 D01005 U64582 U01977 U01976 L46758 L46750 AF243450 AF280803 AF481485 AY923185 GU440576 X84879 X84865 U01974 AF171232 AY184217 AF045212 AF045217

Thanks to Paul Chenowith and David Featherstone

Measles Cases with Genotypes USA: 20092009-2010 (YTD) Virologic Surveillance for Measles, USA: 20022002-2010 (9/1/10) Year Number of cases 44 56 37 66 55 43 141 71 51 561 Number of chains 26 29 21 25 31 27 39 33 41 272 Number chains with genotype (%) 8 (31) 7 (24) 6 (28) 12 (48) 14 (45) 7 (26) 15 (39) 19 (57) 14 (34) 102 (38) Number of outbreaks 3 3 2 3 4 4 9 8 4 40 Number of outbreaks with genotype (%) 1 2 2 2 2 3 9 7 3 31 (77) COUNTRY USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA Year 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 2010 Month 1 1 1 2 2 4 5 5 5 6 6 6 6 6 7 8 12 1 2 2 2 3 3 3 4 4 5 5 6 7 WHONAME MVi/New York.USA/2.09/2 MVi/New York.USA/2.09/1 MVi/California.USA/4.09 MVi/Pennsylvania.USA/7.09 MVi/California.USA/6.09 MVi/Virginia.USA/15.09 MVi/New York.USA/22.09 MVi/Pennsylvania.USA/20.09 MVi/Florida.USA/19.09 MVi/New York.USA/23.09 MVi/West Virginia.USA/23.09 MVi/New York.USA/25.09 MVi/New York.USA/26.09/3 MVi/Massachusetts.USA/26.09 MVi/Arizona.USA/31.09 MVs/Georgia.USA/32.09 MVi/California.USA/52.09 MVs/Virgina.USA/04.10 [SSPE] MVs/Arizona.USA/06.10 MVs/Washington.USA/7.10 MVs/California.USA/6.10 MVi/California.USA/11.10/1 MVs/California.USA/11.10/2 MVs/California.USA/11.10/3 MVi/Kentucky.USA/14.10 MVs/California.USA/17.10/1 MVs/Nebraska.USA/20.10 MVs/California.USA/17.10 MVs/Massachusetts.USA/22.10 MVs/Connecticut.USA/27.10 GENOTYPE SOURCE D8 UK D8 UK D4 UK D8 India D4 UK D8 unknown D4 unknown H1 unknown D4 UK D4 unknown D4 unknown D4 unknown D4 unknown B3 South Africa D4 France H1 unknown D4 unknown D3 B3 D4 D9 D8 D8 H1 D8 B3 D9 D9 H1 D4 N/A Ethiopia India unknown India unknown Canada India Germany unknown Philippines Japan unknown ACCESSION FJ848879 FJ848879 FJ904784 FJ848880 FJ904784 GQ337691 GQ337695 GQ337693 GQ369953 GQ369954 GQ369955 GQ369956 GQ369956 GQ903686 GQ903687 GQ903688 HM044306 HM044305 HM044304 HM044303 pending HM367087 HM367086 pending HM362784 pending pending pending pending pending

2002 2003 2004 2005 2006 2007 2008 2009* 2010 Total

*In 2009, 2 outbreaks genotyped by nested PCR only

Pending: submitted via MeaNS

Measles Cases with Genotypes USA, 2010

MVs/California.USA/11.10/2 MVi/California.USA/11.10/1 manches.unk 94 d8 MVi/Kentucky.USA/14.10 D8 vic.aus 85 d7 illin.usa 99 d7 chicago.usa 89 d3 montreal.can 89 d4 MVs/Washington.USA/7.10 MVs/Massachusetts.USA/27.10 MVs/Connecticut.USA/27.10 palau.bla 93 d5 bangkok.tha 93 d5 vic.aus 99 D9 MVs/California.USA/17.10 MVs/California.USA/6.10 MVs/Nebraska.USA/20.10 nj.usa 94 d6 mvp.uk 74 d1 johann.soa 88 d2 uganda-01-d10 madrid.spa 94 f jm.usa 77 c2 wtf.deu 90 c2 tokyo.jpn 84k c1 braxator.deu 71 e libreville.gab 84 b2 yaounde.cae 83 b1 ny.usa 94 b3

Measles Cases with Genotype D8 USA, 2010 D4

ed-wt a

MVs/California.USA/17.10/1 MVs/Arizona.USA/06.10 B3 ibadan.nie 97 b3 amster.net 97 g2 gresik.ino 02 G3 H1 berkeley.usa 83 g1 beijing.chn 94 h2 hunan.chn 93 h1 MVs/Massachusetts.USA/22.10 MVs/California.USA/11.10/3 5

MVs/Chester.GBR/3.09/ nucleoprotein MVi/Barka.OMN/21.08/1 MVi/Villupuram.Ind/03.07 MVi/Villupuram.Ind/07.07 MVs/Imphal.IND/19.09 California-11.10/1 MVs/Milton Keynes.GBR/20.07/ MVs/Mirbat.OMN/21.08/1 MVs/Kalahandi.IND/04.08/2 California-11.10/2 MANCHES.UNK 94 D8 MVs-BritishColumbia-CAN-13-10-2 MVs/Papumpare.Ind/51.07/4/ Kentucky-14.10 MVs/Papumpare.IND/51.07/4 MVs/Patna.IND/51.05 MVs/Purulia.Ind/39.06

Thanks to colleagues at SEAR Laboratory Network

Measles Cases with Genotype D9 USA, 2010

Measles Cases with Genotype H1 USA, 2010 AMSTER.NET 97 G2 GRESIK.INO 02 G3 BERKELEY.USA 83 G1 BEIJING.CHN 94 H2 HUNAN.CHN 93 H1 CA.USA/11.10/3 CA.USA/11.10/3 MVs-BC-CAN-12-10-1 MVi/Kaohsiung.TWN/53.08 MVs/Sari.IRA/30.2009(1) MVi/Taipei.TWN/30.07 MVs/Taoyuan.TWN/29.08 MVi/Sichuan.PCR/28.04/1 MViSh705 MVs/New York.USA/29.06 MVi/Jiangsu.PRC/23.05/3 MVs/Tainan.TWN/33.07 MVi/Guangdong.PRC/10.05/2 MVi/Hebei.PRC/09.05/1 MVi/Chongqing.PRC/20.04/1 5

California 2/16/2010 Nebraska 5/17/2010 MVs/HongKong.CHN/07.10 from PHL M03/10-NCR-PHL MVs/HongKong.CHN/28.07/5 from PHL California 5/12/2010 (CA MV-2897) M05/09-Region11-PHL M06/09-Region11-PHL VIC.AUS 99 D9

Thanks to colleagues at PHL, Hong Kong, RITM, Manila, and WPRO

Thanks to colleagues at Health Canada

Measles Genotypes in Latin America: 2010

Use of conventional and real time PCR for case classification and molecular surveillance

2010: D4, Brazil (Para) from ?

2010: B3, Brazil from ARG

2010: B3, Argentina from SA

Thanks to colleagues at FioCRUZ and Inst. Carlos Malbran

Testing Scheme for Confirmation of Measles Infection

Utility of New Assays in the Measles Diagnostics Tool Box Classification Clinical Fever/Rash Fever/Rash

IgM P

IgG P or N

Avidity& Low

PCR Positive and Sequence indicates vaccine strain

Throat or Nasal Swab, Urine

Oral Fluid, Dried Blood Spot

Serum Sample Vaccine reaction

Vaccine reaction Measles

P P or N

High

Meets CCD* Modified#

Virus Isolation

RNA extraction, RTRT-PCR

Measles and Rubella IgM

Measles (but recently vaccinated) Measles-Primary Vaccine Failure

Low can confirm IgM P P P or N

Positive PCR can confirm IgM

Meets CCD*

P P or N

Sequence Analysis for Genotype

Measles IgG

Secondary vaccine Failure

Modified#

High

Positive PCR can confirm case

Vaccine or WildWild-type Avidity

*=clinical case definition (CCD) #=modified or mild presentation does not meet CCD &=Collection of sample is ≤ 3 weeks after rash onset

Testing Scheme for Measles RTRT-PCR RNA extraction Or

Improving Primers for Measles Genotyping PCR

Low incidence settings

Standard RTRT-PCR Low Ct (<36)

Real time RTRT-PCR High Ct (>36)

Standard RTRT-PCR

Nested RTRT-PCR* *nested PCR recommended only for experienced Global or Regional Labs Location of primer binding sites relative to sequencing window

Sequence Analysis for Genotype

Vaccine or WildWild-type

Results and Conclusions • The primer sets were tested against RNA from 11 different genotypes of measles. RNA concentrations were determined by real time RT-PCR The MV 60 and MV 63.3 primer pair amplified all of the virus genotypes tested at 106 copies. The MeV 214-216 forward and the reverse primer pair was the most sensitive set for detecting measles RNA and detected all genotypes tested at 104 copies of viral RNA. 600 bp

New primers amplify 104 copies of RNA template 1 2 3 4 5 6 7 8 9 10 11 12 13 14 100 bp marker Water control RNA from uninfected cells Genotype A Genotype B3 Genotype D2 Genotype D3 Genotype D4 Genotype D5 Genotype D6 Genotype D8 Genotype G2 Genotype G3 Genotype H1

•

8 9

10 11 12 13 14

RT-PCR was performed with MeV216 and MeV214

Version 2 of the Measles Genotyping Kit: Results Version 2 of the Measles Genotyping Kit: Control RNA 900 nt 800 nt 700 nt 600 nt 500 nt 854 nt 634 nt

•Lane 1: MW ladder •Lane 2: Pos control •Lane 3: Pos sample •Lane 4: Negative (water) control

Sequence of the 3’ 3’ terminus of the measles N gene mRNA (3’ (3’ terminus of “sequencing window” window”) GGC TCA GAC ACG GAC ACC CCT ATA GTG TAC AAT GAC AGA AAT CTT CTA 1681 ↓ end of window MV63 MeV214 1681 GAC TAG GTG CGA GAG GCC GAG GGC CAG AAC AAC ATC CGC CTA CCC TCC 1728 1729 ATC ATT GTT ATA AAA AA 1633

Since the previous RNA control did not contain the entire 3’ non-coding region of the MeV mRNA, a new positive control RNA was synthesized to be used with MeV 214216.

Version 2.0 of the Measles Genotyping kit: •In this version, the forward and reverse primers have been modified to increase sensitivity and reduce background and the synthetic positive control RNA has been modified. The reaction conditions, primer and template concentrations, and cycling parameters are the same as those used with the previous version of the kit •This new primer set will not amplify the synthetic RNA control supplied in the previous version of the kit. Amplification from infected cell RNA will not be affected. •Measles RNA for RT-PCR can be extracted from either infected cells or clinical samples. •Primers MeV214 and MeV216 are designed to amplify a 634 nucleotide region coding for the 3’ terminus of the nucleoprotein (N) gene in a standard RT-PCR reaction. The positive control RNA, MeV-N3in included in this kit, is a synthetic RNA transcript of the N gene of measles and it is provided to serve as a positive internal control in the RT-PCR reactions. The control RNA has been modified so that the RT-PCR reaction will produce a larger PCR product (854 nucleotides) than the PCR product produced from measles RNA, thereby providing a means to identify laboratory contamination of the RT-PCR reaction

Kit Contents: •Forward primer: MeV216, 25ul Stock Solution 200uM •Reverse primer: MeV214, 25ul Stock Solution 200uM •Dried Positive Control RNA, MeV-N3in, 1011 copies •1ml of 1X nuclease-free TE The sequences of the primers are: Forward primer: MeV 216, 5’-TGG AGC TAT GCC ATG GGA GT-3’ Reverse primer: MeV 214, 5’-TAA CAA TGA TGG AGG GTA GG-3’

To make working stocks of primers MeV214 and MeV216 for RT-PCR: •Add 90ul nuclease-free water to 10ul of MeV214 •Add 90ul nuclease-free water to 10ul of MeV216 •Concentration = 20uM •Store at -20ºC •Use 0.5 – 1ul per RT-PCR reaction as per RT-PCR protocol. Rehydration of measles positive control RNA, MeV-N3in To make master stock: •Add 100ul nuclease-free TE and vortex tube. •Place at 55ºC for 10 minutes and vortex, again. •Make 10ul aliquots. •Concentration = 109 copies/ul •Store at-70ºC To make working stock: •Add 90ul nuclease-free TE to the 10ul master stock. •Concentration = 108copies/ul •Store at -20ºC for short-term and at -70ºC for long-term. •Use 1ul per RT-PCR reaction.

Background: TaqMan Real time RTRT-PCR •Probe contains 5’fluorophore and 3’ quencher •Forward and reverse primers are not modified and are the same as those used in standard RTPCR •Relatively short amplicons (typically less than 100nt) •Probe is degraded by 5’ to 3’ exonuclease activity of the Taq polymerase •Consumption of probe results in fluorescence •Fluorescence is measure at each cycle (typically 40) •Threshold cycle (Ct) is cycle at which fluorescence crosses the threshold.

Detection of Measles RNA by Real Time RTRT-PCR •Real-time assays can detect 10-100 copies of viral mRNA/sample in a high throughput format, results in 3-4 hours •Can help to confirm a case when serologic results are inconclusive •Negative results do not rule out a case •Standard RT-PCR is less sensitive than real time RT-PCR. •Sequence information from the standard PCR product required for genotype and confirmation of vaccine reactions.

Controls

Positive Sample

Primers and Probes for Measles Real time RTRT-PCR and for Reference Gene Control MeV N Gene Make a 15 µ M stock of each forward and reverse primer; final concentration is 300 nM. Make a 12.5 µ M stock of the probe; final concentration is 250 nM. •Forward Primer (MVN1139F): 5’ TGG CAT CTG AAC TCG GTA TCA C 3’ •Reverse Primer (MVN1213R): 5’ TGT CCT CAG TAG TAT GCA TTG CAA 3’ •Probe (MVNP1163P): 5’ FAM CCG AGG ATG CAA GGC TTG TTT CAG A BHQ 3’

Measles Real time RTRT-PCR on ABI 7500

Measles Standards

RNaseP Standards

Human RNase P Gene (Reference gene) Make a 15 µ M stock of each forward and reverse primer; final concentration is 300 nM. Make a 5 µ M stock of the probe; final concentration is 100 nM. •Forward Primer (HURNASE-P-F): 5’ AGA TTT GGA CCT GCG AGC G 3’ •Reverse Primer (HURNASE-P-R): 5’ GAG CGG CTG TCT CCA CAA GT 3’ •Probe (BHQ1HURNASE-P): 5’ FAM TTC TGA CCT GAA GGC TCT GCG CG BHQ 3’

Measles Real time RTRT-PCR on ABI 7500: Standard Curve

Measles Real time RTRT-PCR: Interpretation Viral gene (Ct) RNase P (Ct) Ct < 40 Ct < 40 Undetermined Undetermined Ct < 40 Undetermined Ct < 40 Undetermined Result Positive Positive Negative Indeterminate

•Ct is average Ct from 2 or 3 replicates/sample •Positive if 2/3 replicates are <40 •If testing in duplicate, repeat if one Ct is <40 and the other is Und. •Repeat Indeterminate samples with fresh RNA extraction if possible

Samples from Suspected Measles Cases, USA, 20092009-2010 (through Sept 10) • Samples for real time RT-PCR: 266 (US only) • 79 positive (29%) • 8 indeterminate • 180 negative Virus isolation attempts: 271 (includes international) • 2009: 36 positive from 210 samples (17%) • 2010: 7 positive from 61 samples (11%)

Shipping viral isolates on filter paper Drying cells infected with measles or rubella viruses onto specimen paper Purpose: To submit measles or rubella isolates to the Regional or Global Specialized Laboratory for sequence analysis and genotyping. Once the samples are dry, the samples can be stored at 4 C. Samples can be shipped at room temperature. May also be used to transport proficiency panels for RT-PCR assays Important: Both measles and rubella viruses have been recovered from specimen paper. Treat samples as infectious material. CDC is testing inactivation protocols as well as the FTA cards that are similar to those used by the polio labs.

•

What about infectivity? A non-infectious samples would be useful a number of purposes including shipment of PT panels and control RNA for RT-PCR Whatman FTA elute micro card •Chemically treated to lyse cells and denature proteins on contact. •Nucleic acids are protected from microbial and fungal attack. •Samples are not infectious. •Samples can be stored and shipped at room temperature. •Extract RNA using Qiagen Viral RNA Mini kit.

Measles RNA is stable for at least one month on FTA cards pos control pos con trol

PCR Products are Stable for at least 1 month Day 0 1 Month

water

600 bp

wate r pos con trol

wate r

day 1

1 week RT

1 week 37 °C

2 week s RT

1 week RT 1 week 37 °C

4 week s 3 weeks RT RT 1 week 37 °C

1 month 1 month RT RT with 1 week 37 °C

wa ter pos con tr

•PCR reactions were incubated at, RT, 4C and 37 C for up to 1 month with no degradation of PCR product •PCR reactions can be shipped to sequencing lab at 4C or RT

600 bp

•Place thin-walled tube in sturdy container (e.g. 1.5 ml Eppendorf)

Thank You •Measles, Mumps, Rubella and Herpesviruses Laboratory Branch, DVD/CDC •William Bellini, Jennifer Rota, Yuan Tian, Luis Lowe, Elena Lopareva, Bettina Bankamp, Lauren, Rebecca, McNall Byrd, Joe Icenogle, Emily Abernathy, Lijuan Hao •Epidemiology Branch, DVD/CDC •Kathy Gallagher, Susan Redd, Al Barskey •Global Immunization Division/CDC •National Microbiology Laboratory, Canada •PAHO LabNet: Carlos Castillo, Christina Marsigli •FioCRUZ: Marilda Siqueira •Inst. Carlos Malbran: Elsa Baumeister •WHO/HQ, RRL and NLs •State and Local Public Health Labs, USA

Outline Running statue of Measles Surveillance in China Songtao Xu Huiling Wang

Introduction Measles Epidemiology in China Measles LabNet Running Status Serological Test for Suspected Measles Quality control Virus Surveillance (Imported Measles cases)

WPRO Reference Measles/Rubella Laboratory National Measles Laboratory, Institute of Viral Disease Control and Prevention, China CDC 23 Nov, 2010

The measles incidence, 1950～2009 1600 1400 1200 1000 800 600 400 200 0 20 18 16 14 12 10 8 6 4 2 0 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 发病率1/100 000

Reported measles cases, 2009 and Jan-Oct 2010 2010

发病率1/100 000

1986,2nd dose

1950 1952 1954 1956 1958 1960 1962 1964 1966 1968 1970 1972 1974 1976 1978 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 2006 2008

Data source: NNDRS

1965: Liquid vaccine Unpublished data

1978: 1986:freezeEPI dried vaccine

1998:acceler 2006:Elimi ate control nation plan stage

2009: cases=52,461，incidence=39.5/million，the lowest since report system established 2010, Jan-Oct: cases=37919, incidence=28.5/million Data source: NNDRS Unpublished data

Measles Age Specific Incidence, 2005-2010.10

Nationwide Supplementary Immunization Action (SIAs) in China,2010 • Purpose: – To eliminate immunity gaps of target population (especially the floating population) – To rapidly increase the immunity level of population, block the spread of the virus and reduce the incidence • Time： – Sep 11-20, 2010

• Target population ： 0-5y group 0-3y group. – 5 provinces： – 3 provinces： – 23provinces： 8m～14y 8m～ 6y 8m～ 4y

• Total number of over 100 million population vaccinated

Outline Introduction Measles Epidemiology in China Measles LabNet Running Status Serological Test for Suspected Measles Quality control Virus Surveillance (Imported Measles cases)

Serological Test of Suspected Measles outbreak in 2009 to May 2010 2009 Province Chongqing Gansu Guangxi Hebei Heilongjiang Henan Hubei Hunan Inner mongolia Jiangsu Jiangxi Liaoning Ningxia Shaanxi Shandong Shanghai Sichuan Yunnan Zhejiang Total No. of outbreak 3 10 2 36 13 83 4 5 4 26 6 45 12 2 34 17 1 2 9 314 Confirmed outbrek 3 9 2 35 13 68 0 5 4 26 6 45 12 2 34 17 1 2 9 293 % 100.0% 90.0% 100.0% 97.2% 100.0% 81.9% 0.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 93.3% No. of outbreak / 3 / 67 / 7 / / / 3 / 4 / 3 44 3 / / 7 143 2010.1~5 Confirmed outbrek / 3 / 63 / 5 / / / 3 / 4 / 3 44 3 / / 7 137 % / 100.0% / 100.0% / 71.4% / / / 100.0% / 100.0% / 100.0% 100.0% 100.0% / / 100.0% 95.8%

Serological Test of Suspected Measles-sporadic in 2009 to May 2010 2009 Province suspected cases Beijing Chongqing Gansu Guangxi Hainan Hebei Heilongjiang Henan Hubei Hunan Inner mongolia Jiangsu Jiangxi Liaoning Ningxia Qinghai Shaanxi Shandong Shanghai Shanxi Sichuan Xinjiang Yunnan Zhejiang Total / 406 1180 91 52 3128 1632 9625 2385 5181 1456 6478 1160 3481 1253 392 300 3535 845 401 952 394 820 2960 48107 collected samples 950 510 805 74 52 3757 1169 6376 1352 4411 1180 5454 1160 2100 1244 267 291 2797 933 181 712 559 510 2615 39459 IgM pos measles 384 270 307 68 2 2335 574 4148 809 2160 652 4225 480 1867 549 203 236 1349 786 55 190 83 297 1061 23090 suspecte d cases / 15 402 24 80 13526 7131 2017 / 283 454 884 116 332 55 169 315 1221 128 111 390 107 171 1137 29068 2010.1~5 collected samples / 13 295 17 80 5837 5374 1358 258 268 342 633 91 261 50 289 269 918 131 94 280 141 164 1054 18217 IgM pos measles / 4 137 11 10 4538 3875 765 63 43 225 380 12 197 4 215 239 805 119 46 52 44 62 477 12323

Quality Control Annual Reconfirmation test (Ongoing) Annual Proficiency test (Preparing) Annual Training course and workshop Annual On-site review

Annual Training and workshop National-wide LabNet Workshop done in Sep, 2009 The Sixth Workshop of China Measles Lab Network Changsha, Hunan, 2010 WHO, WPRO, CDC,HPA experts were invited to attend measles workshop Communication and share data: Provinces, National, EPI

On-site review/Accreditation RRL was accredited every year 12 provincial labs were on-site review in 2010 Tibet, Xinjiang, Guangdong, Guangxi, Liaoning, Heilongjiang, Sichuan, Qinghai, Ningxia, Gansu, Beijing and Hebei RRL and 12 provincial labs are all pass on-site review/Accreditation

Hands-on Training Course of Measles LabNet, Beijing, 2010

Congratulations, the Tibet CDC measles laboratory passed on-site review for first time!!

Outline Introduction Measles Epidemiology in China Measles LabNet Running Status Serological Test for Suspected Measles Quality control Virus Surveillance (Imported Measles cases) Province

Measles isolates and genotyping results in Jan-Oct, 2010 No. of isolates 1 4 Sichuan 1 2 Yunnan 1 1 Beijing Gansu Guizhou Hainan Hebei Henan Total 19 11 2 1 30 35 Genotype D9 H1a A H1a d11 H1a H1a H1a H1a H1a H1a H1a 224H1a Province Heilongjiang Hubei Jiangsu Jiangxi Liaoning Innermongolia Qinghai Shandong Shanghai Shanxi Tianjin Zhejiang 1D9 1A-VL 1d11 No. of isolates 20 2 12 2 14 4 3 12 2 10 36 2 Genotype H1a H1a H1a H1a H1a H1a H1a H1a H1a H1a H1a H1a Ningxia

The Phylogenies tree of Chinese measles virus in Jan-Oct, 2010 and 23 WHO reference strains based on the 450 nucleotide sequence of N gene Among 227 isolates 224 isolates were H1a 1 A-VL 1 D9 1 d11

H1a

GS10-08 TJ10-11 GS10-05 GS10-04 GS10-03 GS10-02 GS10-01 GS10-11 GS10-09 QH 10-05 TJ10-31 ZJ10-01 H eN 10-16 ZJ10-02 QH 10-06 SX10-04 HeB10-11 SD10-07 SD10-03 TJ10-29 TJ10-12 SX10-10 SX10-09 SX10-07 SX10-06 SX10-05 SX10-02 SX10-01 SD10-08 SD10-06 SD10-05 SD10-04 SD10-02 SD10-01 SC10-01 LN10-13 LN10-03 LN10-01 HeN10-28 HeB10-30 HeB10-17 GS10-07 GS10-06 GS10-13 JS10-09 JS10-08 JS10-07 JS10-06 QH 10-07 SH10-01 SD10-11 BJ10-16 HeB10-01 HeB10-02 HeB10-05 HeB10-19 HeB10-22 HeN10-08 HeN10-30 LN10-05 SD10-09 SD10-10 TJ10-14 TJ10-16 TJ10-17 HeB10-07 HeB10-21 HeB10-06 HeB10-04 TJ10-19 HeB10-20 TJ10-22 HeB10-03 HeB10-15 TJ10-33 TJ10-4 07 TJ10-13 TJ10-34 SX10-03 TJ10-30 TJ10-25 JS10-01 JS10-04 JS10-12 HeN10-03 HeN10-04 HeN10-10 HeN10-12 HeN10-19 HeN10-21 HeN10-24 HeN10-25 HeN10-26 JS10-05 HeN10-17 H eN 10-06 H eN 10-15 JS10-10 TJ10-27 TJ10-18 LN10-14 LN10-04 HLJ10-11 HLJ10-04 HeB10-28 HeB10-23 BJ10-15 H eN 10-22 HeN10-29 TJ10-23 SH10-02 LN10-07 HLJ10-14 HLJ10-07 HLJ10-01 HeB10-25 HeB10-12 JS10-02 GZ10-01 SC10-02 YN10-03 TJ10-20 NM 10-02 LN10-06 HLJ10-12 HLJ10-06 HeB10-29 HeB10-24 BJ10-20 JS10-11 TJ10-24 TJ10-2 03 LN10-08 HLJ10-15 HLJ10-08 HLJ10-02 HeB10-26 HeB10-13 JS10-03 BJ10-10 HeB10-14 HeB10-27 HLJ10-03 HLJ10-10 LN10-02 LN10-10 TJ10-10 HeN10-02 HeN10-07 HeN10-09 HeN10-13 HeN10-14 HeN10-18 H eN 10-05 HeN10-20 H LJ10-09 H uB 10-02 H uB 10-03 JX10-02 NM 10-03 NM 10-04 NX 10-07 BJ10-01 BJ10-02 BJ10-05 BJ10-07 BJ10-14 BJ10-17 BJ10-18 BJ10-22 BJ10-23 BJ10-24 GZ 10-02 HeB10-09 HeB10-10 HeB10-16 HeB10-18 HeN10-11 LN10-09 LN10-11 LN10-12 TJ10-1 01 TJ10-3 05 TJ10-05 TJ10-06 TJ10-07 TJ10-08 TJ10-09 TJ10-15 TJ10-21 TJ10-26 TJ10-28 TJ10-35 TJ10-36 JX10-01 H eN 10-01 N X10-02 N X10-06 N X10-01 SX10-08 H eB10-08 SD10-12 N M 10-01 TJ10-32 H unan.China93-7/H 1 Beijing.China94-1/H2 Berkeley .USA /83/G 1 M Vi/Amst erdam.N ET/49.97/G2 M Vi/Gresik.INO/18.02/G3 Brist ol.UNK /74/D 1 NewJersey .USA/94/1/D 6 Johannesburg.SOA/88/1/D 2 M Vi/Kamp ala.UGA /50.00/1/D10 M ancester.UN K/30.94/D8 YN10-01 M Vi/Yunnan.C HN/47.09/1/d11 M Vi/Vic.A U/16.85/D7 M Vi/Illinois.USA/50.99/D 7 NX10-08 M Vi/Vic.AU/12.99/D 9 M ont real.C AN/89/D4 Illinois.USA/89/1/D3 Bangkok.TH A/93/1/D5 Palau.BLA/93/D5 M ary land.USA/77/C2 Erlang en.D EU/90/C2 M Vi/Toky o.JPN/84/K/C1 M Vs/M adrid.S PA /94/SSPE/F G oet tingen.DEU/71/E SC10-03 S hanghai-191/C hina-vaccine Edmonst on-wt .U S A /54/A Libreville.GA B/84/B2 Yaounde.C AE/12.83/B1 NewYork.USA/94/B3 Ibadan.NIE/97/1/B3

Distribution of measles viruses, Jan-Oct, 2010

Burma

0.01

Rubella epidemical character Update of Rubella laboratory Surveillance in China Songtao Xu, Zhen Zhu WPRO Reference Measles/Rubella Laboratory National Measles Laboratory, Institute of Viral Disease Control and Prevention, China CDC Sep 20, 2010

• The incidence increased from 2004 to 2008，but decreased from 2009. • School age population(5-10y group) show the highest incidence, main cases occurred in <15y group. • Most of Rubella outbreaks occurs at school, such as middle and primary school. More outbreaks occurs in village schools than town schools.

Rubella reported cases from 2004 to 2010.10 From Jan. to Oct.,2010, 40,762 cases were reported; the incident rate is 3.07/100,000. Clinical diagnosis cases: 34,303 Lab confirmed cases:6,459

Serological Test of Suspected Rubella outbreak in 2009 to May 2010

>89% outbreak was lab confirmed

~96% outbreak was lab confirmed

Data source: NNDRS, China CDC

Serological Test of Suspected Rubella-sporadic cases in 2009 to May 2010

Measles and Rubella virus isolates from 2007-2010.1-10 Number of Virus Strains Year Rubella 2007 2008 2009 2010.1-10 Total 58 69 53 28 208

Summary of Genotypes of Rubella Viruses in China from 1999 to 2010.1-10

280 of 742 Rubella Isolates Were Confirmed and Genotyped

Four genotype 1E 1F 2A and 2B of rubella virus have been found in China during 1999~2010. IE genotype rubella virus was the predominant genotype since 2001. 1E genotype were isolated from 19 provinces of China and takes more than 85% of all rubella isolates. 280 rubella strains from 19 provinces (2009-2010.1-10: 81 from 11 provinces)

The geographical distribution of rubella virus of 19 provinces from 1999 to 2010.1-10

H H H H H H H H e e e e e e

e e e n N n N n N R

n n n a 0 a 0 a 0 V 0 0 i a 7 n a

a a a n 9 n 9 n 9

n n n 0

0 0 0 9

9 9 8 - 9 3 - 1

- 2 - 3 - 1 4 8

- 1 0 9 - 4 0 9 - 1 - 2 9 0 6 - 1 8

- 1 5 - G 0 - 0 8 )

The Phylogenetic Tree of Genotype 1E IE genotype rubella virus was the predominant genotype from 2001 to 2010 It’s could be divided into three groups; Lineage1 was the predominant; The P-distance between lineages is 2.0%-2.6%; Same rubella virus continually circulated in the same province. S 6 4 2 G 8 6 9 5

- M

- 2

- 0

G N

D i n C

- 2 g Q H x 0 e n n h a a a - 2 T T T

- 2 a n n 0 g 8 o o o 9 n n n i a N S

( 7 0 8 0

2 8 - 1 9

- 1 5 - 1 5 0 0 0 9 9 9

4 0 1

H T A S S S G D

e i a n h h h

j i n u n n n 0 i 0 d d d 0 i a i a i a T L

- 1 n n n - 1 g g g 1 g g g j i n 8 h h a a 8

- 9 - 4 - S

2 1 u n k a n g

j i n j i n j i n n 0

0 0 0 g 3 d d

9 9 9 0

- 5 - 1 - 8 9 - 6 0

- 1 n n - 9

o o

n n

g g

0 0

9 9

- 9 - 9

4 3

S A n 8 u H J i l i n 0 A n 0 0 n 0 a a a a 8 n n n n R R R G G G a a V a n n R J n s s V i a J h 8 h 8 8 u - 6 d d d d V V - L s u u o o o o h - 4 i 0 e 0 - 1 u i 0 8 n 8 u i 0

L A

N n

0 h

- 1 a n

2 0 ) 7 - 1

- ( 8

i l i n

9 )

- 1

J J

i l i n i l i n A

- ( 9 - 4 i 0 9

- 1

L S S S S

N h h h h

n n n n - L - L i a u 0 0 - L n

g g g g

0 0 0 0 i a i a o 0 9 9 i a g n g x - 5 x 9

9 9 9 9 o o n

- 6 - 6 - 6 - 7 n n i n - 1 9 5 n i 0 i n

6 4 9 1 g g 1 0 1 1 0 0 - 1 - 9 - 1 0 2

i n g 7

- 1 - 1 o

(predominant) Lineage1

i n 8 i 0 8 - 6

g - 9 8 - 5

- 2

i a n g 8 2 0 0 0 0 0 i a 9 3 9 9 9 9 9 n

g x i 0

x i 0 8

- 8

J J J S T T T T T D i a i a i a i a i a 0 n n n n n R A n h F F u N N i n j i a i n g R x V V V i a 0

i a n

i l i n 8 j i n j i n j i n j i n j i n V u u - 3

g g g g g - T i 0

- 1 - 1 - 1 - 1 - 2

8 4 6 7 0 g 1 0 - 4

j i n

- 9 n 9 i a 0 9 - S - S C R 0 - 7 0 9 - 0 C C - 2 V i 0 - 0 - 0 a 8 - 1 - 0 x x 6 n i a i a - 1 g o o o - 1 d 0 0 6 - 1 i 0 8 n 8 - 2 h u i 0 8 - 7 - 1 7 7 - 1 o 1 n n n 8 n - 2 - 4 0 g g g 2 g 0 9 - 4 2 - 4 0 0 0 9 9 9 - 7 - 7 - 4 5 6 3 8 0 0 9 9 - 0 - 0 4 4 8 7 n - 6 9 1 - 0 6 - 2 - 2 0 - 1 7 7 7 0 1 4 - 6 4 3 8 - 1 7 4 7 0 0 0 1 1 0 0 - 3 - - G - 2 - 2 1 S - M V - 2 0 1 0 - 0 0 7 - 1 - 2 6 - 6 6

j i a n g 0 x i a - 1 - 2 - S

R R

Q N N i n i n g g S N Q S 9 8 8 0

i n x x

g i a i a

h 0 0 h g

a 9 9 u 0 7

i c e n a x

e i n h

i m g a n N N h

i 0 i 0 9 g g 0 o

i n i n a i a n

H R V

n - L S S S

i n d d d 8

h h h D h n n i n i n n i a n g x g g 0

a a a 0 a

n n n

S S 9 0

n g g 0 6 x

L L S h N a i n n

i a i a d g J

o o o x i a n

i a

i 0 A

7 S

- 2 C 4 u 0 - C i 0 h u A u i 0 n h h A L u u n 7 i 0 7 h 7 H - 1 - 0 - 5 9 - 1 u i 0 i 0 h N e a n n 7 g 0 0 n 8 n o q - 1 7 i 0 d 1 g J o - 2 q i a i n n g g x 0 3 i 0 A 1 0 0

1 2 ( 1 - 1 ( 1 3 4 - 6 ( 2 ( 1 7 - 5 - 1 i 0 - 2 - 1 4 - 1 0 8 ) ) ( 2 2 ) ) - 1 6 ) E

T A 9 7

1 h n h

n A

i 0 7 7 u 0 5 x 7 6

8 - 6 - 3 i 0 8

A 9 8

n n

- 8

e S

b h a a 0

i 0 n 0 0

H H C C h o n g

a u Q q L L

i n n

- 1 0 8 8 i n 3 - 8 - 1 g

( 4 - 2

)

i n N N o 0 o i a n g 1 0 u n i 0 n

280 rubella viral strains were isolated from rubella outbreak and sporadic patients But there are still blank background in some provinces.

4 0 7 - 2 3

L 9 5

i a N i a L

L L

- 2 i n n i n g i n g 0 g 0 7 0 5 - 1 7 - 1 4 - 1

C H e n

h a S A S n h h h

o n

(Anhui-01) h n n A u h h n h i 0 u u h u 9 i 0 i 0 u i 0 - 1 9 9 i 0 9 1 - 1 - 3 9 - 1 - 4 0

0 C h a

- 1 1 n - 1 g 0 1 - 9

n C

u o

- 1 6 n A A - 1

Lineage2 4 5 1 - 1 E 1 C E R - A S M 2 5 8 9 5 4 4 2 1 9 7 8

A A R R 6 3 3 3 - P 4 - F A B 3 L H - N B D E S - M - S V 2 U - I T - G - U 9 Y a B H H 1 0 0

n V - L 8

i 0 i n d o

1 s n

- 3 k . B B L R R - 2 - 0 8 4 . 0 . 0

i - M o n E

V R A E S 7 A - 1 - U r 4

s 9 9 R 9 E S

. G

- 1 7 9 7 9

- 1 - 1 E

C F

A R C

S I - B A

A 0 N a a a i n 1 . 0 8 7

0 8 9 n n n a - 1 5 . 0 . 0

0 . R 7 0 0 0 n E - 1 5 5

- 1 U - 1 8 8 8 0

E S E 2 1 0 - 1 - 0 6 - 1 E - E F

- 1 A i n i n i n a - 0 8 - 1 - 2

- C a a a H

- 1 - 2 - 1 7

M R 1 0 0

1 . B s s k k

- M L . B . B R

L - 2 R R

V R R

i - M V V

i n

s i n i n

1 - 2 - 1

E 1 1

- A E E

M - A - A B

2 M M R

5 2 2 D

8 5 5 2

9 8 8

5 9 9

7 5 5 H 5 6 - 8 0 - 2 A

Lineage3

i - M i - M

L L

- C

. 0

(Hainan-07-08)

Challenge New Technical Development

RT-PCR for MMR real time RT-PCR for MMR Simultaneous detection of single-tube：measles and rubella RNA RT-PCR-RFLP for measles genotyping

Improve measles database, combine EPI data with lab data Assuring quality of non-validated assay Specimen collection and transportation-for viral specimens Timeliness and completeness Cold chain Some Provincial Labs not forwarding isolates to NML at regular intervals （28+14d） Data management

Improving the capacity Introduce the rRT-PCR of MMR into LabNet and apply abroad Need to expand the virological sampling to collect data on as many chains of transmission as possible All provinces, different geographical distribution of virus surveillance Outbreak Sporadic Continuous surveillance Some provincial lab could sequence the isolates by themselves need to report the sequence results timely to China CDC NML virus isolates need to be transported to China CDC monthly.

Acknowledgements WHO HQ (Dr David Featherstone), WPRO (Dr Youngmee Jee), excellent experts of US CDC, NIID of Japan and China CDC. PHLC of Hong Kong, Dr Wilina Lim and her good team; MOH, China CDC (Wenbo Xu); All of the National, provincial and prefectural measles lab staffs

National Measles Reference Laboratory, New Zealand

Diagnostic Methods Canterbury Health Laboratories

Canterbury Health Laboratories

• • • •

Measles IgG ( Biomerieux MiniVidas) Measles IgM EIA (Enzygnost) Rubella IgG ( Biomerieux MiniVidas) Rubella IgM ( Biomerieux MiniVidas)

Kevin Barratt Virology Technical Specialist Canterbury Health Laboratories, Christchurch, New Zealand November 2010

• Measles Samples for Real-time RT-PCR and virus isolation in Vero/SLAM cells: – Throat/ NPS – Urine – White blood cells – Serum

Current Status of Data Reporting

Serology and RT-PCR Results 2010 Canterbury Health Laboratories Canterbury Health Laboratories

• • • • •

Monthly reporting to WHO of all suspected cases Results include any known history Serology and or PCR Genotype where possible Selection of samples sent to VIDRL for confirmatory testing

Total samples tested at NZ Labs so far in 2010 = 262

Measles Positives 2010 Month March April Serology positive 5 2 1 1 August September October n/a 1* n/a n/a RT-PCR positive 5 2 n/a 1 3 n/a 2 1* Genotype D8 D8 n/a A* D8 n/a A* Non-subtypeable Region

Canterbury Health Laboratories

Northland outbreak 2010 • • • • •

Canterbury Health Laboratories

Northland Wellington Rotorua Taranaki Auckland Auckland Wellington

32 reported cases in March meeting case definition 5 lab confirmed initially at Labplus Auckland All cases associated with non-vaccinated extended family group Linked cases in Wellington and Brisbane Probable index case child returning from India

Cases shaded orange linked to Northland outbreak

* Probably vaccine related

Technical Problems

Canterbury Health Laboratories

Database Problems • WHO Database doesn’t show RT-PCR results on reports

Canterbury Health Laboratories

• Don’t always receive both serology and RT-PCR / Virus isolation samples • Low level positive RT-PCR results, usually with a history of recent vaccination, can be difficult to distinguish from clinical disease

Canterbury Health Laboratories

Measles One-Step • • August 2009 SuperScriptTM III One-Step RT-PCR (Platinum Taq)

Canterbury Health Laboratories

•

Primers target the nucleoprotein (N) gene – N3F 5’ - TGG CAT CTG AAC TCG GTA TCA C - 3’ – N3R 5’ - TGT CCT CAG TAG TAT GCA TTG CAA – 3’ Probe is labelled with FAM/BHQ (fluorophore/quencher) – N3P 5’ - CCG AGG ATG CAA GGC TTG TTT CAG A – 3’

•

Case Definitions

Canterbury Health Laboratories

Testing Algorithm: Serology Clinical History ? Measles - ? Rash SEROLOGY MEASLES IgM

Canterbury Health Laboratories

Confirmed Case: • A clinically compatible illness that is epidemiologically linked to a confirmed case or is laboratory confirmed. Probable Case: • A clinically compatible illness Negative / Equivocal

Clinically Compatible Illness: • Measles cases must meet all the following criteria: • Fever ≥ 38°C • Generalized maculopapular rash lasting three or more days • Cough or coryza or conjunctivitis or Koplik’s spots.

Positive

Measles IgG

Refer to confirmatory algorithm

Positive Immune – no further action

Negative Report as negative. Add comment regarding timing of sample

Confirmatory Testing CONFIRMATORY ALGORITHM FOR POSITIVE MEASLES IgM POSITIVE MEASLES IgM PCR Storage

Canterbury Health Laboratories

Quality Assurance • Controls included in all batches • Participation in External QAP (RCPA) • VIDRL panel (annual WHO proficiency panel)

Canterbury Health Laboratories

Positive Immune - no further action Measles IgG Negative suggest repeat if symptoms < 7 days Negative

Split sample aseptically

Repeat IgM

Positive

Alternative Diagnostic Tests

Cross Reactivity Check

Parvo IgM

Rubella IgM

HHV6 PCR

Parvo IgM

Rubella IgM

Positive

Negative

Interpret in conjunction with clinical history

Report as possible simultaneous reactivation IgM

Report as Measles IgM Positive Notifiable Disease

Contents

National Measles Laboratory in Republic of Korea

Staff structure for measles and rubella Diagnosis for measles and rubella

Hee sook Yoon Div. Of Respiratory Viruses Center for Infectious Disease National Institute of Health Korea CDC

National laboratory data during 2008-2010 National External Quality Assurance Program, 2010 Shipment Arrangement to RRL Challenges or Problems Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Staffs for measles and rubella

Diagnosis for measles and rubella Specimens: Blood (serum), respiratory specimens (Nasopharyngeal and throat swab), urine, and oral fluid

Name

Position Title or Duties Director Researcher Research assistant (serology) Research assistant (virus isolation)

Full-time or Part-time Full-time // //

% of time spent working on measles or rubella 10 50 80

Years of experience 5yrs 1yr 3yrs

WHO training

Methods Virus Measles Rubella IgM Enzygnost AntiMeasles-Virus/IgM Enzygnost AntiRubella-virus/IgM IgG Enzygnost AntiMeasles-Virus/IgG Enzygnost AntiRubella-Virus/IgG Isolation/Detection Vero-SLAM cell culture/ Realtime PCR

KS Kim YJ Kim HS Yoon

ST Kim

3yrs

Differential diagnosis Virus Parvovirus B19 Human Herpes virus type 6 IgM Biotrin Parvovirus B19 IgM EIA Panbio HHV6 IgM EIA IgG Isolation/Detection

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Laboratory testing algorithm

National laboratory data during 20082010 Monthly request specimens 180 160 140

Suspected case Specimens for virus isolation Vero-SLAM cell + RT-PCR + Positive Negative Negative + Positive RT-PCR + Others + Positive 1st serum IgM Detection Differential diagnosis 2nd Serum Negative

120 100 80 60 40 20 0 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

2008 2009 2010

Monthly positive cases 90 80 70 60 50 40 30 20 10 0 Jan Feb Mar Apr May Jun Jul Month

Outbreak in Incheon 2008 2009 2010

•Rubella •Parvovirus B19 • HHV 6 • MV IgM positive – confirmed Measles

• MV IgG 4 fold increase - confirmed Measles

cases

Aug

Sep

Oct

Nov

Dec

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

National laboratory data for 2008-2010 Year 2008 2009 2010 Total Reported case 165 132 279 576 Virus Isolation 0 0 18* 18 Positive 22 32 112 166 IgM Positive 22 32 96 150 Negative 143 100 167 410 IgG increase 0 0 0 0

Molecular Epidemiology of Measles Virus, 2010 2010 Measles virus 2010 Measles virus isolated cases isolated cases 2010 Measles outbreak 2010 Measles outbreak cases in Incheon cases in Incheon

Year 2008 2009 2010 Total

Positive 22 32 112 166

RT-PCR 0 2 40* 42 7.5 6

*2010 Incheon out break cases *2010 Incheon out break cases

MVs. Incheon.KOR 25 10 15(64) MVs. Incheon.KOR 25 10 18(68) MVs. Incheon.KOR 25 10 12(56).seq MVs. Incheon.KOR 25 10 4(18).seq MVs. Incheon.KOR 25 10 17(67) MVs. Incheon.KOR 25 10 9(30).seq MVi. Incheon.KOR 25 10 18(83) MVi. Incheon.KOR 25 10 17(76) MVi. Incheon.KOR 25 10 16(74) MVi. Incheon.KOR 25 10 15(73) MVi. Incheon.KOR 25 10 14(69) MVi. Incheon.KOR 25 10 13(68) MVi. Incheon.KOR 25 10 12(67) MVi. Incheon.KOR 25 10 11(64) MVi. Incheon.KOR 25 10 10(62) MVi. Incheon.KOR 25 10 9(58) MVi. Incheon.KOR 25 10 8(43) MVi. Incheon.KOR 25 10 7(41) MVi. Incheon.KOR 25 10 6(30) MVi. Incheon.KOR 25 10 5(18) MVi. Incheon.KOR 25 10 3(14) MVi. Incheon.KOR 25 10 4(16) MVi. Incheon.KOR 25 10 2(22) MVi. Incheon.KOR 25 10 1(15) MVs. Incheon.KOR 26 10 40(189) MVs. Incheon.KOR 26 10 38(171) MVs. Incheon.KOR 26 10 37(168) MVs. Incheon.KOR 26 10 36(166) MVs. Incheon.KOR 26 10 35(165) MVs. Incheon.KOR 26 10 34(164) MVs. Incheon.KOR 26 10 33(163) MVs. Incheon.KOR 26 10 32(161) MVs. Incheon.KOR 26 10 31(159) MVs. Incheon.KOR 26 10 30(157) MVs. Incheon.KOR 26 10 29(156) MVs. Incheon.KOR 26 10 28(155) MVs. Incheon.KOR 26 10 27(128) MVs. Incheon.KOR 25 10 26(82) MVs. Incheon.KOR 25 10 25(83) MVs. Incheon.KOR 25 10 24(78) MVs. Incheon.KOR 25 10 23(76) MVs. Incheon.KOR 25 10 22(74) MVs. Incheon.KOR 25 10 21(73) MVs. Incheon.KOR 25 10 2(15).seq MVs. Incheon.KOR 26 10 39(188) MVs. Incheon.KOR 25 10 6(20).seq MVs. Incheon.KOR 25 10 8(27).seq MVs. Incheon.KOR 25 10 11(43).seq MVs. Incheon.KOR 25 10 14(62) MVs. Incheon.KOR 25 10 20(70) MVs. Incheon.KOR 25 10 19(69) MVs. Incheon.KOR 25 10 13(58).seq MVs. Incheon.KOR 25 10 10(41).seq MVs. Incheon.KOR 25 10 7(22).seq MVs. Incheon.KOR 25 10 3(16).seq MVs. Incheon.KOR 25 10 1(14).seq MVs. Incheon.KOR 25 10 5(19).seq MVs. Incheon.KOR 25 10 16(66) Mvs Seoul KOR 24 07 22[H1].seq Mvs Seoul KOR 24 07 26[H1].seq 2009 Korea H1 MVi Incheon KOR 20 06.seq MVi Shanghai PRC 14 03 5.seq MVi Tianjin PRC 8 03 1.seq MVi Shanghai PRC 12 03 2.seq 2010 Japan MVi Shanghai PRC 11 03 2.seq MVi Shanghai PRC 18 06 10.seq MVi Shanghai PRC 13 03 6.seq MVi Tianjin PRC 8 03 2.seq MVi Shanghai PRC 13 03 1.seq MVi Shanghai PRC 13 03 3.seq MVi Xinjiang PRC 24 03 2.seq MVi Xinjiang PRC 32 03 1.seq MVi Sichuan PRC 17 03 1.seq MVi Shannxi PRC 12 03 1.seq MVi Shanghai PRC 14 03 1.seq MVi Shanghai PRC 12 03 6.seq MV AF045212 [H1].seq MVi Sichuan PRC 12 03 1.seq MV AF079555 [D5].seq MV L46758 [D5].seq MV U01977 [D3].seq MV AF481485 [D9].seq MV U01976 [D4].seq MV AF243450 [D7].seq MV AY037020 [D7].seq MV GU440571 [d11].seq MV GU440575 [d11].seq MV AY923185 [D10].seq MV U64582 [D2].seq MV D01005 [D1].seq MV L46750 [D6].seq MV AF280803 [D8].seq MV L46753 [B3].seq MV U01998 [B1].seq MV AJ232203 [B3].seq MV U01994 [B2].seq MV U01987.seq MVi Xinjiang PRC 24 03 1.seq MV M89921 [C2].seq MV X84872 [C2].seq MV AY043459 [C1].seq MV X84879 [E].seq MV X84865 [F].seq MV AF184217 [G3].seq MV AF171232 [G2].seq MV U01974 [G1].seq MV AF045217 [H2].seq

: 2010 Measles : 2010 Measles isolated : 2007 measles

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

4 Nucleotide Substitutions (x100)

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Differential diagnosis for requested sera, 2008-2010 Positive 2008 (126 sera) Rubella Parvo B19 HHV6 Rubella Parvo B19 HHV6 Rubella Parvo B19 HHV6 10(7.9%) 19(15.1%) 46(36.5%) 7(6.4%) 9(8.3%) 45(41.3%) 15(13.6%) 10(9.1%) 23(20.9%) Equivocal 8(6.3%) 5(4.0%) 4(3.2%) 10(9.2%) 4(3.7%) 7(6.4%) 14(12.7%) 5(4.5%) 6(5.5%) Negative 108(85.7%) 100(79.4%) 74(58.7%) 92(84.4%) 96(88.1%) 57(52.3%) 81(73.6%) 93(84.5%) 79(71.8%) NT* 0 2(1.6%) 2(1.6%) 0 0 0 0 2(1.8%) 2(1.8%)

External Quality Assurance in 2010 Measles & Rubella IgM Ab test Participants : 12/17 PHERI(Provincial Health and Environmental Research Institutes), 4 Private diagnostic centers PHERI including 2010 EQA program PHERI excluding 2010 EQA program Private diagnostic center * PHERI? Provincial Health and Environmental Research Institutes

2009 (109 sera)

2010 (110 sera)**

*NT=Not tested **110 sera were requested during January to October in 2010

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Panel composition

Proficiency test in 2010 Validation of panel

Panel MR1 MR2 MR3 MR4 MR5 MR6 MR7 MR8 MR9 MR10 Positive 1 Positive 2 Positive 3 Rubella positive Rubella positive Rubella positive Negative 1 Negative 1 Negative 2 Negative 2

Measles IgM Positive Positive Positive Negative Negative Negative

Rubella IgM Negative Negative Negative Positive Positive Positive

Diagnosis Measles Measles Measles Rubella Rubella Rubella

Remarks

The panel was tested for Measles IgM at KCDC using the SIEMENS Enzygnost® anti-measles virus IgM The panel was tested for Rubella IgM at KCDC using the SIEMENS Enzygnost® anti-rubella virus IgM All panels were tested triplicate in a run and this experiment was performed 3 times. RRL (VIDRL) confirmation of 2010 EQA panels before distribution

Kits in use Participants Diagnostic Method ELISA ELISA Kits SIEMENS Enzygnost® IgM Radim (2 centers) Euroimmune (1 center) Bio-rad (1 center)

Negative

Healthy donor Healthy donor

12 PHERIs 4 Private diagnostic centers

Negative

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Proficiency test result analysis, 2010

Evaluation of 2010 EQA The panels were performed to pre-test at RRL before the distribution.

The number of rubella positive panel is increase and their Measles positive panel analysis Measles positive panel analysis

OD value were appropriate for analysis.

The OD value of measles positive panels were too low to analysis.

Rubella positive panel analysis

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Shipment arrangement Measles suspect case specimens Council of Measles elimination

Challenges or problems Need to train staffs in PHERIs for MV and rubella

Need to sequencing staff Div. Respiratory viruses Div. VPD and Control NIP Epidemiological report and characterization Div. Infectious Diseases Surveillance

Need to share genotype result among national measles Serology and virus isolation EDI reporting

laboratories

Confirmation of measles serology in RRL (VIDRL) (Shipment of 10% sera tested in KCDC) Monthly Lab reporting WPRO Annual participation in WHO EQA

Korea Centers for Disease Control and Prevention Korea Centers for Disease Control and Prevention

Thank Thank you! you!

NATIONAL MEASLES LABORATORY, NATIONAL CENTER OF COMMUNICABLE DISEASES OF MONGOLIA

The National Measles Laboratory of Mongolia is responsible to laboratory control of measles and rubella.

22-27 November, 2010

Serological laboratory Immune fluorescence laboratory Cell culture laboratory Kitchen

◦ Laboratory technologist – 1 ◦ Laboratory technicians – 2 ◦ Aid person – 1

Equipments: Biosafety cabinet class II Inverted microscope Immune fluorescent microscope ELISA reader and washer Clean bench Centrifuge -20oC and - 80oC freezer Autoclave and others PCR equipment

The National Measles Laboratory uses standard EIA techniques, virus isolation and IFA routinely. All specimen collected from suspected measles cases from over all country, testing only in National Measles laboratory. Provincial Health Departments do not test the measles and rubella cases.

NATIONAL MEASLES LABORATORY DATA (2007-2010) Specimens: - Blood (serum) - Respiratory specimens (Nasopharyngeal and throat swab), Methods - Serology: Enzygnost Anti-Measles-Virus/IgM & IgG 2007 Type of test Measles IgM Rubella IgM Measles Virus Isolation Measles PCR No. Samples tested 2030 2030 No. Positive (%) 13 (0.6) 964 (47.4) 2008 No. Samples tested 301 279 21 0 No. Positiv e (%) 30 (9.9) 67 (24.01) 2009 No. Samples tested 177 177 3 0 No. Positive (%) 3 (1.7) 3 (1.7) October 2010 No. Samples tested 130 130 0 12 No. Positiv e (%) 0 8 -

Siemens IFA - Virus isolation in Vero Slam cell

13 0

Suspected cases of measles Blood serum Measles IgM detection Measles + MV isolation CPE + IFA + NT + CPE Rubella + Discard Rubella Inform Measles -

Proficiency Test : Anti-Measles-Virus/IgM Participation of Quality Assurance Panel Year 2006 2007 RRL VIDRL VIDRL VIDRL VIDRL Result Measles - 95% Rubella - 100% Measles - 100% Rubella - 100% Measles - 100% Rubella - 100% Measles - 100% Rubella - 100%

Rubella IgM detection

2008 2009

Inform

Discard

prepare viral stock Specialized lab for genetic analysis

2009 Jan-Dec 2008

2010 Jan-Dec 2009/Jan-Aug2010

1 Measles IgM test results are reported by the laboratory within 7 days of receipt, for ≥ 80% of samples:

100% 301 Parallel testing for M &R Measles 90% Rubella 92% Partially

100% 177 /120 Parallel testing for M &R 100% 97.6% IHC initiated, not yet fully 100% 100% NA %

Year 2007 2008 2009 2010

RRL Hong Kong NIID, Tokyo NIID, Tokyo Hong Kong

Number of specimen sent to RRL & Results 25/98.2% 100/100% 10/90% 117/ measles100% rubella 97.6%

2 Serological tests are performed on at least 50 specimens annually:

3 The accuracy of measles and rubella IgM detection is ≥ 90%: 4 Internal quality control (QC) procedures are implemented: 5 The score on the most recent WHO proficiency test is ≥ 90%: Measles: Rubella:

100% 100% NA %

6 Results of virus detection and genotyping (if performed) are completed within 2 months of receipt of specimens AND data reported to WHO monthly, for ≥80% of samples appropriate for genetic analysis: In 2010, H1 strains detected from 2008-2009 samples by HK RRL. HK RRL will send genotyping results to WHO HQ on behalf of NML Mongolia 7 The score from the annual on-site review of laboratory

79/92

81/92

Kit provided: 13 Measles, 13 Rubella Additional TSA support for operational cost : increased from 5000 to 7000 USD in 2010

Strengthening of molecular epidemiological surveillance for measles and rubella. Provision with required equipments and diagnostic reagents.

Country report measles vaccination and surveillance in Japan

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 yrs A single-dose schedule (1) 12 months – 90 months

2006 June 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 yrs

Yuichiro Nakatsu Measles Laboratory, VirologyIII, National Institute of Infectious diseases, Japan

A two-dose schedule (1) 1 year children (2) 5-6 yrs children (one year before primary school entrance)

Weekly cases per sentinel from 1999 to 2007 (Data from NESID, Japan) Introduction of two-dose schedule

“Special guidance for measles” Ministry of Health, Labor and Welfare (MHLW) Dec 28, 2007

“Eliminate measles by 2012, and maintain after that.” Measles cases (<15 yrs) reported from ~ 3,000 pediatric sentinels

(1) Introduction of supplementary immunization for teenagers Adults measles cases (≥15 yrs) reported from ~ 470 sentinel hospitals

(1) Initiation of a case-based surveillance

IASR Vol. 28 (No.331) September 2007

2010.6.24

Supplementary immunization for 5 years targeting at teens from 2008 1st 2nd 1st grade of junior high school 3rd grade of high school One year before primary school entrance

MCV* coverage in 2008 ≧95.0% 90.0%－95.0% 85.0%－90.0% 80.0%－85.0% 75.0%－80.0% ＜75.0%

1-year children 2010.6.24

85.9%

77.9%

1st cohort： 94.3％ 93.6%

3rd cohort： 85.1 nd 2 cohort：％ 91.8％ 92.3%

4th cohort： 77.3％

＊MCV: 99.7% MR vaccine use 5 2010.6.24 6

Weekly measles case reports 2008～2010 Start of Supplementary immunization

Comparison of 2009 and 2010 (week 1-40) Weekly

2008 n=11,015

93% reduction

2009 n= 741

2010 (week 1-40) n=392

Total

(week)

（week 1-40）

2009 n= 662 2010 n= 392

40% reduction (week) (week)

case / million population (in each prefectures) case/million

2009

Current status of measles in Japan • Number of reported measles cases is decreasing and may become less than 500 cases/year in 2010 ( less than 4.0/million?)

< 1 case / million 4 prefectures

case/million

2010 (week 1-40)

17 prefectures

• Reduction of measles cases in 2009 & 2010 is likely attributed to measles epidemic in 2007 & 2008 as well as the new vaccination strategy started from 2008. 10

Diagnosis of measles cases 2008（N=11,007） 2009（N=741）

Destinations of samples from suspected measles cases Clinical diagnosis 41%

Laboratory diagnosis 38.2 %

Clinical diagnosis 61.8%

Hospitals/ Clinics/ Doctors Samples

Laboratory diagnosis 59 %

Health Center 2010 (week 1-40) (N=396) Laboratory diagnosis 71.7% Clinical diagnosis 28.3%

Commercial Laboratory Prefectural Institute IgM ELISA Majority 11

RT-PCR 12

Summary of test results

Viral Rash & Fever Disease Diseases Etiologic agent Measles virus Rubella virus HHV6, HHV7 EnterovirusV71, Coxsackie virus A10, A16 etc Parbovirus B19 VZV

Judge Positive Weak positive Equivocal Negative

IgM value 3 ＜ 1.2 < IgM ≦ 3 0.8 ≦ IgM ≦ 1.2 < 0.8

Proportion about 1.2％ about 3.4 % about 2.5 % about 92.9 %

Measles Rubella Exanthema subiturm (ES) Hand foot and mouth disease (HFMD) Erythema Infectiosum (the fifth disease) Varicella (chickenpox)

Age

Sex

Rash

Fever

Sampling Days (after onset)

Measles virus RT-PCR IgM

Parbovirus B19 PCR IgM

Problems of measles surveillance in Japan 1. Measles cases diagnosed with a laboratory test is slowly increasing (around 70% in 2010) More samples should be collected to prefectural laboratories / NIID for genotyping 2. Increasing false-positive cases in accordance with reduction of measles cases Several tests should be conducted to identify false positive and reach measles elimination stage

１２３４５６

41 27 45 42 31 29

F F F F F F

+ + + + + +

+ +

11 19 8 7 4

2.22 1.73 4.00 1.95 1.88 1.27

+ + + + + +

6.74 8.47 7.81 9.01 8.93 8.72

Measles IgM: positive >1.2 (Denka) ParbovirusB19 IgM: positive >1.0 (Denka)

Tanaka T et al,, 2010

COUNTRY REPORT LABORATORY SURVEILLANCE OF MEASLES & RUBELLA IN MALAYSIA

NATIONAL VACCINATION PROGRAMME • Started in 1986. • 1982 - high incidence of measles cases – 65.62 / 100,000 pop. • 1989 – 1998 – measles incidence 1.51 – 5.87 / 100,000 • Two doses of MMR vaccine; Location Peninsular Malaysia Ist. Dose MMR 12 months 12 months 6 months (single dose measles) 12 months (1st dose MMR) 2nd dose MMR 7 year 7 year 7 year

SOUTH CHINA SEA

Sarawak BRUNEI

STRAITS OF MALACCA

WAN NORAINI WAN YUSSOF VIROLOGY SECTION NATIONAL PUBLIC HEALTH LABORATORY

Sabah

Vaccination Coverage

LABORATORY SURVELIIANCE

DIRECTOR Senior Medical Officer

Consultant Virologist

VIROLOGY DIVISION Senior Science Officer

SEROLOGY LAB Science Officer (2) Ass. Science officer (1) Medical Lab Tech (3)

VIRUS ISOLATION LAB Sr Science Officer (1) Science Officer (2) As. Science Officer (3) Medical Lab Tech (6)

MOLECULAR LAB Sr Science Officer (1) Science Officer (1) Ass. Science Officer (1) Med Lab Tech (2)

METHODS SEROLOGY TEST ELISA Methods • Measles IgM/ IgG - Enzygnost (Siemens) • Rubella IgM/ IgG - Enzygnost (Siemens) State Perlis Kedah P.Pinang Perak Selangor WPKL N.Sembilan Melaka Johor Pahang Terengganu Kelantan Sabah Sarawak WP Labuan Malaysia

MEASLES INCIDENCE 2009 Population 240,700 2,000,000 1,577,300 2,393,300 5,111,400 1,723,300 1,013,900 769,300 3,385,200 1,543,300 1,121,100 1,634,200 3,201,000 2,503,600 89,000 28,306,600 Suspected Cases 12 263 3 191 394 145 15 17 67 47 545 425 43 56 0 2223 Laboratory Confirmed 0 1 1 2 16 17 0 0 1 3 4 3 3 0 0 51

VIRUS ISOLATION • Vero/SLAM cell • Direct Immunofluorescence Assay (IFA)

MOLECULAR DETECTION • rt-PCR / RT-PCR (Measles & Rubella)

MEASLES INCIDENCE 2010 State Perlis Kedah P.Pinang Perak Selangor WPKL N.Sembilan Melaka Johor Pahang Terengganu Kelantan Sabah Sarawak WP Labuan Malaysia Population 240,700 2,000,000 1,577,300 2,393,300 5,111,400 1,723,300 1,013,900 769,300 3,385,200 1,543,300 1,121,100 1,634,200 3,201,000 2,503,600 89,000 28,306,600 Suspected cases 8 111 14 60 268 115 55 8 39 38 82 139 58 161 0 1,156 Laboratory Confirmed 3 20 0 2 14 4 0 0 2 1 3 1 0 1 0 51

TESTING ALGORITHM FOR MEASLES & RUBELLA (IgM) Measles IgM

TESTING ALGORITHM FOR MEASLES & RUBELLA (virus isolation) MEASLES VIRUS ISOLATION NO VIRUS ISOLATED ISOLATED RUBELLA virus isolation

Positive

Equivocal

Negative

Final Report Measles Virus Isolation : Measles Virus Isolated ISOLATED NO VIRUS ISOLATED

Retest in duplicate

Rubella IgM Send culture to Molecular laboratory for confirmation Final Report Measles Virus Isolation : No Virus Isolated Rubella Virus Isolation : Rubella Virus Isolated Final Report Measles Virus Isolation : No Virus Isolated Rubella Virus Isolation : No Virus Isolated

Positive

Equivocal

Negative

Positive

Equivocal

Negative Measles/Rubella rt PCR

Request second sample within 2 weeks from first sample Positive PCR

Retest in duplicate DETECTED NOT DETECTED

Equivocal

Negative

Genotyping

Request second sample within 2 weeks from first sample

Final Report Measles/ Virus rt PCR : Measles/ Rubella Virus detected

Final Report Measles/ Virus rt PCR : Measles/ Rubella Virus Not Detected

Send PCR Product for Measles/Rubella Genotyping

Year

No of samples 1176 3046 2269 739

Positive cases % Positivity 44 90 56 46 3.70% 3% 2.50% 6.20%

Measles IgM Detection

2007 2008 2009 2010 #

Rubella IgM Detection

Year 2007 2008 2009 2010 #

No of samples 943 2068 3184 730

Positive cases 468 851 1243 99

% Positivity 49.60% 41% 42.20% 13.60%

Virus Isolation

Year 2007 2008 2009 2010#

Specimens 208 221 124 68

Positive 0 9 1 1

Measles & Rubella Detection 2007 Type of test No of Positive samples (%) 1176 44 (3.7%) 468 (49.6%) 0 (0%) 2008 No of samples 3046 Positive (%) 90 (3%) 851 (41.2%) 9 (4%) 2009 No of samples 2269 Positive (%) 56 (2.5%) 1243 (42.2%) 1 (0.8%) 2010 # No of samples 739 Positive (%) 46 (6.2%)

Measles IgM

Rubella IgM Measles Virus Isolation Measles PCR

943

2068

3184

730

99 (13.6%)

208

221

124

3 (60%)

Genotyping

# Data as month of October 2010

PROFICIENCY TEST Year Measles IgM Rubella IgM 2007 100% 100% 2008 100% 100% 2009 100% 2010

CONFIRMATORY TESTING RESULTS 2007 Measles IgM Rubella IgM 95% 100% 2008 95% 95% 2009 100% 97.9% 2010 100% 100%

100% 2009 & before – specimen send to VIDRL (Australia) 2010 – specimen sent to RRL (Hong Kong), May & Dec

GENOTYPING Year Genotyping Year 2009 2008 2008 2008 2008 2008 2008 Lab No. M1/09/11 M1/08/01 M1/08/11 M1/08/14 M1/08/22 M1/08/112 GV/08/320

LAB. INDICATORS 2010 2010 G3 (2) Measles Genotyping G3 D9 D9 D9 D9 D9 D9

2007 Location Selangor Selangor Selangor Selangor Selangor Kuala Lumpur Kuala Lumpur

2008 D9 (6)

2009 G3 (1)

Indicators Measles IgM test results are reported by the laboratory within 7 days of receipt, for ≥ 80% of samples: Serological tests are performed on at least 50 specimens annually: The accuracy of measles and rubella IgM detection is ≥ 90%: Internal quality control (QC) procedures are implemented: The score on the most recent WHO proficiency test is ≥ 90%: The score from the annual on-site review of laboratory operating procedures and practices is ≥ 80%:

Achievement 98.5% Measles IgM : 739 Rubella IgM : 730 Measles IgM : 100% Rubella IgM : 100% Yes (IHC) Not yet receive PT sample for 2010 97%

Virus Isolates Measles virus isolated Measles virus isolated Measles virus isolated Measles virus isolated Measles virus isolated Measles virus isolated Measles virus isolated

CHANGES FOLLOWING RECOMMENDATIONS FROM WPRO (2009) 1) To standardize flow chart for diagnosing measles and rubella (surveillance & outbreak / acute case) - 2010. 2) Use of Vero/SLAM cells for the isolation of measles and rubella viruses - but isolation rate is very low. 3) Use of serum samples with early onset for molecular detection of measles and rubella viruses; equivocal & selected positive IgM specimen (Dis 2010).

4) Sending of specimen to NPHL : MOH Circular requesting all hospitals and health clinic to send all request for measles screening to NPHL only. 5) Rubella were also included in the Sistem Maklumat Siasatan Measles (SM2) 2 emeasles notification. 6) Timely data reporting* 7) Molecular surveillance a. To submit representative genotype /sequence information on their measles and rubella viruses to the WHO genotype / MeaNS database or gene bank b. Detection of viral RNA in archival sera

CURRENT STATUS • New guideline on surveillance (MEP Circular); 1) Emphasize more on specimen collection esp. within first 5 days of rash 2) Cover both rubella & measles 3) Notification of suspected cases (measles / rubella) 4) Strengthening lab. base surveillance genotyping 5) Measles road-show by zone (in Nov, Dec 2010 & Jan 2011) followed by state & district.

National Measles Vaccination Programme

Country Report Measles Laboratory National Institute of Hygiene and Epidemiology (NIHE), VIETNAM

• 1985: Vaccination for children from 9 – 11 months • 2002 – 2003: Campaign for children from 9 month to 10 years old • 2006 - 2009: Vaccination with 2 doses: - The first dose: at age of 9 – 11 month - The second dose: at age of 6 years old • Sep – Nov.2010: Campaign for children under 6 years old (Nationwide) • 2010: - The first dose: at age of 9 – 11 month - The second dose: at age of 18 month

ELISA kit used for Measles and Rubella IgM testing

National Surveillance Data from 2009 to Nov. 2010

• ELISA kits used for Measles and Rubella: - Siemens (provided by WHO) - Bio-rad (provided by NIHE)

Testing algorithm used for measles and rubella Year Serum

Timeline of sample testing ≤ 7 day No. 2009 2315 930 % 57 87 >7 day No 1735 137 % 43 13 4050 1067 Total

Suspected

Throat swab

Virus Isolation/Vero-SLAM cell CPE No CPE

IgM M (R)

+ Confirmed M (R)

IgM R (M)

RT-PCR/Measles

RT-PCR/Rubella

Nov. 2010

+ Confirmed Measles

Negative

+ Confirmed R (M)

Negative

Measles IgM Testing Year No. of samples No. of samples tested 3890 Positive No. 2187 % 56 Siemens, Biorad Siemens, Biorad Kits used Year

Rubella IgM Testing No. of samples No. of samples tested 2208 Positive No. 545 % 25 Siemens, Biorad Siemens, Biorad Kits used

2009

4050

2009

4050

Nov. 2010

1067

788

225

2010

1067

867

389

QA measures 0.6

IHC – Measles/Dade Behring 0.5 0.4 0.3 S eries1

- In-house quality control samples - Proficiency test - Confirmatory testing by RRL

0.2 0.1 0 2/22/2010 3/22/2010 4/19/2010 5/17/2010 5/31/2010 6/14/2010 6/28/2010 7/12/2010 7/26/2010 8/23/2010 2/8/2010 3/8/2010 4/5/2010 5/3/2010 8/9/2010 9/6/2010

Results of Proficiency testing Years No. of tested 2006 2007 2008 2009 20 20 20 20 Measles Kit used Score No. of tested Denka Seiken Bio rad Bio rad Dade Behring 100 100 100 100 20 20 20 20 Rubella Kit used Score Dade Behring Bio rad Bio rad Dade Behring 100 100 2009 100 100 2010

Confirmatory testing Years No. of sample (Measles) 60 Result No. of sample (Rubella) 40 Result

2007 - 2008

100%

90%

97%

96%

Measles virus Isolation Year 2006 2008 2009 2010 No. of Throat swab 18 42 106 9 CPE No. 6 16 23 1 % 33.3 38 22 11 Confirmed by RT-PCR

Lab No.

Age

Sex

Province

Year

Result Serolory Measles IgM Rubella IgM

Isolation CPE Type of CPE

1 2 3 4 5

18 37 14m 20 20 23 25 23 20m

M M F F M M F M M

Ninh Binh Ninh Binh Ninh Binh Ha Noi Ha Noi Ha Noi Ha Noi Bac Giang Ha Giang

2008 2008 2008 2008 2008 2008 2008 2009 2010

Pos Pos Pos Pos Pos Pos Pos Pos Pos

Neg Neg Neg Neg Neg Neg Neg Neg Neg

4+ 4+ 4+ 4+ 4+ 4+ 4+ 4+ 4+

Roud, swollen Roud, swollen Roud, swollen Roud, swollen Roud, swollen Roud, swollen Roud, swollen Roud, swollen Roud, swollen

No. 6 16 23 1

Pos. 6 (100%) 16 (100%) 23 (100%) 1 (100%)

6 7 8 9

Thank you for your attention

PHILIPPINES COUNTRY REPORT MEASLES DATA 2010 4th Regional Hands-on Training Workshop on the Laboratory Diagnosis of Measles and Rubella Focusing on Molecular Diagnosis Public Health Laboratory Centre, Hong Kong (China) 22 to 27 November 2010

Measles Referral by Month

Measles and Rubella Positives by Region (2010)

2010 Measles Positives by Age Group

Measles Positivity Rate 1999-2010* (*as of 12Nov2010)

Rubella Positivity Rate 1999-2010* (*as of 12Nov2010)

Measles In-House Control 2010

Rubella In-House Control 2010

Measles & Rubella Virus Isolation

egional

eference

aboratory (CHP, Hong Kong)

Referrals for Retesting (March 2010) Rubella Virus Isolation

Results Measles + Rubella + Negative On-going TOTAL

IF 19 4 78 0 101

RT-PCR 12 0 0 12

Pending 6 6

Total 31 4 78 6 119

Sample Type NPS NPS/OPS OPS ITCF

Count 11 7 1 1

RT-PCR + 1 1 -

Genotype

Region NCR NCR -

1j -

egional

eference

aboratory (CHP, Hong Kong)

egional

eference

aboratory (CHP, Hong Kong)

Referrals for Retesting (March 2010) Measles Virus Isolation Sample Type NPS NPS/OPS OPS ITCF Count 11 7 1 1 RT-PCR + 3 1* 1* Genotype Region 4A, 11 NCR RRL Results Equivocal Positive Negative

Referrals for Retesting (June 2010) Measles IgM Equivocal, 10 Samples Count 6 2 2 RT-PCR + 1 1 Genotype Region 6 6

D9 -

1* same patient

egional

eference

aboratory (CHP, Hong Kong)

egional

eference

aboratory (CHP, Hong Kong)

Referrals for Retesting (June 2010) Measles IgM Positive, 50 Samples RRL Results Positive Equivocal Count 47 3 RT-PCR + 2 2 Genotype Region 12, NCR NCR, 7 Sample Type NPS/OPS NPS ITCF

Referrals for Retesting (June 2010) Measles Genotyping, 26 Samples Count 7 6 13 Measles VI + + Not Done RT-PCR+ 3 3 Genotype D9 D9 Region NCR NCR -

D9 D9

Distribution of Measles and Rubella Genotypes

NCR/D9/1j

4A/D 9

THANK YOU! 7/D9 11/D 9

6/G3

12/D 9

23/07/2012

Lab diagnosis

Virology Laboratory, Singapore General Hospital

Singapore National Measles & Rubella Laboratory 4th Regional Hands-on Training Workshop on the Lab Diagnosis of Measles & Rubella focusing on Molecular Diagnosis

Virology Laboratory, Department of Pathology, Singapore General Hospital (SGH). Main role of Virology Lab: provides laboratory diagnostic services for virus infections for patients from SGH and other hospitals, as well as clinics in Singapore. Serves as WHO national laboratory for Poliovirus, Measles and Rubella virus. Laboratory diagnosis for measles in Singapore is done mainly in the Virology Lab. 2

Lab diagnosis

Laboratory Staff and Accreditation Staff Structure Medical Virologist Scientific Officer Medical Technologist Health Care Attendant Clerk 1 3 20 3 2

Virological Testing Methods Virus Isolation Antigen Detection Immunofluorescence Assay EIA Chromatographic Assay

Antibody Detection EIA Immunofluorescence Assay

Laboratory Accreditation College of American Pathologists (CAP) accredited lab. Accredited as WHO Measles and Rubella national lab since 2006. Participates in CAP, RCPA, WHO & CDC PT programme.

Complement Fixation Test Haemagglutination Test Particle Agglutination Test

Virus Genotyping Sequencing 3 4

Lab diagnosis

Shipment arrangement to RRL or GSL Accredited for WHO Measles and Rubella national lab since 2006. Representative measles and rubella IgM samples were sent to RRL for confirmation. 15 measles and 15 rubella samples were sent to RRL (Hong Kong) in March 2009. Self-funded

Measles & Rubella IgM PT & confirmatory testing results

Proficiency Testing (2009) Measles IgM Rubella IgM

Confirmatory Testing (sent to RRL, HK) (2009) Measles IgM 14/15 (93.3%) Rubella IgM 15/15 (100%)

100%

23/07/2012

Lab diagnosis

QA Measures The Laboratory College of American Pathologists (CAP) accredited lab. Participates in CAP, RCPA, WHO & CDC PT programme.

Measles and Rubella Testing Methods and Algorithm ELISA kits used for measles and rubella IgM testing Siemen Enzygnost Anti-Measles IgM EIA assay Siemen Enzygnost Anti-Rubella IgM assay

Laboratory staff Technical staff are trained and competency assessed bef performing lab testing.

Quality control QC data assessed and monitored for each run. Kit controls and in-house controls are included. Results are assessed and validated before reporting.

Testing algorithm Tests are carried out based on requests from clinicians MOH, Singapore is notified positive cases Monthly data is reported to WHO and MOH, Singapore

Equipment function monitoring and maintenance All equipment are on scheduled maintenance programme. Daily monitoring of temperature sensitive equipment. Pipette calibration 7 8

Background

Measles Incidence in Singapore Number of reported measles cases has rapidly declined with the introduction of compulsory measles vaccination in Aug 1985. In 1992 and 1997, there was an increase in the number of reported cases, affecting all age groups. The “catch-up” immunization initiative was implemented in Jul Nov 1997 and the two-dose MMR vaccination regime was implemented in Jan 1998. The incidence of measles has remained at a low level since then. In 2005, a national sero-prevalence survey showed an overall sero-prevalence of 96.7% for measles. 9

Incidence of reported measles cases in Singapore

Lab diagnosis

Background

Rubella Incidence in Singapore In 2005, a national sero-prevalence survey showed an overall sero-prevalence of 87.4% for rubella in those aged 18-74. 15.8% of females 18-44 years of age remained susceptible to rubella infection. No reported case of congenital rubella and termination of pregnancy in 2009 due to rubella infection.

Measles & Rubella reporting to WHO, 2010 Jan - Oct 2010 Measles IgM tests done (n=159) Rubella IgM tests done (n=701) Measles genotyping done (n=13) on Measles isolates

23/07/2012

Lab diagnosis

Measles & Rubella IgM tests done (Monthly Distribution) Measles & Rubella IgM tests done (Monthly Distribution) 350 300 250

Measles & Rubella IgM Positive (Monthly Distribution) Measles & Rubella IgM Positive Monthly Distribution 2007 - Oct 2010 18 16

314

17 13

No. of tests done

No. of Positive Specimens

14 12 10 8 6 4 2 0

200 150

105 100 50 0

l -0 8

l -0 9

l -1 0 Ju

l -0 7

pr -0

r- 1

ct -0

Ja n0 Ap 7 r-0 Ju 7 l-0 O 7 ct -0 Ja 7 n0 Ap 8 r-0 Ju 8 l-0 O 8 ct -0 Ja 8 n0 Ap 9 r-0 Ju 9 l-0 O 9 ct -0 Ja 9 n1 Ap 0 r-1 Ju 0 l-1 O 0 ct -1 0

ct -0

Measles-IgM Total

Rubella-IgM Total

Measles-IgM Pos

Rubella-IgM Pos

ct -1

Lab diagnosis

Year 2010 (Jan –Oct) data Measles-IgM Mth Jan Feb Mar Apr May Jun Jul Aug Sep Oct Total Neg 14 11 15 9 15 20 11 26 13 6 140 1 16 3 1 1 Pos 4 1 2 4 2 1 Equi 2 Total 20 12 17 13 18 20 12 27 13 7 159 Neg 286 53 29 34 32 25 29 83 24 33 628 17 1 1 43 30 Rubella-IgM Pos 13 2 4 3 1 1 2 1 2 2 3 5 Equi 15 Total 314 55 35 38 35 28 32 105 25 34 701 Neg 18 12 15 14 18 10 19 29 15 11 161 1 0 1 Measles-isolation Pos Inc Total 18 12 15 14 18 10 19 30 15 11 162

Measles Virus Genotyping Samples sent for measles Ag testing were cultured in order to study measles genetic information. 24 measles isolates (2007-Oct 2010) were sequenced. The common circulating measles strains belong to the genogroup D. Year 2007 Genogroup D5 D9 D9

No. of isolates 1 2 1 4 1 1 1 1 2 10

2008 D4 H1

2009

D8 D9 H1

2010 (Jan-Oct)

G3 D9

Lab diagnosis

Measles Virus Genotyping MVi/Singapore.SGP/01.10 [G3] 6 year old, male, Indonesian, reside in Singapore Travel to Indonesia from 3rd Oct – 20th Dec 2009 Developed fever on 28th Dec 2009 Nasopharyngeal aspirate – measles Ag test on 2nd Jan 2010

Challenges, Problems • Test is performed based on clinician’s request, paid by patients. • WHO algorithm for measles and rubella testing is not followed because no funding to support additional testing. • Little clinical and epidemiological information is available. So it is difficult to supply this information to WHO.

MVi/Singapore.SGP/02.10/1 [G3] 3 year old, female Same travel history Developed same symptoms 2 days later Nasopharyngeal aspirate – measles Ag test on 5th Jan 2010

23/07/2012

Thank you

MEASLES AND RUBELLA SURVEILLANCE IN SOUTHERN OF VIET NAM 2009-2010

Roles _Perform the isolation and identification : Measles and Rubella virus _Detect and control the outbreak _Conduct trainings

ðANG THANH GIANG Pasteur institute ,Ho Chi Minh City, Viet Nam Nov- 22-2010 HONGKONG _Collaborate with WHO , - PT - Re-testing.

Specimen & Method Specimen: Serum,Throat swab. Specimen collection - Serum : 4- 28 days after on set. - Throat swab :0-7 days after onset Detection method: - ELISA : - Virus isolation using Vero/h/Slam cells - RT-PCR: +Measles :MMRHLB,SOP 8 VER 1.06/3/2008 +Rubella :RV11,RV12 – Sequence analysis: N gene (545 bp)

DISTRIBUTION OF MEASLES AND RUBELLA IgM POSITIVE BY MONTH IN SOUTHERN OF VIET NAM 2009-2010 Case 500

Measles Positive 2009(2181) 450 400 350 300 250 200 150 100 50 M onth

Measles Positive 2010(877)

0 1 2 3 4 5 6 7 8 9 10

Rubella Positiv e 2009(985) Rubella Positiv e 2010(1523) 600 Ca s e

DISTRIBUTION (%) BY SEX 2010 Meas les Ig M Pos itive R ubella Ig M Pos itive

500

400

300

30% M

37% 63%

M F

200

70%

100

Month

0 1 2 3 4 5 6 7 8 9 10

DISTRIBUTION(%) BY AGE 2010 Measles IgM Positive

DISTRIBUTION(%) BY AGE 2010 1000 900 800 700

case 60%

Rubella IgM Positive

case 450 400 350 300 250

51%

29%

600 500 400

24%

200 150 100 50 0 0-6 6-24 25-60 > 60 Un

15% 5% 0% age

300 200 100 0 0-6 7-24 25-60 > 60 Un

9% 0%

age

QA Measures Annual Proficiency test Annual Reconfirmation test Annual On-site review QC data is accessed and monitored for each run of testing, kit controls and in-house controls are included and the results are accessed to validate the test run before reporting

Measles & Rubella IgM PT Results Year 2004 2005 2006 2007 2008 2009 Measles IgM Rubella IgM PT PT 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100%

RE-TESTING Year 2007 2008 2009 Measles IgM PT 100% 100% 100% Rubella IgM PT 100% 100% 100%

THANKS FOR YOUR ATTENTION!

ANNEX 5 WHO Measles and Rubella Workshop 22-27 November 2010

World Health Organization

HANDS-ON TRAINING ON MOLECULAR EPIDEMIOLOGY OF MEASLES AND RUBELLA

Instructions and Protocols for Practical

22-27 November 2010 Public Health Laboratory Centre Centre for Health Protection Hong Kong SAR, China

ANNEX 5 WHO Measles and Rubella Workshop 22-27 November 2010

Table of Contents

Day 1, Monday, 22 November

Practical 1: Practical 2a:

Extraction of measles and rubella RNA RT-PCR for rubella detection

2 5

Practical 2b: RT-PCR for rubella genotyping Day 2, Tuesday, 23 November Practical 3: Practical 4: Practical 5: Practical 6: Practical 7: RT-PCR for measles genotyping Gel electrophoresis of rubella detection and genotyping RT-PCR Gel electrophoresis of measles genotyping RT-PCR PCR purification for measles and rubella genotyping RT-PCR Gel electrophoresis of purified PCR products (measles and rubella) 7 8 10 11 12 15 16 17 19 20 21 22 23 24

Day 3, Wednesday, 24 November Practical 8: Cycle sequencing (measles and rubella) Practical 9: Purification of cycle sequencing products (measles and rubella) Practical 10: Sequencing run Day 4, Thursday, 25 November Practical 11: Sequence analysis for measles virus genotyping Day 5, Friday, 26 November Practical 12: Sequence analysis for rubella virus genotyping

WHO Measles and Rubella Workshop 22-27 November 2010

Day 1, Monday, 22 November Objectives: 1. To perform RNA extraction of measles and rubella with simulated samples 2. To perform RT-PCR for rubella detection and genotyping Time and location: 13:30-15:00 Practical 1: Extraction of measles and rubella RNA (Location: Room 906 & Room 907) 15:30-17:00 Practical 2: RT-PCR for rubella detection and genotyping (Location: Room 809, Room 811 & Room 817)

Practical 1: Extraction of measles and rubella RNA References: QIAamp® Viral RNA Mini Handbook, Third Edition, December 2007. Qiagen. Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 2-4. Materials/Reagents/Equipment provided: Vials containing simulated samples to be extracted Filter paper samples containing measles/rubella sample to be extracted Bottle containing Buffer AVL* (pre-aliquot) 1X PBS QIAamp spin columns* Buffer AW1 with ethanol* Buffer AW2 with ethanol* Buffer AVE* Vial of lyophilized carrier RNA* Collection tubes 1.5ml screw cap vials (self-standing) 1.5ml snap cap vials Absolute ethanol (96-100%) Microcentrifuge Micropipettes Aerosol-free pipette tips Vortex mixer Timer Page 1

WHO Measles and Rubella Workshop 22-27 November 2010

Ice bucket Biological safety cabinet Worksheet for RNA extraction (Appendix 1) *Reagents from QIAamp® Viral RNA Mini kit or reagents prepared from content of the kit. Buffers AW1 and AW2 (with ethanol added) will be provided. Please refer to the kit handbook for preparation of these buffers when using the new kit. Procedures (Room 906 & Room907) (1) (2) Add 310µl Buffer AVE to the vial containing lyophilized carrier RNA to dissolve thoroughly. Aliquot 100µl of dissolved carrier RNA to the bottle containing 10ml pre-aliquot Buffer AVL. Gently mix by inverting the bottle 10 times to avoid foaming. Freeze the remaining carrier RNA at –20oC. (Refer Table 1 in the kit handbook for corresponding volumes of carrier RNA and Buffer AVL needed.) (3) Aliquot 600µl of Buffer AVL with carrier RNA into two 1.5ml snap cap vials for filter paper samples. Aliquot 560µl of Buffer AVL with carrier RNA into another six 1.5ml snap cap vials. 8 simulated samples (including two filter paper samples, one for measles and one for rubella) will be provided for RNA extraction (4 for measles, labeled as M1-M4; and 4 for rubella, labeled as R1-R4). Vortex briefly the thawed vials containing the simulated samples and pulse-spin the content. Label 8 vials containing the Buffer AVL with carrier RNA according to the worksheet (Appendix 1). Store the rest of the vials at 4oC for later use. Put the filter papers circle into the Buffer AVL (560µl) and add 150µl 1X PBS. Mix by pulse-vortexing for 15 seconds. Incubate at room temperature for 10 minutes. In a biological safety cabinet, pipette 140µl of each sample to a vial of Buffer AVL, according to specific order written on the worksheet (Appendix 1).

(4)

(5) (6) (7) (8) (9)

Mix the content in the vials by pulse-vortexing for 15 seconds and incubate at room temperature for 10 minutes. (10) Label the spin columns and the 1.5ml screw cap vials (for storing extracted RNA) accordingly. (11) Centrifuge the vials containing the filter papers at 13,000 for 2 minutes. Transfer 600µl of the liquid to a new 1.5ml snap cap vial. Add 600µl absolute ethanol. Briefly centrifuge the other vials after the 10-minute incubation. Add 560µl absolute ethanol (96-100%) to the each vial and mix by vortexing for 15 seconds. (12) Pulse-spin all the vials.

Page 2

WHO Measles and Rubella Workshop 22-27 November 2010

(13) Open the cap of the spin columns one by one and transfer 630µl of the solution from the vials to the corresponding spin column. Close the cap and centrifuge at 6,000 × g (8,000 × rpm) for 1 minute. (14) Place the spin columns in clean 2ml collection tubes and discard the collection tubes containing the filtrate. (15) Repeat steps (13) − (14). (16) Open the cap of the spin columns one by one and add 500µl Buffer AW1. Close the cap and centrifuge at 6,000 × g (8,000 × rpm) for 1 minute. [Note: Use a new pipette tip when adding buffer to each column]

(17) Place the spin columns in clean 2ml collection tubes and discard the collection tubes containing the filtrate. (18) Open the spin columns one by one and add 500µl Buffer AW2. Close the cap and centrifuge at 16,100 × g (13,200 × rpm) for 3 minutes. [Note: Use a new pipette tip when adding buffer to each column] (19) Place the spin columns in clean 2ml collection tubes and centrifuge at 16,100 × g (13,200 × rpm) for another 1 minute. (20) Place the spin columns in clean 1.5ml snap cap vials (cut away the caps by scissors) and discard the collection tubes containing the filtrate. (21) Open the caps of the spin columns and add 60µl Buffer AVE equilibrated to room temperature. (22) Close the cap of the spin columns and incubate at room temperature for 1 minute. (23) Centrifuge at 6,000 × g (8,000 × rpm) for 1 minute. (24) Remove the spin columns one by one from the 1.5ml snap cap vials and transfer the eluated RNA into the 1.5ml screw cap vials. Keep the vials on ice. Practical 2a: RT-PCR for rubella detection Practical 2b: RT-PCR for rubella genotyping References: QIAGEN® OneStep RT-PCR Kit Handbook. February 2008. Qiagen. Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 6-13.

Page 3

WHO Measles and Rubella Workshop 22-27 November 2010

Materials/Reagents/Equipment provided: Qiagen One-Step RT-PCR kit 3 vials of rubella detection primers (RV11, RV12 and RV12-2) 4 vials of rubella genotyping primers (8633F, 9112R, 8945F and 9577R) 1 vial of RNase Inhibitor (ABI) 1.5ml screw cap vials (self-standing) 1 vial of rubella synthetic RNA control 1 vial of molecular grade water (as negative control and diluent) Micropipettes Aerosol-free pipette tips 0.2ml PCR tubes Vortex mixer Microcentrifuge Tomy centrifuges (for 1.5ml and 0.2ml tubes)

Ice bucket ABI 9700 thermal cycler Biological safety cabinet/PCR workstation Worksheet for rubella detection RT-PCR (Appendix 2) Worksheet for rubella genotyping RT-PCR (Appendix 3) Procedures Preparation of master mix (Room 811) (1) (2) (3) (4) Three master mixes will be prepared for the two PCR protocols (detection and genotyping). Prepare the RT-PCR master mix in biological safety cabinet or PCR workstation. Thaw the kit reagents and primers except enzymes. Vortex briefly to mix the content. Pulse-spin and keep on ice Fill in the worksheets (Appendices 2 and 3) of RT-PCR for rubella detection and genotyping respectively. Calculate the number of reactions and volume of reagents needed for each RT-PCR. Label three self-standing screw cap 1.5 ml vial for each RT-PCR master mix (one for detection RT-PCR and two for genotyping RT-PCR). Aliquot appropriate amount of each reagent into the 1.5 ml screw cap vial, according to the worksheets. Vortex briefly to mix the content in the vials. Pulse-spin the vials and keep them on ice. Page 4

(5) (6) (7)

WHO Measles and Rubella Workshop 22-27 November 2010

(8)

Label the 0.2ml PCR tubes according to worksheets and keep them on ice.

(9) Aliquot 45µl of master mix to each set of 0.2ml PCR tubes. (10) Keep the PCR tubes on ice. RNA template addition (Room 809) (1) (2) Aliquot 5µl of extracted RNA to the each set of PCR tubes accordingly. Aliquot 4µl of water to PCR tubes for adding rubella synthetic RNA control in detection RT-PCR and 3’ (Fragment 2) genotyping fragment RT-PCR. Aliquot 2µl of water to PCR tube for adding rubella synthetic RNA control in 5’ (Fragment 1) genotyping fragment RT-PCR. (3) Aliquot 1µl of rubella synthetic RNA control to the corresponding PCR tubes in detection and 3’ (Fragment 2) genotyping RT-PCR. Aliquot 3µl of rubella synthetic RNA control to the PCR tube in 5’ (Fragment 1) genotyping RT-PCR. (4) (5) (6) Aliquot 5µl of water as negative control to the corresponding PCR tubes. Vortex briefly to mix the content. Pulse-spin the PCR tubes. Place the PCR tubes into thermal cycler (Location: Room 817). Start the PCR run with the PCR conditions as shown below. Make sure the thermal cycler is preheated to 50oC before placing PCR tubes in it. Cycling parameters of RT-PCR for rubella detection/genotyping 95oC 15 min 50oC 30 min 94oC 30 sec 60oC 30 sec 40 cycles 72oC 1 min 72oC 10 min 4oC ∞

Day 2, Tuesday, 23 November Objectives: 1. To perform RT-PCR for measles genotyping 2. To perform gel electrophoresis of RT-PCR for rubella detection and genotyping 3. To perform gel electrophoresis of RT-PCR for measles genotyping 4. To purify positive PCR products of RT-PCR for measles and rubella genotyping 5. To perform gel electrophoresis with purified PCR products (measles and rubella) Time and location: 09:00-10:00 10:00-11:30 Practical 3: RT-PCR for measles genotyping (Location: Room 809, Room 811 & Room 817) Practical 4: Gel electrophoresis of RT-PCR for rubella detection and genotyping Page 5

WHO Measles and Rubella Workshop 22-27 November 2010

(Location: Room 817) 13:30-15:00 Practical 5: Gel electrophoresis of RT-PCR for measles genotyping (Location: Room 817) Practical 6: PCR purification of RT-PCR for measles and rubella genotyping (Location: Room 817) 16:30-17:45 Practical 7: Gel electrophoresis of purified PCR products (measles and rubella) (Location: Room 817) Practical 3: RT-PCR for measles genotyping References: QIAGEN® OneStep RT-PCR Kit Handbook. February 2008. Qiagen. Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 14-17. Measles Genotyping Kit Version 2.0 insert, CDC. Materials/Reagents/Equipment provided: Qiagen One-Step RT-PCR kit 2 vials of measles detection primers (MeV216 and MeV214)* 1 vial of RNase Inhibitor (ABI) 1.5ml screw cap vials (self-standing) 1 vial of measles synthetic RNA control* 1 vial of molecular grade water (as negative control and diluent) Micropipettes Aerosol-free pipette tips 0.2ml PCR tubes Vortex mixer Microcentrifuge Tomy centrifuges (for 1.5ml and 0.2ml tubes) Ice bucket ABI 9700 thermal cycler Biological safety cabinet/PCR workstation Worksheet for measles genotyping RT-PCR (Appendix 4) *Reagents from Measles Genotyping Kit Version 2.0, CDC.

15:30-16:30

Page 6

WHO Measles and Rubella Workshop 22-27 November 2010

Procedures Preparation of master mix (Room 811) (1) (2) (3) (4) (5) (6) (7) (8) (9) Prepare the RT-PCR master mix in biological safety cabinet or PCR workstation. Thaw the kit reagents and primers except enzymes. Vortex briefly to mix the content. Pulse-spin and keep on ice. Fill in the worksheet (Appendix 4) of RT-PCR for measles genotyping. Calculate the number of reactions and volume of reagents needed. Label one self-standing screw cap 1.5 ml vial for the RT-PCR master mix. Aliquot appropriate amount of each reagent into the 1.5 ml screw cap vial, according to the worksheet. Vortex briefly to mix the content in the vial. Pulse-spin the vial and keep it on ice. Label the 0.2ml PCR tubes according to worksheet and keep them on ice. Aliquot 45µl of master mix to each 0.2ml PCR tube. Keep the PCR tubes on ice.

RNA template addition (Room 809) (1) (2) (3) (4) (5) (6) Aliquot 5µl of extracted RNA to the PCR tubes accordingly. Aliquot 4µl of water to PCR tube for adding measles synthetic RNA control. Aliquot 1µl of measles synthetic RNA control to the corresponding PCR tube. Aliquot 5µl of water as negative control to the corresponding PCR tube. Vortex briefly to mix the content. Pulse-spin the PCR tubes. Place the PCR tubes into thermal cycler (Location: Room 817). Start the PCR run with the PCR condition as shown below. Make sure the thermal cycler is preheated to 50oC before placing PCR tubes in it.

Cycling parameters of RT-PCR for measles genotyping 95oC 15 min 50 C 30 min o

94oC 30 sec

40 cycles 72oC 55oC 30 sec 30 sec 72oC 10 min 4oC ∞

Page 7

WHO Measles and Rubella Workshop 22-27 November 2010

Practical 4: Gel electrophoresis of rubella detection and genotyping RT-PCR Reference: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 18-20. Materials/Reagents/Equipment provided: 2% agarose solution* Gel casting tray and combs Microwave oven 1 vial of 1X TBE buffer SYBR SafeTM DNA gel stain Agarose gel tanks Power supply Micropipettes Aerosol-free pipette tips Tomy centrifuge (for 0.2ml tubes) 96-well plates (U-bottomed) 1 vial of 6X loading dye 1 vial of 100bp DNA ladder Gel documentation system Procedures (Room 817) Preparation of agarose gel *Note: pre-cast agarose gels will be provided (1) Loosen the cap of the bottle containing the agarose gel. Melt the agarose gel in microwave. Avoid overheating. Swirl from time to time. (2) (3) (4) (5) (6) After the gel is melted completely, leave it at room temperature for 5 minutes. Assemble the gel casting tray and together with the combs. Add 25µl of SYBR SafeTM DNA gel stain to each bottle of agarose gel. Swirl to mix. Pour the mixture into the cast and allow the gel to solidify for at least 30 minutes. Cover the gel casting tray to protect it from light. When the gel is solidified, remove the combs from the casting tray and put the gel together with the casting tray into the agarose gel tank filled with TBE buffer.

Gel loading and electrophoresis (1) Vortex and pulse-spin the 6X loading dye. (2) (3) Calculate the number of wells needed and add 2µl of the 6X loading dye into each well. Vortex and pulse-spin the PCR tubes. Page 8

WHO Measles and Rubella Workshop 22-27 November 2010

(4) (5) (6) (7)

Transfer 5µl of PCR product from each PCR tube and mix with the loading dye in the well. Load the content of each well into the wells of the agarose gel. Load 10µl of the 100bp DNA ladder one of the wells as molecular size marker. Run the gel at 140V, for 25-30 minutes (until the blue marker dye has migrated to about 5mm from the bottom of the gel).

(8) Turn off the power supply, disconnect the cable and retrieve the gel from the gel tank. (9) Rinse the gel with water briefly. (10) Visualize the gel and print the gel photo with gel documentation system. Practical 5: Gel electrophoresis of measles genotyping RT-PCR Reference: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 18-20. Materials/Reagents/Equipment provided: 2% agarose solution* Gel casting tray and combs Microwave oven 1 vial of 1X TBE buffer SYBR SafeTM DNA gel stain Agarose gel tanks Power supply Micropipettes Aerosol-free pipette tips Tomy centrifuge (for 0.2ml tubes) 96-well plates (U-bottomed) 1 vial of 6X loading dye 1 vial of 100bp DNA ladder Gel documentation system Procedures (Room 817) *Note: pre-cast agarose gels will be provided Refer “Practical 4: Gel electrophoresis of rubella detection and genotyping RT-PCR” on P.10-11.Practical 6: PCR purification for measles and rubella genotyping RT-PCR

Page 9

WHO Measles and Rubella Workshop 22-27 November 2010

References: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 22. QIAquick Spin Handbook, March 2008, Qiagen. Materials/Reagents/Equipment provided: QIAquick PCR Purification kit (Qiagen)* Micropipettes Aerosol-free pipette tips Microcentrifuge 1.5ml snap cap vials *Buffer PE (with ethanol added) will be provided. Please refer to the kit handbook for preparation of this buffer when using the new kit. Procedures (Room 817) (1) Label appropriate number of 1.5ml snap cap vials and spin columns. [Note: each PCR product to be purified requires three 1.5ml snap cap vials] (2) Transfer 5-times volume (of PCR product to be purified) Buffer PB into a pre-labeled, clean 1.5ml snap cap vial (e.g. 200µl Buffer PB for 40µl PCR product). Close the cap. Pulse-spin the PCR tubes containing the PCR products to be purified. Transfer the PCR product from each PCR tube to the corresponding 1.5ml snap cap vial containing Buffer PB. Vortex briefly and mix. Pulse-spin the mixture. Transfer the content of each vial to the corresponding spin column. Centrifuge at 13,000 × rpm for 1 minute. Discard the flow-through and reconnect the collection tube back to the spin column.

(3) (4) (5) (6) (7) (8)

(9) Add 750µl of Buffer PE to the spin column. (10) Centrifuge at 13,000 × rpm for 1 minute. (11) Discard the flow-through and reconnect the collection tube back to the spin column. (12) Centrifuge at 13,000 × rpm for an additional 1 minute. (13) Discard the collection tube and place the spin column into a clean 1.5ml snap cap vial (cut away the caps by scissors). (14) Add 40µl of Buffer EB to the centre of the spin column membrane. Let the column stand at room temperature for 1 minute. Page 10

WHO Measles and Rubella Workshop 22-27 November 2010

(15) Centrifuge at 13,000 × rpm for 1 minute. (16) Remove the spin columns one by one from the 1.5ml snap cap vials. Transfer the eluted PCR product to another clean 1.5ml snap cap vial. (17) Store the PCR product at 4oC (short term) or -20oC (long term) for later use. Practical 7: Gel electrophoresis of purified PCR products (measles and rubella) Reference: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 20-22. Materials/Reagents/Equipment provided: 2% agarose solution* Gel casting tray and combs Microwave oven 1 vial of 1X TBE buffer SYBR SafeTM DNA gel stain Agarose gel tanks Power supply Micropipettes Aerosol-free pipette tips Tomy centrifuge (for 0.2ml tubes) 96-well plates (U-bottomed) 1 vial of 6X loading dye 1 vial of 100bp DNA ladder Gel documentation system Procedures (Room 817)

*Note: pre-cast agarose gels will be provided Refer “Practical 4: Gel electrophoresis of rubella detection and genotyping RT-PCR” on P.10-11.

Page 11

WHO Measles and Rubella Workshop 22-27 November 2010

Day 3, Wednesday, 24 November Objectives: 1. To perform cycle sequencing with purified measles and rubella genotyping RT-PCR positive products Time and location: 09:00-10:30 Practical 8: Cycle sequencing (measles and rubella) (Location: Room 811 & Room 817) Practical 9: Purification of cycle sequencing products (measles and rubella) (Location: Room 817) 16:00-17:00 Practical 10: Sequencing run (Location: Room 839 & Room 840)

13:30-15:30

Practical 8: Cycle sequencing (measles and rubella) Reference: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 23-27. Materials/Reagents/Equipment provided: Purified PCR products (measles and rubella) 2 vials of measles sequencing primers (MeV216 and MeV214) 4 vials of rubella sequencing primers (8633F, 9112R, 8945F and 9577R) BigDye Terminator V 3.1 5X sequencing reaction buffer 1 vial of molecular grade water 0.2ml PCR tubes 1.5ml screw cap vials (self-standing) Micropipettes Aerosol-free pipette tips Vortex mixer Microcentrifuge Tomy centrifuges (for 1.5ml and 0.2ml tubes) Page 12

WHO Measles and Rubella Workshop 22-27 November 2010

Ice bucket ABI 9700 thermal cycler Biological safety cabinet/PCR workstation Worksheet for cycle sequencing (Appendix 5) Procedures Preparation of cycle sequencing master mix (Room 811) (1) (2) Thaw the kit reagents and primers. Vortex briefly to mix the content. Pulse-spin and keep on ice. Fill in the worksheet (Appendix 5) of cycle sequencing. Calculate the number of reactions and volume of reagents needed. [Note: Generally, 1µl of purified PCR product is used. A template gel should be run after purification to verify recovery of the PCR product after cleanup. If the band on the template gel is faint, the amount of template used in the sequencing reaction can be increased to 5µl. Adjust the volume of water accordingly.] (3) (4) (5) (6) (7) (8) Label the 0.2ml PCR tubes according to the worksheet and keep them on ice. Label self-standing screw cap 1.5 ml vials for each of the cycle sequencing master mix. Aliquot appropriate amount of water, 5X sequencing reaction buffer and BigDye into the 1.5 ml screw cap vials, according to the worksheet. Vortex briefly to mix the content in the vial. Pulse-spin the vial and keep it on ice. Aliquot the master mix to corresponding PCR tubes. Aliquot each sequencing primer to each PCR tube accordingly.

Addition of purified PCR products to be sequenced (Room 817) (1) (2) (3) (4) Vortex briefly the purified PCR products to be sequenced. Pulse-spin the vials. Add 1µl (or more when necessary) of PCR product to corresponding PCR tube. Vortex briefly the content of the PCR tubes and pulse-spin. Place the PCR tubes into thermal cycler (Location: Room 817). Start the PCR run with the cycling condition as shown below. Make sure the thermal cycler is preheated before placing PCR tubes in it.

Cycling parameters of cycle sequencing 96oC 30 sec 50oC 15 sec 25 cycles 60oC 4 min 4oC ∞

Page 13

WHO Measles and Rubella Workshop 22-27 November 2010

Practical 9: Purification of cycle sequencing products (measles and rubella) References: DyeExTM handbook, May 2002. Qiagen. Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 28. Materials/Reagents/Equipment provided: Cycle sequencing products (measles and rubella) Qiagen DyeEx 2.0 Spin Kit 1.5ml snap cap vials Micropipettes Aerosol-free pipette tips Vortex mixer Microcentrifuge Tomy centrifuge (0.2ml tubes) Speedvac vacuum drier Worksheet for sequencing plate (Appendix 6) Procedures (Room 817) (1) (2) (3) (4) (5) (6) (7) Gently vortex the spin column to resuspend the resin. Loosen the cap of the column a quarter turn (to avoid a vacuum inside the spin column). Snap off the bottom closure of the spin column and place the spin column in a 2 ml collection tube provided. Centrifuge at 750 × g for 3 minutes. Label one 1.5ml snap cap vial for each sequencing reaction PCR tube. Discard the collection tube and carefully transfer the spin column to a clean 1.5ml snap cap vial. Slowly apply the sequencing reaction mixture onto the centre of the slanted gel bed surface so that the drops are absorbed into the gel and instead of flowing down the sides of the gel bed. [Note: Do not allow the sequencing reaction mixture or the pipette tip to touch the sides of the column. Avoid touching the gel bed surface with the pipette tip. It is not necessary to replace the lid on the column.] (8) (9) Centrifuge at 750 × g for 3 minutes. [Place the column such that the slanted gel bed surface faces the centre of the rotor.] Remove the spin column from the 1.5ml snap cap vial.

Page 14

WHO Measles and Rubella Workshop 22-27 November 2010

(10) Vacuum dry the 1.5ml snap cap vials containing the eluate for 1 hour (until all fluid is dried up). Practical 10: Sequencing run Reference: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 29-30 Materials/Reagents/Equipment provided: Sequencing plates loaded with purified cycle sequencing products ABI 3130xl or 3730 sequencer Worksheet for sequencing plate (Appendix 6) Procedures Preparation of samples for loading to sequencer (Room 839 & Room 840) Note: The following steps will be demonstrated and performed by staff of PHLC. (1) Fill in the worksheet (Appendix 6) for sequencing plate and enter the sample IDs into (2) the computer. Load the plate into sequencer. Start the sequencing run. Refer the above reference or the manual of the sequencer for further details. Day 4, Thursday, 25 November Objective: 1. To perform sequence analysis for measles virus genotyping Time and location: 09:30-13:00 Practical 11: Sequence analysis for measles virus genotyping (Location: Room 111) Practical 11: Sequence analysis for measles virus genotyping-continued (Location: Room 111)

13:30-17:00

Practical 11: Sequence analysis for measles virus genotyping

Page 15

WHO Measles and Rubella Workshop 22-27 November 2010

References: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 31-32. Materials/Reagents/Equipment provided: Files containing raw sequences data of the measles samples Electropherograms of the measles samples sequenced File containing measles reference sequences including d11 Panel of reference sequences for measles Personal computers, with internet access and MEGA 4.0.2 installed Procedures Refer “Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 31-32.” Day 5, Friday, 26 November Objective: 1. To perform sequence analysis for rubella virus genotyping Time and location: 09:00-12:00 Practical 12: Sequence analysis for rubella virus genotyping (Location: Room 111) Practical 12: Sequence analysis for rubella virus genotyping-continued (Location: Room 111)

13:30-17:00

Practical 12: Sequence analysis for rubella virus genotyping References: Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 33-35.

Page 16

WHO Measles and Rubella Workshop 22-27 November 2010

Materials/Reagents/Equipment provided: Files containing raw sequences data of the rubella samples Electropherograms of the rubella samples sequenced Panel of reference sequences for rubella Personal computers, with internet access and MEGA 4.0.2 installed Procedures Refer “Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus. Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong. Pages 33-35.”

Page 17

ANNEX 6

Protocols for Molecular Epidemiology of Measles Virus and Rubella Virus

Revised for WHO/WPRO Workshop, Nov 22-27, 2010, Centre for Health Protection, Hong Kong, SAR

Contents Drying Cells Infected with Measles or Rubella Viruses onto Specimen Paper Shipment of Specimen Paper Extraction of RNA from Specimen Paper with the Qiagen Viral RNA Mini Kit

RNA Extraction from Plasma, Serum, Clinical Samples and Cell-Culture Lysates with the Qiagen Viral RNA Mini Kit Preparation of Infected Cell Lysates for Qiagen RNA Extraction Qiagen RT-PCR Protocol for Rubella Detection Qiagen RT-PCR Protocol for Rubella Genotyping (Two Fragment System)

1 2 2 3 4 6 10 14 18 21 22 23 26 28 29 31 33

Qiagen RT-PCR protocol for Measles Genotyping (version 2) Agarose Gel Electrophoresis Options for Laboratories Submitting PCR Products for Sequencing Clean-up of PCR reactions Sequencing reactions-Rubella Sequencing reactions-Measles Sequence Cleanup For use with ABI 3130 or 3730 Sequencing run Sequence analysis-Measles Sequence analysis-Rubella

Drying Cells Infected with Measles or Rubella Viruses onto Specimen Paper Purpose: This procedure can be used to submit measles or rubella isolates to the Regional or Global Specialized Laboratory for sequence analysis and genotyping. Once the samples are dry, the samples can be stored at 4 C. Samples can be shipped at room temperature. Important: Both measles and rubella virus have been recovered from specimen paper. Treat samples as infectious material. Materials needed: Cell scrapers (Corning, #3010) Cryovials Vortex Empty pipette tip boxes Desiccant packs (Whatman Bioscience, # WB10 0003) S&S 903 specimen card paper (Whatman Bioscience, #10534612) Scissors Non-absorbent paper (Fisher, #09-898-12C) Procedures not described in this paragraph: Prepare a T25 flask of Vero-SLAM infected with MeV or RuV. Incubate until extensive cytopathic effect is visible (for Measles) or for 5-7 days (for Rubella). If several specimens are processed simultaneously, avoid cross-contamination. 1. Remove the supernatant from the T25 flask. For Rubella virus, save as stock in a -70º C freezer. For Measles virus, discard supernatant. Add 400 ul DMEM with 2% FBS to the flask. Scrape cells into the medium and transfer all of the slurry to a sterile 1.5 ml microcentrifuge tube. 2. Vortex the tube to distribute the cells evenly. 3. Obtain an empty pipet tip box. Remove the perforated plastic piece (where the tips were) and add enough desiccant packs to almost fill the box. Replace the perforated piece. 4. From an S&S specimen card cut 4 circles (1.5 cm each) for each virus isolate from the paper. Place the circles on a piece of non-absorbent paper (or Parafilm) on top of the perforated piece in the tip box. 5. Add 80ul of the infected cell slurry from step 2 to each paper circle. Any remaining cell slurry can be saved by freezing at -70º C. 6. Replace the lid on the box and store the box at 4° C for 3 days to dry the paper. 7. After 3 days, carefully transfer the paper circles to another piece of non-absorbent paper, wrap as an envelope and secure with tape. Label the paper with the sample ID. 8. Place the “envelopes” containing the paper circles in a plastic bag with a desiccant pack. Prior to shipment, store the samples at 4° C. 9. One circle can be used for RNA extraction, 1 can be used for elution of infectious virus, and 2 can be stored as back-ups.

Shipment of Specimen Paper The specimen paper needs to be shipped using the triple layer containment method for Category B infectious substances (UN 3373). This requires a primary container, secondary container, and outer packaging. The samples can be shipped at room temperature. The plastic bag containing the filter papers should be wrapped in 3 layers of bubble wrap to minimize the detrimental effects of high temperatures during shipment. (Alternate Procedure) Preparation of FTA cards FTA cards are treated with a chemical to destroy viral infectivity, but retain viral RNA. Measles viral infectivity is lost by using the following procedures. (This protocol is not yet tested for rubella virus.) • In a biosafety cabinet, add 40 ul of clarified viral lysate to one circle on the FTA card. Take care not to puddle the isolate in one place, but to move in a concentric pattern to avoid overloading the chemicals on the card. • Place FTA card in an airtight container (ziplock bag) with desiccant packs and allow to dry for three days at room temperature. • Cards with viral lysate are stable at room temperature for up to two months; however, it is recommended to store them at 4 C. Extraction of RNA from specimen paper (or FTA Card) by using the Qiagen viral RNA mini kit Modification of RNA extraction procedure for specimen paper. For a full description of the RNA extraction procedure, please see next section. 1. Pipet 600 ul of prepared buffer AVL containing carrier RNA into a 1.5ml micro centrifuge tube. 2. Put one paper circle into the AVL buffer, add 150 ul 1x PBS. Mix by pulse-vortexing for 15 seconds. 3. Incubate at RT for 10 min. 4. Centrifuge at 13000 rpm for 2 min. 5. Remove 600 ul of the liquid to a new tube. Add 600 ul ethanol. Mix by pulse vortexing for 15 seconds. Spin briefly to collect liquid from the lid. Then follow the standard Qiagen kit protocol for RNA extraction, step 5, below.

RNA Extraction from Plasma, Serum, Clinical Samples and Cell-Culture Lysates using the Qiagen Viral RNA Mini Kit Purpose: Extraction of RNA for use in RT-PCR reactions. This kit is for the purification of Viral RNA from plasma, serum, and clinical samples including urine and throat swabs, and cell culture lysates (Note: The Qiagen viral RNA kit handbook recommends using only cell-free samples, but CDC has used cell-containing slurry with positive results.) Notes: When working with RNA always: • Wear gloves at all times. • Use sterile, clean plastic tubes. • Use only reagents that are dedicated for RNA extraction and have been kept RNase free. • Label all reagents for RNA use and write dates and name when opening stock vials. • Use only sterile, filter tips with the micropipettors. • Work quickly during the procedure and store eluted RNA at – 20 or -70 quickly after extraction. • Keep eluted RNA samples on ice during procedures. Materials Needed Qiagen Viral RNA mini kit (Qiagen, #52904) 95-100% Ethanol Sterile 1.5ml Eppendorf tubes Micropipettors Sterile filter tips 15ml conical tube with 95-100% Ethanol Preparing Buffers from Kit • • • • • Add 310 ul buffer AVE to the tube containing lyophilized carrier RNA. Vortex thoroughly. Divide carrier RNA solution into aliquots, store at -20 C. Do not freeze-thaw more than 3 times. Mix buffer AVL and carrier RNA solution at a ratio of 100 parts AVL plus 1 part carrier RNA, e.g. for 10 samples, mix 5.6 ml AVL with 56 ul carrier RNA. Add 25 ml of 95-100% Ethanol to AW1 buffer (as indicated on the bottle) Add 30 ml of 95-100% Ethanol to AW2 buffer (as indicated on the bottle)

Procedure: 1. Heat AVL buffer in 37C water bath until all crystals have been dissolved, 5-10 min 2. Add 560ul of AVL buffer to clean and sterile 1.5 ml tube. 3

3. Add 140 ul of sample (if using clinical samples or cell lysates) to tube indicated in step 2, pulse vortex for 15 seconds and let incubate at room temperature for 10 minutes. 4. Add 560 ul of 95-100% Ethanol to each tube and pulse vortex for 15 seconds. Briefly spin tube in a microcentrifuge to remove drops from inside the lid. 5. For each sample, label a Mini spin column and place in a 2 ml collection tube (both provided in kit). Add 630 ul of the mixture to column and centrifuge for 1 minute at 8,000rpm 6. Empty the collection tube and repeat step 5 one time 7. Remove the column from the collection tube and place in a clean collection tube. Add 500 ul of buffer AW1. Centrifuge for 1 min at 8,000 rpm 8. Remove the column from the collection tube and place in a clean collection tube. Add 500 ul of AW2. Centrifuge for 3 min at 14,000 rpm 9. Remove the column from the collection tube and place in a clean sterile and labeled 1.5 ml tube. 10. Add 60 ul of AVE buffer, provided with kit (can use distilled water), wait for 1 minute and centrifuge for 1 minute at 8,000 rpm 11. Remove and discard column; place 1.5 ml containing RNA on ice for immediate use or store in –20C or –70C freezer for future use.

*Preparation of Infected Cell Lysates for Qiagen RNA Extraction The following protocol is the preferred method for preparation of cell lysates from rubellainfected cell cultures and this protocol can also be used for measles-infected cultures 1. Five to 7 days after inoculation (for rubella) or after CPE is maximal (measles) freeze cell culture flask at -70oC (several hours to overnight). 2. Thaw cell culture flask under the hood. 3. If cells do not come off flask bottom with gentle tapping, use cell scraper to remove adhered cells. 4. Pipette slurry up and down several times and transfer to 15 ml centrifuge tube. 5. Centrifuge at 1000 x g for 10 minutes. 6. Remove 140 ul of supernatant for Qiagen RNA extraction. 7. Agitate the tube to resuspend the cell pellet, then aliquot 1 ml of the slurry into 2 sterile freezer tubes each for storage at -70oC. Alternate protocols for measles infected cells 1. When CPE is visible throughout the monolayer, scrape the cells into the medium with a cell scraper or 1 ml pipette. Transfer medium and cells to a sterile, plastic centrifuge tube 4

and centrifuge the cells at approximately 1000 x g for 10 minutes. Discard the supernatant and resuspend the cell pellet in 1.0 ml of DMEM-PS. 2. Freeze thaw cell suspension 1X. 3. Remove 140 ul of the lysate for Qiagen RNA extraction. 4. Divide the remaining slurry to each of 2 cryovials and store at –70° C as viral stock.

Alternatively: 1. Decant all but about 1 ml of the supernatant medium into hypochlorite solution. 2. Freeze cell culture flask at -70oC (several hours to overnight). 3. Thaw cell culture flask under the hood. 4. If necessary, scrape the cells into the remaining medium or disperse by pipetting. 5. Remove 140 ul of the lysate for Qiagen RNA extraction. 6. Divide the remaining slurry to each of 2 cryovials and store at –70° C as viral stock.

Qiagen RT-PCR Protocol for Rubella Detection This is a conventional RT-PCR reaction for detection of rubella virus (RV) RNA extracted from a clinical sample or cell culture. A 3 primer system is used for detection of both Clade 1 and Clade 2 RV RNAs: one forward primer and 2 reverse primers. One reverse primer works more efficiently for Clade 1 viruses and one works more efficiently for Clade 2 (3 nucleotides were changed to match the sequence of the majority of Clade 2 viruses identified so far). The inclusion of both primers will allow detection of either clade if the genotype of the virus is unknown. NOTE: If a sample gives a positive result in this RT-PCR assay, the RNA should be used in additional RT-PCR assays to amplify a larger target(s) for sequence analysis and genotyping.

This is a one-tube reaction, so there is a minimum of specimen handling. Some points to consider: 1. Controls Positive control. RNA from known positive wild-type or vaccine virus infected cells can be used. The CDC can provide a transcribed RNA which consists of RV RNA containing a 30 nt insert. The amplified product will thus be 30 nt larger than the normal 185 nt RT-PCR product when visualized on an agarose gel. By using this control, the RT-PCR reaction is controlled without any possibility of contamination by wild-type or vaccine viruses. Negative controls should include (1) a non-template control (water) and (2) an extraction control (RNA extracted from uninfected cells or cell-culture media). When doing RNA extractions, it is a good idea to include an extraction control as this will show that reagents for RNA extraction have not been contaminated by template. 2. Avoid template contamination. Use dedicated equipment, rooms and hoods for all pre-PCR procedures. Post amplification analysis and processing should be performed in separate rooms using dedicated equipment. Do not share equipment (including lab coats) between pre-PCR and post-PCR procedures. 3. Template amount. In most cases, use 5 ul of RNA per reaction. Most of the extraction protocols yield 40-60 ul of RNA. We usually extract RNA from one 25 cm2 flask of infected cells or from 100-200 ul of clinical material. The volume of RNA can be increased, but this will not improve the sensitivity. 4. Primers. Please see primer map in the Appendix. • Forward Primer (RV11): 5’ CAA CAC GCC GCA CGG ACA AC 3’ • Reverse Primer 1 (RV12): 5’ CCA CAA GCC GCG AGC AGT CA 3’ • Reverse Primer 2 (RV12-2): 5’ CCA CGA GCC GCG AAC AGT CG 3’

5. GC Content. RV has a high GC content, so addition of a GC “melt” reagent is recommended for all RT-PCR reactions. The Q solution in the Qiagen kit is a GC melt reagent and should always be included in the reaction mixes. Materials: Qiagen RT-PCR kit (Qiagen CAT# 210210 0r 210212) RNasin (RNase inhibitor) Bucket with ice Autoclaved PCR tubes (0.2ul, thin-walled), pipettors, and filter tips Forward Primer (20uM working dilution prepared in RNase-free water) Reverse Primers 1 and 2 (20uM working dilution prepared in RNase-free water) Synthetic (transcribed) RNA for positive control (optional) Test sample RNAs Instructions: 1. Determine the number of reactions to be done and fill in the RT-PCR worksheet. 2. Start in the BSC designated for master mix preparation. Thaw all kit reagents except enzymes, vortex and place on ice. Keep enzymes on ice at all times. Allow RNA samples to thaw on ice and keep on ice while you are setting up the reactions. 3. Label appropriate number of 0.2 ml thin-walled, reaction tubes and place in pre-chilled metal cooling rack. Keep cooling rack on ice for entire protocol. 4. Add appropriate volumes (see worksheet) of reagents 1 through 7 to a pre-chilled 1.5 ml Eppendorf tube. Vortex and keep tube on ice. 5. Add the RNAsin and the Enzyme Mix to the pre-mix tube last. Vortex and quickly spin the tube in a microcentrifuge to collect the mix in the bottom (10,000 rpm for 10 sec). 6. Dispense pre-mix (see worksheet) to each reaction tube. Close caps and keep reaction tubes on ice after the pre-mix is dispensed. 7. Proceed to a separate BSC designated for template addition. Using a new, clean pipette tip for each transfer, add RNA to each tube and close the cap. Add the positive control last. 8. Spin the tubes briefly (10,000 rpm for 10 sec) in a microcentrifuge or vortex briefly and immediately return the tube to the metal cooling rack. 9. Select the appropriate RT-PCR program on the thermocycler. View the program steps to make sure that you are running the proper conditions. Place the samples in the block and “start” the run. 7

One Step Kit: Qiagen (CAT# 210210/210212) Rubella detection RT-PCR Worksheet Date:______________ Component 1. Nuclease-free water (19 if using 5ul RNA) 2. 5X Qiagen OneStep RT-PCR buffer 3. 5X Q Solution (necessary for rubella) 4. dNTP Mix 5. Forward Primer (20 uM) 6. Reverse Primer #1 (20 uM) 7. Reverse Primer #2 (20 uM) Operator:_____________________ [Final] Conc. Vol/rxn __ ul 1X 1X 0.400mM 0.2 uM 0.2 uM 0.2 uM 10 ul 10 ul 2 ul 0.5 ul 0.5 ul 0.5 ul # rxns plus 1 Total vol. Added Y/N

Vortex and place on ice before adding enzymes 8. Qiagen One Step Enzyme Mix 9. RNase Inhibitor 20 U.

2 ul 0.5 ul

Vortex and dispense pre-mix (50ul – RNA vol)_______ into each chilled reaction tube. Steps 1-9 should be completed in the BSC designated for mater mix preparation. Keep reaction tubes on ice. Bring reaction tubes (on ice) to separate BSC designated for template addition. Add RNA temples as specified below. 10. add RNA (up to 5ul) to each tube ___ ul NA NA

Forward Primer: _______________ Reverse Primer(s):_______________ Total reaction volume: 50 ul Pre-mix dispense volume (50ul- vol RNA):________ Positive control:____________ Negative control:____________

Cycling Parameters for Qiagen (Rubella detection)

95oC 50 C 30 min o

94oC 30 sec

40 Cycles 72oC 60oC 30 sec 1 min 72oC 10 min 4oC

15 min

Qiagen RT-PCR protocol for Rubella Genotyping (Two Fragment System) This protocol describes 2 RT-PCR reactions for rubella RNA extracted from a sample or cell culture. These are one-tube reactions, so there is a minimum of specimen handling. The 2 reactions will produce 2 overlapping fragments which can be used for sequencing and genotyping of the virus. Some points to consider: Note: If RNA extracted from an isolated virus grown in cell culture is available, a single larger amplicon can be generated using the forward primer from Fragment 1 (8633F) and the reverse primer from Fragment 2 (9577R), length 945 nts. This single fragment requires approximately 2000 copies of rubella RNA for detection and sequencing. 1. Controls. Positive control. The positive control RNA provided is transcribed RNA which consists of rubella RNA containing both a 30 nt insertion and an 84 nt deletion. Amplified products of fragment 1 (5’ fragment) will be 30 nt larger than the normal RT-PCR product and the products of fragment 2 (3’ fragment) will be 84 nt smaller when visualized on an agarose gel. By using this control, any contamination by the positive control RNA can recognized on the gel or detected by sequencing. Note: it is difficult to see the size difference for fragment 1, but if any contamination has occurred, the insertion can be detected by sequencing. Negative controls should include one non-template control with water substituted for RNA. When doing large numbers of RNA extractions, it is a good idea to include an extraction control. This mock extraction (from non-virus containing material such as DMEM or uninfected cells) will show that reagents for RNA extraction have not been contaminated by template. 2. Avoid template contamination. Use dedicated equipment, rooms and hoods for all pre-PCR procedures. Post amplification analysis and processing should be performed in separate rooms using dedicated equipment. Do not share equipment (including lab coats) between pre-PCR and post-PCR procedures. Use filter tips for all pre-PCR procedures and for setting up RT-PCR reactions. 3. Use 5 ul of RNA per reaction. Most of the extraction protocols yield 40-60 ul of RNA. We usually extract RNA from one 25 cm2 flask of infected cells or from 100-200 ul of clinical material. The volume of RNA can be increased, but this will not improve the sensitivity. If you change the volume of RNA, the volume of water in the reaction must be adjusted accordingly. 4. Primers. Fragment 1 PCR : 8633F: (8633-8652) 9112R : (9092-9112) Fragment 2 PCR : 8945F (8945-8961) 9577R (9557-9577)

5’ AGC GAC GCG GCC TGC TGG GG 3’ 5’ GCG CGC CTG AGA GCC TAT GAC 3’ 5’ TGG GCC TCC CCG GTT TG 3’ 5’ CGC CCA GGT CTG CCG GGT CTC 3’

Materials Qiagen RT-PCR kit (Qiagen CAT# 210210 0r 210212) RNasin (pancreatic RNase inhibitor) (optional) Bucket with ice Autoclaved PCR tubes (0.2ul, thin-walled) 10

Forward Primer (20uM working dilution prepared in RNase-free water) Reverse Primer (20uM working dilution prepared in RNase-free water) Positive control Preparation of synthetic RNA for RV positive control: Rehydrate to generate master stock: Add 100 ul nuclease-free water or TE buffer and vortex for 15 seconds. Leave at room temperature for 10 minutes. For RT-PCR use 1 ul per reaction as a positive control (add water to the reaction as needed). (Use 3 ul per reaction as a positive control for Fragment 1 (5’ fragment).) Store all RNA at -70°C for best results. Avoid repeated freeze-thawing RNA to prevent RNA degradation. Always work with RNA on ice. Instructions: 1. In the BSC designated for master mix preparation, thaw all kit reagents except enzymes, vortex and place on ice. Keep enzymes on ice at all times. Allow RNA samples to thaw on ice and keep on ice while you are setting up the reactions. 2. Label appropriate number of 0.2 ml thin-walled, reaction tubes and place in pre-chilled metal cooling rack. Keep cooling rack on ice for entire protocol. 3. Add appropriate volumes (see worksheet) of reagents to a pre-chilled 1.5 ml Eppendorf tube. Vortex and keep tube on ice. Two master mixes need to be set up – one for each of the two primer pairs. 4. Dispense pre-mix (see worksheet) to each reaction tube. Keep reaction tubes on ice after the pre-mix is dispensed. 5. Proceed to the separate BSC designated for template addition. Using a new, clean pipette tip for each transfer, add RNA to each tube and close the cap. 6. Spin the tubes briefly (10,000 rpm for 1 minute) in a chilled microcentrifuge and immediately return the tube to the metal cooling rack. 7. While tubes are spinning, select the appropriate program in the thermocycler. Use the “view” command to make sure that you are running the proper conditions. Place the tubes in the block and “start” the run.

One Step Kit: Qiagen (CAT# 210210/210212). Rubella genotyping RT-PCR Worksheet Fragment 1 Component 1. RNAse free H20 2. 5X reaction buffer 3. 5X Q Solution 4. 10 mM dNTP mix 5. Enzyme mix 6.RNAse Inhibitor 7. Forward Primer (20uM) 8. Reverse Primer (20uM) 9.RNA template (add last) Final Volume Forward primer: 8663F reverse primer : 9112R Amplicon size: 480 nt Fragment 2 Component 1. RNAse free H20 2. 5X reaction buffer 3. 5X Q Solution 4. 10 mM dNTP mix 5. Enzyme mix 6.RNAse Inhibitor 7. Forward Primer (20uM) 8. Reverse Primer (20uM) 9. RNA template (add last) Final Volume Forward primer: 8945F Amplicon size: 633 ul/RX 19.5 10 10 2 2 0.5 0.5 0.5 5 50 ul xxxxxxxx xxxxxxxx # Rxs + 1 Total vol Added?

ul/RX 19.5 10 10 2 2 0.5 0.5 0.5 5 50 ul

# Rxs + 1

Total vol

Added?

xxxxxxxx

Reverse primer: 9577R

Master Mix: add first 8 reagents Master Mix Dispense Vol: 45 ul/tube RNA: add 5 ul Positive Control:_________ Negative Control: _________

Cycling Parameters for Qiagen (Rubella genotyping)

95oC 50 C 30 min o

94oC 30 sec

40 Cycles 60 C 30 sec o

15 min

72oC 1 min

72oC 10 min 4oC

Qiagen RT-PCR protocol for Measles Genotyping (Version 2) This is a standard RT-PCR reaction for molecular epidemiology. This is a one-tube reaction, so there is a minimum of specimen handling. Some points to consider: 1. Controls. Positive control should be RNA extracted from cells infected with MV. It is best not to use a vaccine strain as a control. It is better to use a previously characterized wild-type virus. This is very important especially if vaccine sequences are detected from suspected cases or suspected vaccine reactions. If a wild-type is used as the positive control, this helps rule out the possibility of contamination in the assay. Synthetic measles or rubella RNA is also an excellent positive control (see below). Negative controls should include RNA extracted from uninfected cells as well as a control with water substituted for RNA. When doing large numbers of RNA extractions, it is a good idea to include an extraction control. This mock extraction will show that reagents for RNA extraction have not been contaminated by template. 2. Avoid template contamination. Use dedicated equipment, rooms and hoods for all pre-PCR procedures. Post amplification analysis and processing should be performed in separate rooms using dedicated equipment. Do not share equipment (including lab coats) between pre-PCR and post-PCR procedures. Use filter tips for all pre-PCR procedures and for setting up RT-PCR reactions. 3. Use 5 ul of RNA per reaction. Most of the extraction protocols yield 40-50 ul of RNA. We usually extract RNA from one 25 cm2 flask of infected cells or from 100-200 ul of clinical material. The volume of RNA can be increased, but this will not improve the sensitivity. If you change the volume of RNA, the volume of water in the reaction must be adjusted accordingly. 4. Primers. Previously used primers MV60 and MV63.3 have been replaced by primers MeV214 and MeV216. The location of the primer binding sites is described in the appendix. Size nt Sequence 20 TGG AGC TAT GCC ATG GGA GT 20 TAA CAA TGA TGG AGG GTA GG

Name MeV216 (forward) MeV214 (reverse) Materials:

Qiagen RT-PCR kit (Qiagen CAT# 210210 0r 210212) RNasin (pancreatic RNase inhibitor) (optional) Bucket with ice Autoclaved PCR tubes (0.2ul, thin-walled) Forward Primer MeV216 (20uM working dilution prepared in RNase-free water) Reverse Primer MeV214 (20uM working dilution prepared in RNase-free water) Positive control

Preparation of working stocks (20 uM) of genotyping PCR primers: Primers are supplied from CDC as 200 uM stocks. To make working stocks of primers MeV214 and MeV216 for RT-PCR: • Add 90ul nuclease-free water to 10ul of MeV214 • Add 90ul nuclease-free water to 10ul of MeV216 • Concentration = 20uM • Store at -20ºC Use 0.5 – 1ul per RT-PCR reaction as per RT-PCR protocol Preparation of synthetic RNA for MV positive control (MeV-N3in). This is an RNA transcript of a measles N-gene with a 220 base insert in the 3’ variable region. Amplified products will thus be 220 nt larger than the normal RT-PCR product when visualized on an agarose gel. Using this control simplifies the identification of contaminations. Important: The new synthetic RNA, MeV-N3in, will work with both the old primer set (MV60, MV63.3) and the new primer set (MeV214, MeV216). But the synthetic RNA MVN216 which was used with the old primer set will NOT work with the new primers. Each tube contains 1 x 1011 copies of dried RNA. Rehydration of measles positive control RNA, MeV-N3in: To make master stock: • Add 100ul nuclease-free TE and vortex tube. • Place at 55ºC for 10 minutes and vortex, again. • Make 10ul aliquots. • Concentration = 109 copies/ul • Store at-70ºC To make working stock: • Add 90ul nuclease-free TE to the 10ul master stock. • Concentration = 108copies/ul • Store at -20ºC for short-term and at -70ºC for long-term. • Use 1ul per RT-PCR reaction. Optional: Reconstitution of control RNA (from infected cells) 1. Vial contains 20 ug of dried RNA extracted from infected Vero/hSLAM cells. 2. Add 200ul of nuclease-free TE and vortex tube for 15 seconds. Final concentration will be 100 ng/ul. 3. Heat tube to 55C for 15 minutes then vortex tube for 15 seconds. 4. Keep RNA on wet ice at all times after reconstitution. 5. Use 1ul of this RNA per PCR reaction 6. Aliquot and store RNA at -20C. Instructions: 1. In the BSC designated for master mix preparation: Thaw all kit reagents except enzymes, vortex and place on ice. Keep enzymes on ice at all times. Allow RNA samples to thaw on ice and keep on ice while you are setting up the reactions.

2. Label appropriate number of 0.2 ml thin-walled reaction tubes and place in pre-chilled metal cooling rack. Keep cooling rack on ice for entire protocol. 3. Add appropriate volumes (see worksheet in appendix) of reagents 1 through 5 to a pre-chilled 1.5 ml Eppendorf tube. Vortex and keep tube on ice. 4. Allow time for pre-mix contents to chill, then add reagents 6 and 7 to pre-mix tube. Vortex and chill briefly on ice. 5. Dispense pre-mix (see worksheet) to each reaction tube. Keep reaction tubes on ice after the pre-mix is dispensed. 6. Proceed to the separate BSC designated for template addition. Using a new, clean pipette tip for each transfer, add RNA to each tube and close the cap. 7. Spin the tubes briefly (10,000 rpm for 1 minute) in a chilled microcentrifuge and immediately return the tube to the metal cooling rack. 8. While tubes are spinning start the appropriate program in the thermocycler. Place the samples in the block and start the run.

One Step Kit: Qiagen (CAT# 210210/210212). RT-PCR Reaction Worksheet: Date:______________ Component

Operator:_____________________ [Final] conc. Vol/rxn # of rxns plus 1 Total vol. Added?

1. ETF water 27.5 ul 2. 5x Qiagen One-Step RT1x 10 ul PCR buffer 3. dNTP mix 0.4 mM 2 ul 4. Forward primer (20 uM) 0.6 uM 1.5 ul 5. Reverse primer (20 uM) 0.6 uM 1.5 ul Vortex and place on ice before adding enzymes 6. Qiagen One-Step Enzyme 2 ul Mix 7. RNase inhibitor 20 U 0.5 ul Vortex and dispense 45 ul master mix into each chilled reaction tube. Steps 1-7 should be completed in a BSC designated for master mix preparation. Keep reaction tubes on ice. Bring reaction tubes (on ice) to separate BSC designated for template addition. Add RNA templates as specified below Add RNA to each tube 5 ul xxxxx xxxxx

94oC 30 sec

40 Cycles 55 C 30 sec o

72oC 30 sec

72oC 10 min 4oC

15 min

Agarose Gel Electrophoresis Materials Agarose Agarose gel casting tray and comb(s) Ethidium Bromide (EtBr) at a concentration of 10ug/ml or GelRed (Biotium, # 41003) 1X TBE Buffer Agarose gel electrophoresis box Loading dye Molecular weight marker Preparation of Agarose Gel and Analysis of PCR Products: There are many different gel casting systems and gel electrophoresis boxes available. The volume of gel solution as well as voltage and running time must be determined based on the available equipment. 1. Always wear gloves while preparing and working with EtBr-containing agarose gels. Dispose of all waste and gel matter containing EtBr in the proper EtBr waste containers. 2. To avoid working with EtBr, which causes cancer, GelRed may be used. It is a noncarcinogenic dye which is at least as sensitive as EtBr for visualizing DNA bands in agarose gels. 3. Weigh appropriate amount of agarose. For PCR products of both MV (600 bp) and RV (185 bp) 2% agarose gels will work well. Add 1 X TBE buffer (TAE is also acceptable). 4. Melt agarose in microwave (microwave in the lab, not a food microwave). Please avoid over heating, as the agarose will bubble all over the inside of the microwave. 5. Add 1ul of Ethidium bromide (10ug/ml)/50ml of melted agarose or add 0.8 ul GelRed and swirl gently. 6. Pour into casting tray until agarose is half way up the tines of the comb and allow gel to solidify. 7. Gently remove comb and remove gel from casting tray. Place in electrophoresis box with enough 1X TBE to cover gel. 8. Load the appropriate amount of a molecular weight marker into the first well (e.g. 10 ul BioRad 100 bp ladder premixed with loading dye) 9. Place 2 ul of loading dye onto parafilm. Mix 5 ul of sample with the 2 ul of loading dye, pipet up and down until they are thoroughly mixed. Place all into an empty well of the gel. Repeat for all samples. 10. Run at up to 100 V if using TBE buffer until the dark blue marker dye (bromophenol blue) is has migrated through about two-thirds of the gel. 11. Visualize DNA by UV light. Best to use a uv transilluminator. Compare the size of the bands for your specimen with the size of the controls and the molecular weight marker. Photograph gel to record results. If the desired PCR products are present, purify the PCR products from the remaining reaction.

Example gels Example gel for Measles Example of agarose gel with synthetic measles RNA as control RNA 1% agarose gel el is stained with GelRed and visualized by ultraviolet illumination. Primers MeV214 and MeV216 amplify a 634 base pair region (see red sequence below) at the COOH terminus of the N gene of positive specimens. Sequence analysis of this PCR product is used for genotyping. The same primers produce an 854 base pair amplicon from the synthetic control RNA.

Lane 1: 100 base ladder molecular weight molecular marker (Invitrogen) Lane 2: Synthetic MeV RNA (MeV-N3in) with insert = 854 base fragment Lane 3: wild-type Measles RNA = 634 base fragment Lane 4: negative (water) control

Example gel for Rubella Synthetic Rubella E1 RNA with a 30 nt insertion and an 84 nt deletion

cMyc (30 nts)

84 nts

Fragment 1 Fragment 2 Example of the 2 RT-PCR fragments made from wild-type (wt) and synthetic RNA (PC) templates. M = mock RNA.

M wt PC M wt PC Fragment1 Fragment2

Option for Laboratories Submitting PCR Products for Sequencing PCR products can be shipped without drying. Transfer the PCR reaction into a 1.5 ml tube, seal with parafilm and ship on a cool pack.

PCR Reaction Clean Up PURPOSE: To extract and purify DNA fragments from positive PCR reactions. Excess dNTPs, primers and enzyme will be removed from the reaction. The purified DNA will be used as template for sequencing. Materials/Reagents/Equipment provided: QIAquick PCR Purification kit (Qiagen)* (Cat. no. 28104, 50 columns; 28106, 250 columns) Micropipettes Aerosol-free pipette tips Microcentrifuge 1.5ml snap cap vials *Buffer PE (with ethanol added) will be provided. Please refer to the kit handbook for preparation of this buffer when using the new kit. Procedures (1) Label appropriate number of 1.5ml snap cap vials and spin columns. (2) Transfer 5-times volume (of PCR product to be purified) Buffer PB into a pre-labeled, clean 1.5ml snap cap vial (e.g. 200µl Buffer PB for 40µl PCR product). Close the cap. (3) Pulse-spin the PCR tubes containing the PCR products to be purified. (4) Transfer the PCR product from each PCR tube to the corresponding 1.5ml snap cap vial containing Buffer PB. (5) Vortex briefly and mix. Pulse-spin the mixture. (6) Transfer the content of each vial to the corresponding spin column. (7) Centrifuge at 13,000 × rpm for 1 minute. (8) Discard the flow-through and reconnect the collection tube back to the spin column. (9) Add 750µl of Buffer PE to the spin column. (10) Centrifuge at 13,000 × rpm for 1 minute. (11) Discard the flow-through and reconnect the collection tube back to the spin column. (12) Centrifuge at 13,000 × rpm for an additional 1 minute. (13) Discard the collection tube and place the spin column into a clean 1.5ml snap cap vial (cut away the caps by scissors). (14) Add 40µl of Buffer EB to the centre of the spin column membrane. Let the column stand at room temperature for 1 minute. (15) Centrifuge at 13,000 × rpm for 1 minute. (16) Remove the spin columns one by one from the 1.5ml snap cap vials. Transfer the eluted PCR product to another clean 1.5ml snap cap vial. (17) Store the PCR product at 4oC (short term) or -20oC (long term) for later use.

Sequencing reactions-Rubella Purpose The purpose is to derive the rubella virus 739 nucleotide sequence using one forward and one reverse primer for each of the two DNA fragments generated in the Qiagen RT-PCR reactions. The 4 resulting sequences will then be analyzed and assembled into a single sequence to be used for genotyping. Preparation of working stocks for primers • For RV fragment 1, use primers 8633F and 9112R. For RV fragment 2, use primers 8945F and 9577R. • For sequencing reactions, make fresh dilutions from the primer stocks. • Do not use the 20 uM stocks for RT-PCR for sequencing reactions. Sequencing primers are used at a concentration of 3.2 pmol/ul or 0.02 ug/ul (for a 20-22 nt primer). Example calculation The concentration of the primer is listed as 407.58 uMolar. This is the same as 407.58 uM/l. Dividing the stock concentration by the working dilution concentration produces the dilution factor:407.58/3.2 = 127 The stock has to be diluted 1:127 to produce the working dilution. To make 100 ul of working dilution, divide 100 by the dilution factor to get the amount of stock needed: 100 ul/127=0.79 ul of primer stock. You can round up or down to the nearest 0.1 ul. Add 0.8 ul of primer stock to 99.2 ul of nuclease free water. Template concentrations Generally, use 1 ul of the purified PCR product. A template gel should be run after purification to verify recovery of the PCR product after cleanup. If the band on the template gel is faint, the amount of template in the sequencing reaction can be increased to 5 ul. The total volume of the sequencing reaction is 20 ul. Calculate the amount of water needed depending on the amount of sample DNA that will be used. The following protocol is used for 1 ul sample DNA. Reduce volume of water if a greater volume of template is needed.

Materials needed: Ice Bucket 0.2ul thin walled autoclaved PCR tubes Sample(s) to be sequenced BigDye Terminator V 1.1 (ABI part no. 4336774), thaw on ice Desired sequencing primer diluted to 0.02ug/ul Nuclease Free water 5X Sequence reaction buffer provided in the BigDye version 1.1 kit 96 Well cold plate Thermocycler (ABI GeneAmp PCR system 9700)

Procedures 1. Fill ice bucket and get required materials from –20 C freezer. 2. Turn on thermocycler to pre-heat block. 3. Place cold plate in ice to cool, place reagents and BigDye in ice to thaw. 4. Add 0.2 ul tubes as needed and label (2 tubes are needed for each fragment, 4 tubes in total). 5. Make a master mix of water, buffer and BigDye in a 1.5 ml tube and aliquot into 0.2ul reaction tubes as shown in worksheet below. 6. Add primer to each tube: add the appropriate template last. 7. Select program for sequencing on the thermocycler (25 cycles of 96°C for 30 sec, 50°C for 15 sec, 60°C for 4 min, followed by a 4°C hold). 8. Start program and let the temperature of the block get to 90°C and pause the run. 9. Add your tubes to the thermocycler and continue the run. Go directly from the cold plate to the hot block. After the cycle is complete, proceed to clean up (reactions can be stored at 4 C in the dark, if necessary). Sequencing reactions will need to be cleaned with the Agencourt CleanSeq kit prior to analysis with the ABI Sequencer.

Sequencing Work Sheet for Rubella 2 Fragment System Using ABI BigDye Date: Themocycler: Experiment title:

Set up 1 reaction for each primer (4 total) Fragment 1 Component ul/RX # Rxs + 1 Total vol 1. 5X BigDye Buffer 2 2. BigDye 4 3. Nuclease Free Water 12 4. Primer (.02 ug/ul) 1 5.DNA template 1 Total volume 20 Fragment 1 forward primer: 8633F Fragment 1 reverse primer: 9112R Fragment 2 forward primer: 8945F Fragment 2 reverse primer: 9577R Master Mix: add first 3 reagents Master Mix Dispense Vol: 18 ul/tube Primer and template: add to each tube PCR conditions 25 cycles of: 96 C for 30 sec. 50 C for 15 sec. 60 C for 4 min. Final: 4 C hold Template: Template: Template: Template: Fragment Fragment Fragment Fragment 1 1 2 2

Note: The PCR primers given above work well when a large amount of DNA is present. If the sequences do not work well due to insufficient quantities of DNA, internal sequencing primers will often give a better result.

Sequencing reactions-Measles Purpose The purpose is to derive the sequence of the 456 nucleotides of the end of the N gene coding region using the DNA fragment generated in the Qiagen RT-PCR reactions. Sequences are set up in duplicate. The 4 resulting sequences will then be analyzed for genotyping. Preparation of working stocks for primers In the past, primers MV60 and MV63.3 were used for sequencing. While these primers can still be used, it is recommended to switch to the new primers, MeV214 and MeV216. • For sequencing reactions, make fresh dilutions from the primer stocks. • Do not use the 20 uM stocks for RT-PCR for sequencing reactions. Sequencing primers are used at a concentration of 3.2 pmol/ul or 0.02 ug/ul (for a 20-22nt primer). Example calculation The concentration of the primer is listed as 407.58 uMolar. This is the same as 407.58 uM/l. Dividing the stock concentration by the working dilution concentration produces the dilution factor:407.58/3.2 = 127 The stock has to be diluted 1:127 to produce the working dilution. To make 100 ul of working dilution, divide 100 by the dilution factor to get the amount of stock needed: 100 ul/127=0.79 ul of primer stock. You can round up or down to the nearest 0.1 ul. Add 0.8 ul of primer stock to 99.2 ul of nuclease free water. Template concentrations Generally, use 1 ul of the purified PCR product. A template gel should be run after purification to verify recovery of the PCR product after cleanup. If the band on the template gel is faint, the amount of template in the sequencing reaction can be increased to 5 ul. The total volume of the sequencing reaction is 20 ul. Calculate the amount of water needed depending on the amount of sample DNA that will be used. The following protocol is used for 1 ul sample DNA. Reduce volume of water if a greater volume of template is needed.

Materials needed: Ice Bucket 0.2ul thin walled autoclaved PCR tubes Sample(s) to be sequenced BigDye Terminator V 1.1 (ABI part no. 4336774) * Thaw on ice Desired sequencing primer diluted to 0.02ug/ul Nuclease Free water 5X Sequence reaction buffer provided in the BigDye version 1.1 kit 96 Well cold plate Thermocycler (ABI GeneAmp PCR system 9700)

Procedures 1. Fill ice bucket and get required materials from –20 C freezer. 2. Turn on thermocycler to pre-heat block. 3. Place cold plate in ice to cool, place reagents and BigDye in ice to thaw. 4. Add 0.2 ul tubes as needed and label (4 tubes are needed for each PCR product). 5. Make a master mix of water, buffer, primer and BigDye in a 1.5 ml tube and aliquot into 0.2ul reaction tubes as shown in worksheet below. 6. Add the appropriate template last. Mix by flicking tubes, then spin briefly to collect. 7. Select program for sequencing on the thermocycler (25 cycles of 96°C for 30 sec, 50°C for 15 sec, 60°C for 4 min, followed by a 4°C hold). 8. Start program and let the temperature of the block get to 90°C and pause the run. 9. Add your tubes to the thermocycler and continue the run. Go directly from the cold plate to the hot block. After the cycle is complete, proceed to clean up (reactions can be stored at 4 C in the dark, if necessary). Sequencing reactions will need to be cleaned with the Agencourt CleanSeq kit prior to analysis with the ABI Sequencer. Sequencing work sheet for measles using ABI BigDye Date: Thermocycler: Experiment title:

Set up 2 reactions for each primer, a total of 4 reactions per template Component 1. Nuclease-free water 2. 5x BigDye buffer 3. BigDye 4. Primer (0.02 ug/ul) 5. DNA template Total volume Ul/reaction 12 2 4 1 1 20 Number of reactions+1 Total volume for master mix

xxxxx

xxxxxx

Make a master mix with components 1-4: Make one master mix for primer MeV214 and one master mix for primer MeV216. Aliquot 19 ul of master mix into each tube. Add 1 ul template to each tube. PCR conditions 25 cycles of: 96 C for 30 sec (denaturation) 50 C for 15 sec (annealing) 60 C for 4 min (extension) Then hold at 4 C

Sequence Cleanup for use with ABI 3100 or 3130 PURPOSE: To remove unincorporated dye-labeled dNTPs and enzyme from samples for loading to sequencer before performing capillary electrophoresis. Materials/Reagents/Equipment provided: Cycle sequencing products (measles and rubella) Qiagen DyeEx 2.0 Spin Kit (Cat. no.: 63204, 50 columns; 63206, 250 columns) 1.5ml snap cap vials Micropipettes Aerosol-free pipette tips Vortex mixer Microcentrifuge Tomy centrifuge (0.2ml tubes) Speedvac vacuum drier Procedures (1) Gently vortex the spin column to resuspend the resin. (2) Loosen the cap of the column a quarter turn (to avoid a vacuum inside the spin column). (3) Snap off the bottom closure of the spin column and place the spin column in a 2 ml collection tube provided. (4) Centrifuge at 750 × g for 3 minutes. (5) Label one 1.5ml snap cap vial for each sequencing reaction PCR tube. (6) Discard the collection tube and carefully transfer the spin column to a clean 1.5ml snap cap vial. (7) Slowly apply the sequencing reaction mixture onto the centre of the slanted gel bed surface so that the drops are absorbed into the gel and instead of flowing down the sides of the gel bed. [Note: Do not allow the sequencing reaction mixture or the pipette tip to touch the sides of the column. Avoid touching the gel bed surface with the pipette tip. It is not necessary to replace the lid on the column.] (8) Centrifuge at 750 × g for 3 minutes. [Place the column such that the slanted gel bed surface faces the centre of the rotor.] (9) Remove the spin column from the 1.5ml snap cap vial. (10) Vacuum dry the vials containing the eluate for 1 hour (until the content is dried up). Preparation of samples for loading to sequencer (1) Thaw the Hi-Di formamide. Vortex gently to mix and pulse-spin the content. (2) Switch on the heat block and adjust the temperature to 95oC. (3) In a biological safety cabinet, add 15µl of Hi-Di formamide into each 1.5ml snap cap vial containing the dried cycle sequencing product. Vortex briefly and pulse-spin the content. (4) Incubate the 1.5ml snap cap vials in the heat block at 95oC for 5 minutes. (5) Chill the vials in ice for 5 minutes. (6) Vortex briefly to mix and pulse-spin the content. (7) Remove the plate septa from the 96-well plate. Transfer the content to corresponding wells on the 96-well plate. (8) Cover the plate with the plate septa. 28

Sequencing run (Example from CDC) 1. Before starting a run, verify that there is enough polymer in the syringe, that there is sufficient buffer in the buffer container and the ‘shot glass’ and sufficient water in the water container. 2. A constant green light at the front of the sequencer indicates that it is ready to run. A flashing green light indicates that it is already running. 3. Place 96 well reaction plate into black base. There is a ‘cut’ corner, so the plate will fit only one way. Place white retainer on reaction plate. You should hear it click into place and the holes in the white retainer line up with the wells in the septa lid. 4. Press the ‘tray’ button at the front of the sequencer once. The tray moves to the front of the sequencer. Open the door of the sequencer and place plate assembly in its housing on the tray, either the on right (position B) or on the left (position A). There is a notch at one of the short ends of the black base, this goes towards the back of the tray. Close the door. 5. Take note as to which position “A or B” your plate is in. The tray will move back into its original position. 6. Important: While the tray is moved to the front, the capillaries are not inserted into the buffer reservoir. Do not leave the doors open for an extended period of time because the capillaries will dry out. 7. When the door is opened, the orange light at the front of the sequencer will light up. Once the door is closed and the tray has moved back, the green light at the front of the sequencer lights up again. Establishing a sample sheet • Open the Foundation Data Collection program. From the options on the left hand side, choose ‘plate manager’. At the bottom of the screen, click on ‘new’. Fill out the following fields: • Name: Name the sample sheet. This will be the name of the folder that will contain your sequencing results later. Remember or write down this name as you will need it later. This name is case sensitive. • Description: it is not necessary to fill out this field. • Application: click on the arrow, choose the appropriate application file. • Plate type: choose ’96 well’. • Owner name: fill in your initials • Operator name: fill in your initials • Click ‘OK’. A spreadsheet will open with the following columns • Well number: this is provided by the spreadsheet and corresponds to the position of the well on the 96 well plate. • Sample name: This is your sample ID. 29

• • • • • • •

Comment: It is not necessary to fill out this field. Priority: It is not necessary to fill out this field. Results group 1: Right click on the empty field, choose the appropriate results file Instrument protocol: Right click on the empty field, choose the appropriate protocol file. Analysis protocol: Right click on the empty field, choose the appropriate analysis file. The fields for results group, instrument protocol and analysis protocol need to be filled for all wells used. Click ‘ok’ at the bottom of the window. The Sample Sheet closes and the program returns to the main screen of the Foundation data collection program.

Starting the run 1. From the list of options on the left hand side, choose ‘Run scheduler’. This window allows you to choose a sample sheet and link it with your plate: 2. In the field below ‘scan or type plate ID’, type the name of your sample sheet. It is important to type it exactly the same way as in the sample sheet. 3. Click on ‘search’. The field below lists your sample sheet with its plate ID, application and the status. At this point, the status is listed as ‘pending’. 4. On the right hand side of the screen are two large fields representing the two plate trays in the sequencer, A on the left and B on the right. Empty trays are represented in grey. Trays with a plate that has not yet been linked to a sample sheet are yellow. Since you have already placed your plate in the sequencer, the corresponding field is yellow. 5. Click on the field representing your plate, then click on the plate ID. This links the plate to the sample sheet. The field representing the plate turns green, indicating that the link has been established. 6. If you wish to run two plates, search for the second plate ID, then link it to the second plate. 7. In the upper left corner of the window is a ‘play’ arrow. Once the plate and sample sheet are linked, this arrow turns green. Click on the green arrow. 8. A text box will open and read “You are about to start running sequences”. Click OK. The status of your run will be listed as ‘processing’. 9. The green light at the front of the sequencer will start flashing. It will continue to flash during the run. A red light indicates a problem with the run.

Sequence Analysis: Measles Genotyping MEGA v4.0.2: This program can be used to view and edit chromatogram files, create a final sequence, create an alignment with reference sequences, and determine a genotype by phylogenetic analysis. The full manual for Mega v4.0.2 can be downloaded from: http://www.megasoftware.net/manual_pdf.html To view chromatogram files (abi files from the sequencer) and edit the sequences: 1. Open MEGA program. Go to Alignment>Alignment Explorer/CLUSTAL. Check “create a new alignment” then “OK”. Check “Yes” for DNA (nucleotide sequences). An alignment window will open. Go to Edit>Insert Sequence from File (or click the “insert sequence” icon). Browse to the folder containing the .abi sequences and click on the abi file for the forward sequencing reactions (primers 60 or 216). 2. Click on the primer name to select the sequence. 3. To find the beginning of the measles genotyping sequence, in the alignment editor go to Search>Find Motif (or icon). Type in AAGGTCA (the A is the starting nucleotide of the 456-nt window in the measles N gene). 4. The query sequence should be highlighted in yellow and this sequence is typically about 100 nucleotides from the beginning. Use the mouse to select the nucleotides from the beginning of the sequence to the A (alternatively, highlight the first nucleotide; hold the “shift” key then click on the nucleotide before the A. This will allow you to highlight the region to be cut). Click on the X to delete the selected nucleotides. The first nucleotides should now be AAGGTCA. 5. The sequence for this fragment should be about 456 nts long. Look at the bottom left of the window where it says “Site#” and type “456” then hit the “Enter” key. The nucleotide 456 will be highlighted in white in the middle of the window. Click on the grey bar above the nucleotide to verify the nucleotide #. The last 12 nucleotides of the sequencing window are CTTCTAGACTAG (note: Not all viruses will have this exact sequence. An alternative is to search for TAG, then click ‘Search Again’ until you find the right region).Click on the first nucleotide after TAG and drag the mouse to the end of the sequence (alternatively, highlight the first nucleotide then scroll down to the end of the sequence; hold the “shift” key then click on the last nucleotide. This will allow you to highlight the region to be cut). Delete the selected nucleotides. 7. Go back to Edit>Insert Sequence ( ) and find and open the abi files for the reverse primers (63 or 216). 12. Since this is a reverse primer, we need to get it in the correct orientation. Be sure the name of the sequence is selected then go to Data>Reverse Complement. 13. Repeat steps 3-5 to obtain the 456 nt sequence. 14. Look at the grey bars above the nucleotides. There will be an asterisk at every residue where there is agreement between the nucleotides of the 2 sequences. If there are any mismatches, look at the chromatograms to resolve the problem. a) When there is a discrepancy, go to Sequencer>Edit Sequence File. Browse to the folder with the .abi files, select and open the appropriate .abi file(s). In the chromatogram 31

window, go to Edit>Find and type in nts close to problem area and look at the peaks. If you are viewing a chromatogram from one of the reverse primers, you can reverse complement the chromatogram to make the comparison easier. b) If you find that changes need to be made, go to back to the sequence in the alignment window and make the correction. Under Edit make sure allow base editing is checked. You can click after a nucleotide and backspace to delete, then type in the correct nucleotide. c) In some cases, especially with the reverse primers, the last 15-20 nucleotides of the 456 nucleotide sequencing window may be difficult to read because these are close to the primer binding site. This proximity to the binding site often leads to high background and “noise” for the first bases. If this is the case, delete these bases. 16. The goal of the alignment is to have a sequence that covers the 456 nucleotide window in which all of the nucleotides match (all asterisks). After all nucleotides match (also make sure both sequences stop at the same nucleotide), select one of the sequences to be the reference sequence and delete the remaining sequences using Edit->Cut. This leaves a single sequence for the sample. Go to Data>Export Alignment and save the sequence as a .fas (FASTA) file (for example “virus name.fas”. This fragment should be exactly 456 nt in length. The .fas file can be opened with the Microsoft Text Editor if you need to check it. To make an alignment file to use for phylogenetic analysis: 1. Open the sequence created in the final step above in a NewAlignment window. 2. Go to Import Sequences and browse to find the fasta file containing the WHO reference sequences. Highlight and import. Check the alignment carefully to make sure that the new sequence aligns with the reference sequences. If there is a problem with the alignment, check the chromatograms again. 3. Go to Data>Export Alignment and choose Mega Format. Save the file in mega format (virus name.meg). When prompted to ‘input title of the data’, choose a title (e.g. the virus name or outbreak name). When asked whether the sequence is ‘protein-coding nucleotide data’, click on yes. Close the window. Open the new Mega file by clicking on file, then open data. Proceed to Phylogenetic analysis.

Sequence Analysis for rubella virus 2 fragment genotyping MEGA v4.0.2: This free program can be used to view and edit chromatogram files, create a consensus sequence, and create an alignment with reference sequences. The aligned file can be used for phylogenetic analysis. The full manual can be downloaded from http://www.megasoftware.net/manual_pdf.html To view chromatogram files (abi files from the sequencer) and edit the sequences: A. Rubella 5’ Fragment of the 739-nt window (Fragment1) 1. Open MEGA program. Go to Alignment>Alignment Explorer/CLUSTAL. Check “create a new alignment” then “OK”. Check “Yes” for DNA (nucleotide sequences). An alignment window will open. Go to Edit>Insert Sequence from File (or click the “insert sequence” icon). Browse to the folder containing the .abi sequences and click on the Fragment 1 forward primer.abi file. 2. In the Alignment Explorer window, click on the primer name to select the sequence. 3. To find the beginning of the rubella genotyping sequence, in the alignment editor go to Search>Find Motif (or icon). Type in GTTYCAYAC (the G is the starting nucleotide of the 739-nt window; the Y means the nucleotide is either a C or T). 4. The query sequence should be highlighted in yellow. In order to remove the nucleotides prior to the 739 nt start site, drag the mouse to select the nucleotides from the beginning up to the G (alternatively, highlight the first nucleotide of the sequence; hold the “shift” key then click on the nucleotide before the G. This will allow you to highlight the region to be cut). Click on the X to delete the selected nucleotides. The first nucleotide should now be the G. 5. The sequence for this fragment should be about 350 nts long. Look at the bottom left of the window where it says “Site#” and type “350” then hit the “Enter” key. The nucleotide 350 will be highlighted in white in the middle of the window. Click on the grey bar above the nucleotide to verify the nucleotide #, then drag the mouse to the end of the sequence (alternatively, highlight the first nucleotide then scroll down to the end of the sequence; hold the “shift” key then click on the last nucleotide. This will allow you to highlight the region to be cut). Delete the selected nucleotides. 6. Go back to Edit>Insert Sequence ( ) and find and open the Fragment 1 reverse primer .abi file. 7. Since this is a reverse primer, it must be converted to the correct orientation. Be sure the name of the sequence is selected then go to Data>Reverse Complement. 8. Repeat steps 3-5 to obtain the 350 nucleotide sequence. 9. Look at the grey bars above the nucleotides. There will be an asterisk at every residue where there is agreement between the nucleotides of the 2 sequences. If there are any mismatches, look at the chromatograms to resolve the problem. a) When there is a discrepancy, go to Sequencer>Edit Sequence File. Browse to the folder with the .abi files, select and open the appropriate .abi file(s). In the chromatogram window, go to Search>Find (or ) and type in nts close to problem area and look at 33

the peaks. b) If you find that changes need to be made, go to back to the sequence in the alignment window and make the correction. Under Edit make sure allow base editing is checked. You can click after a nucleotide and backspace to delete, then type in the correct nucleotide. 10. After all nucleotides match (also make sure both sequences stop at the same nucleotide), select one of the sequences and go to Edit->Cut. This leaves a single sequence for Fragment 1. Go to Data>Export Alignment and save the sequence as a .fas (FASTA) file (for example “virus name_5.fas”. This fragment should be 350 nucleotides in length. B. Rubella 3’ Fragment of the 739-nt window (Fragment 2) The steps for fragment 2 are similar, except that we need to make sure we have sufficient overlap and to remove extra nucleotides after the 3’ end of the 739-nt window. 1. Click to open a new window. As in step 1 above, click to insert new sequence, browse to the abi file folder and open the Fragment 2 forward primer.abi file. Click the and type in TRGGGGC where R can be an A or G. This will be the beginning of fragment 2. Select and delete any nucleotides before the T. NOTE: the majority of rubella viruses have a G as R; however, for some 1h viruses the G is replaced by an A. 2. Now, click the and type in GGGGYGAG where Y can be a C or T. This is the 3’ terminal sequence of the 739-nt window. Select and remove all of the sequence after the final G. The sequence should now be 476 nucleotides in length. NOTE: the majority of rubella viruses have a C as Y; however, for some 1G and 2B viruses the C is replaced by a T. 3. Insert the Fragment 2 reverse primer.abi file. 4. Select the name of the sequence, then go to Data> Reverse Complement. and type in the TRGGGGC as in step 1 of this section. 5. Click the Delete the upstream nucleotides as was done for the forward sequence, then search for GGGGYGAG and remove the nucleotides after the final G. 6. The 2 sequences should now start and end with the same nucleotides. Check the asterisks for agreement between the 2 sequences. 7. As before, go to the chromatograms to resolve any discrepancies between the sequences. 8. When all of the nucleotides are in agreement, cut one of the primer sequences and export the other as a “virus name_3.fas” file. This fragment should be 476 nucleotides in length. C. Combining the fragments 1. There should now be 1 sequence for fragment 2 (3’fragment) in the alignment window. Click the Insert Sequence icon , browse to the folder containing the 2 .fas files made above; select the .fas file for fragment 1 (virus name_5.fas) and open it. 2. There are 2 options for overlapping the 2 sequences. a. Manual: select the 3’ (longer) sequence and click on the first nucleotide. Click on the right arrow icon and the sequence will move downstream toward the end of the 5’ fragment sequence. 34

The overlapping region can be aligned visually. This has to be done one nucleotide at a time so it is not very efficient. We do not recommend this method for the two-fragment protocol. b. Automatic: use the “mark sequence” method. Click on the first nucleotide of the 3’ (longer) sequence. Go to Alignment>Mark Site (or click the “mark site” icon ). The

. Type marked nucleotide will turn light blue. Select the 5’sequence name and click on the in TRGGGGC (the first 7 nt of the 3’ sequence). This query sequence should now be highlighted within the 5’ sequence. Click on the first nucleotide of the query (T) and click the mark site icon. Go to Alignment>Align Marked Sites (or click on the “align marked sites” icon ). The 2 sequences should now appear as 2 overlapped sequences. 4. Check the asterisks in the overlapped region to make sure the nucleotides in the overlap match. If there are any mismatches, re-examine the chromatograms in the problem area. 5. To generate full-length 739-nt sequence of the virus, go to Edit>Insert New Blank Sequence (or the insert blank sequence icon ). Select the nucleotides of the 5’ sequence up to the overlap start and go to Edit>Copy. Paste the copied sequence into the new blank sequence line. Select the 3’ sequence and copy the nucleotides from the beginning of the overlap to the end of the 3’ sequence. Paste this sequence at the end of the 5’ sequence in the new sequence line. Make sure you now have a sequence that is 739 nt long starting with GTT and ending with GAG. 6. Right click on the full length sequence name (Sequence 3), choose Edit Sequence Name and rename as “virus name_739”. Go to Data>Export Alignment and save all 3 sequences as a .fas file. To make an alignment file to use for phylogenetic analysis: 1. Open the sequence created in the final step above in a NewAlignment window. 2. Select the 2 overlapping sequences (5’ and 3’) and go to Edit>Cut. There should now be one 739-length sequence in the window. To compare to the rubella reference sequences, go to Import Sequences and browse to find the reference sequence fasta file. Highlight and import. The new sequence should line up with the reference sequences. Go to Data>Export Alignment and choose Mega Format. Save the file in mega format and it is ready to be used for phylogenetic analysis. EAbernathy, MMRHVLB, October 2010

Appendix 1: Primers and reference sequences Primers for MeV genotyping RT-PCR Size nt 20 20

Name MeV216 (forward) MeV214 (reverse)

Sequence TGG AGC TAT GCC ATG GGA GT TAA CAA TGA TGG AGG GTA GG

Notes: The map below shows the sequence of the N gene of measles virus (Edmonston strain). The binding regions of the primers are indicated by underlining and bold face type. Arrows indicate direction (5’-3’). The minimal region to be sequenced for genotyping is indicated by ‘start of window’ and ‘end of window’. For genotyping, use primers MeV214 and MeV216. The primers recommended in previous versions of this manual, MV60 and MV63.3 may also be used, however, we recommend the new primers, since they increase the distance between the reverse primer and the sequencing window. Primers MV61, MV62 are additional sequencing primers.

Measles N gene Primer Map and Sequence N-GENE PRIMER MAP 1 ACC AAA CAA AGT TGG GTA AGG ATA GTT CAA ATC AAT GAT CAT CTT CTA 48

GTG CAC TTA GGA TTC AAG ATC CTA TTA TCA GGG ACA AGA GCA GGA TTA

GGG ATA TCC GAG ATG GCC ACA CTT TTA AGG AGC TTA GCA TTG TTC AAA

144

145

AGA AAC AAG GAC AAA CCA CCC ATT ACA TCA GGA TCC GGT GGA GCC ATC

192

193

AGA GGA ATC AAA CAC ATT ATT ATA GTA CCA ATC CCT GGA GAT TCC TCA

240

241

ATT ACC ACT CGA TCC AGA CTT CTG GAC CGG TTG GTC AGG TTA ATT GGA

288

289

AAC CCG GAT GTG AGC GGG CCC AAA CTA ACA GGG GCA CTA ATA GGT ATA

336

337

TTA TCC TTA TTT GTG GAG TCT CCA GGT CAA TTG ATT CAG AGG ATC ACC

384

385

GAT GAC CCT GAC GTT AGC ATA AGG CTG TTA GAG GTT GTC CAG AGT GAC

432

433

CAG TCA CAA TCT GGC CTT ACC TTC GCA TCA AGA GGT ACC AAC ATG GAG

480

481

GAT GAG GCG GAC CAA TAC TTT TCA CAT GAT GAT CCA ATT AGT AGT GAT

528

529

CAA TCC AGG TTC GGA TGG TTC GAG AAC AAG GAA ATC TCA GAT ATT GAA

576

577

GTG CAA GAC CCT GAG GGA TTC AAC ATG ATT CTG GGT ACC ATC CTA GCC

624

625

CAA ATT TGG GTC TTG CTC GCA AAG GCG GTT ACG GCC CCA GAC ACG GCA

672

673

GCT GAT TCG GAG CTA AGA AGG TGG ATA AAG TAC ACC CAA CAA AGA AGG

720

721

GTA GTT GGT GAA TTT AGA TTG GAG AGA AAA TGG TTG GAT GTG GTG AGG

768

769

AAC AGG ATT GCC GAG GAC CTC TCC TTA CGC CGA TTC ATG GTC GCT CTA

816

817

ATC CTG GAT ATC AAG AGA ACA CCC GGA AAC AAA CCC AGG ATT GCT GAA

864

865

ATG ATA TGT GAC ATT GAT ACA TAT ATC GTA GAG GCA GGA TTA GCC AGT

912

913

TTT ATC CTG ACT ATT AAG TTT GGG ATA GAA ACT ATG TAT CCT GCT CTT

960

961

GGA CTG CAT GAA TTT GCT GGT GAG TTA TCC ACA CTT GAG TCC TTG ATG

1008

1009

AAC CTT TAC CAG CAA ATG GGG AAA CCT GCA CCC TAC ATG GTA AAC CTG

1056

1057

1105

GAG AAC TCA ATT CAG AAC AAG TTC AGT GCA GGA TCA TAC CCT CTG CTC MeV216 (nt 1105-1124) MV60 (nt 1109-1132) TGG AGC TAT GCC ATG GGA GTA GGA GTG GAA CTT GAA AAC TCC ATG GGA

1104

1152

1153

GGT TTG AAC TTT GGC CGA TCT TAC TTT GAT CCA GCA TAT TTT AGA TTA ↓ start of window GGG CAA GAG ATG GTA AGG AGG TCA GCT GGA AAG GTC AGT TCC ACA TTA

1200

1201

1248

1249

MV61 GCA TCT GAA CTC GGT ATC ACT GCC GAG GAT GCA AGG CTT GTT TCA GAG 1296

1297

ATT GCA ATG CAT ACT ACT GAG GAC AAG ATC AGT AGA GCG GTT GGA CCC

1344

AGA CAA GCC CAA GTA TCA TTT CTA CAC GGT GAT CAA AGT GAG AAT GAG

1392

1394

CTA CCG AGA TTG GGG GGC AAG GAA GAT AGG AGG GTC AAA CAG AGT CGA

1440

1441

GGA GAA GCC AGG GAG AGC TAC AGA GAA ACC GGG CCC AGC AGA GCA AGT

1488

1489

GAT GCG AGA GCT GCC CAT CTT CCA ACC GGC ACA CCC CTA GAC ATT GAC MV62 ACT GCA TCG GAG TCC AGC CAA GAT CCG CAG GAC AGT CGA AGG TCA GCT

1536

1537

1584

1585

GAG CCC CTG CTT AGG CTG CAA GCC ATG GCA GGA ATC TCG GAA GAA CAA

1632

1633

1681 1729

GGC TCA GAC ACG GAC ACC CCT ATA GTG TAC AAT GAC AGA AAT CTT CTA ↓ end of window MV63 MeV214 GAC TAG GTG CGA GAG GCC GAG GGC CAG AAC AAC ATC CGC CTA CCC TCC ATC ATT GTT ATA AAA AA

1680

1728

Primer Sequences for rubella RT-PCR Rubella Diagnostic and Genotyping Primers Name RV 11 RV 12 RV12-2 8633F 9112R 8945F 9577R Size 20 nts 20 nts 20 nts 20 nts 21 nts 17 nts 21 nts Sequence 5' CAA CAC GCC GCA CGG ACA AC 3' 5' CCA CAA GCC GCG AGC AGT CA 3' 5’ CCA CGA GCC GCG AAC AGT CG 3’ 5’ AGC GAC GCG GCC TGC TGG GG 3’ 5’ GCG CGC CTG AGA GCC TAT GAC 3’ 5’ TGG GCC TCC CCG GTT TG 3’ 5’ CGC CCA GGT CTG CCG GGT CTC 3’ NT #s 8812-8831 8977-8996 8977-8996 8633-8652 9092-9112 8945-8961 9557-9577

E1 Primer Map

E1 start

8221 GGTCGTCCTGCAGGGGTACAACCCCCCCGCCTATGGCGAGGAGGCTTTCACCTACCTCTG 8280

8281 CACTGCACCGGGGTGCGCCACTCAAGCACCTGTCCCCGTGCGCCTCGCTGGCGTCCGTTT 8340

8341 TGAGTCCAAGATTGTGGACGGCGGCTGCTTTGCCCCATGGGACCTCGAGGCCACTGGAGC 8400

. . . . . . 8401 CTGCATTTGCGAGATCCCCACTGATGTCTCGTGCGAGGGCTTGGGGGCCTGGGTACCCGC 8460 . . . . . . 8461 AGCCCCTTGCGCGCGCATCTGGAATGGCACACAGCGCGCGTGCACCTTCTGGGCTGTCAA 8520 . . . . . . 8521 CGCCTACTCCTCTGGCGGGTACGCGCAGCTGGCCTCTTACTTCAACCCTGGCGGCAGCTA 8580 . . . . . 8633F . 8581 CTACAAGCAGTACCACCCTACCGCGTGCGAGGTTGAACCTGCCTTCGGACACAGCGACGC 8640 . . . . . . 8641 GGCCTGCTGGGGCTTCCCCACCGACACCGTGATGAGCGTGTTCGCCCTTGCTAGCTACGT 8700 . . . . . . 739 start 8701 CCAGCACCCTCACAAGACCGTCCGGGTCAAGTTCCATACAGAGACCAGGACCGTCTGGCA 8760 . . . . . RV11 8761 ACTCTCCGTTGCCGGCGTGTCGTGCAACGTCACCACTGAACACCCGTTCTGCAACACGCC 8820 . . . . . . 8821 GCACGGACAACTCGAGGTCCAGGTCCCGCCCGACCCCGGGGACCTGGTTGAGTACATTAT 8880 . . . . . . 8881 GAATTACACCGGCAATCAGCAGTCCCGGTGGGGCCTCGGGAGCCCGAATTGCCACGGCCC 8940 RV12 . 8945F . . . . 8941 CGATTGGGCCTCCCCGGTTTGCCAACGCCATTCCCCTGACTGCTCGCGGCTTGTGGGGGC 9000

. . . . . . 9001 CACGCCAGAGCGCCCCCGGCTGCGCCTGGTCGACGCCGACGACCCCCTGCTGCGCACTGC 9060 . . . . 9112R . . 9061 CCCTGGACCCGGCGAGGTGTGGGTCACGCCTGTCATAGGCTCTCAGGCGCGCAAGTGCGG 9120 . . . . . . 9121 ACTCCACATACGCGCTGGACCGTACGGCCATGCTACCGTCGAAATGCCCGAGTGGATCCA 9180 . . . . . . 9181 CGCCCACACCACCAGCGACCCCTGGCATCCACCGGGCCCCTTGGGGCTGAAGTTCAAGAC 9240 . . . . . . 9241 AGTTCGCCCGGTGGCCCTGCCACGCACGTTAGCGCCACCCCGCAATGTGCGTGTGACCGG 9300 . . . . . . 9301 GTGCTACCAGTGCGGTACCCCCGCGCTGGTGGAAGGCCTTGCCCCCGGGGGAGGCAATTG 9360 . . . . . . 9361 CCATCTCACCGTCAATGGCGAGGACCTCGGCGCCGTCCCCCCTGGGAAGTTCGTCACCGC 9420 . . . . . . 739 end 9421 CGCCCTCCTCAACACCCCCCCGCCCTACCAAGTCAGCTGCGGGGGCGAGAGCGATCGCGC 9480 . . . . . .

9481 GACCGCGCGGGTCATCGACCCCGCCGCGCAATCGTTTACCGGCGTGGTGTATGGCACACA 9540 . . 9577R . . . 9541 CACCACTGCTGTGTCGGAGACCCGGCAGACCTGGGCGGAGTGGGCTGCTGCCCATTGGTG 9600 . . . . . . 9601 GCAGCTCACTCTGGGCGCCATTTGCGCCCTCCCACTCGCTGGCTTACTCGCTTGCTGTGC 9660 . . . . . . E1 stop 9661 CAAATGCTTGTACTACTTGCGCGGCGCTATAGCGCCTCGCTAGTGGGCCCCCGCGCGAAA 9720 9721 CCCGCACTAGGCCACTAGATCCCCGCACCTGTTGCTGTATAG 9762

The rubella virus diagnostic, fragment 1, and fragment 2 primer locations are indicated. The 739 genotyping window and the E1 coding region start and end sites are also marked.

Rubella Sequencing Primers for Two Fragments These are internal primers that may work better with some templates, especially if the amount of DNA is low. Primer 8955F does not work well with some viruses (primarily Clade 2), so both 8955F and 8955F-2 can be included in one sequencing reaction if the genotype is unknown. Name 8635F 9102R 8955F 8955F-2 9545R Size 15 nts 21 nts 20 nts 19 nts 17 nts Sequence 5’ CGA CGC GGC CTG CTG 3’ 5' GAG CCT ATG ACA GGC GTG ACC 3' 5’ CGG TTT GCC AAC GCC ATT CC 3’ 5’ CGG TTT CTC AGC GCC ACT C 3’ 5’ TGG TGT GTG TGC CAT AC 3’ NT #s 8635-8649 9082-9102 8955-8974 8955-8973 9529-9545

Worksheet: Qiagen (CAT# 210210/210212). Measles genotyping RT-PCR Reaction Date:______________ Component

Operator:_____________________ [Final] conc. Vol/rxn # of rxns plus 1 Total vol. Added?

Forward Primer:_______________ Reverse Primer:_______________ Total reaction volume: 50 ul Positive control:____________Negative control:____________ Cycling parameters for Qiagen-Measles 50 C for 30 min 95 C for 15 min 40 cycles of: 94 C for 30 sec 55 C for 30 sec 72 C for 30 sec Followed by 72 C for 10 min, then hold at 4 C

Worksheet: Qiagen (CAT# 210210/210212). Rubella genotyping RT-PCR Reaction Fragment 1 Component 1. RNAse free H20 2. 5X reaction buffer 3. 5X Q Solution 4. 10 mM dNTP mix 5. Enzyme mix 6.RNAse Inhibitor 7. Forward Primer (20uM) 8. Reverse Primer (20uM) 9.RNA template (add last) Final Volume Forward primer: 8663F Amplicon size: 480 nt Fragment 2 Component 1. RNAse free H20 2. 5X reaction buffer 3. 5X Q Solution 4. 10 mM dNTP mix 5. Enzyme mix 6.RNAse Inhibitor 7. Forward Primer (20uM) 8. Reverse Primer (20uM) 9. RNA template (add last) Final Volume Forward primer: 8945F Amplicon size: 633 nt ul/RX 19.5 10 10 2 2 0.5 0.5 0.5 5 50 ul xxxxxxxx xxxxxxxx # Rxs + 1 Total vol Added?

Reverse primer: 9112R

ul/RX 19.5 10 10 2 2 0.5 0.5 0.5 5 50 ul

# Rxs + 1

Total vol

Added?

xxxxxxxx

Reverse primer: 9577R

Master Mix: add first 8 reagents Master Mix Dispense Vol: 45 ul/tube RNA: add 5 ul Positive Control:_________ Negative Control: _________

Cycling parameters for Qiagen-Rubella genotyping 50 C for 30 min 95 C for 15 min 40 cycles of: 94 C for 30 sec 60 C for 30 sec 72 C for 1 min Followed by 72 C for 10 min, then hold at 4 C

Sequencing Work Sheet for Rubella 2 Fragment System Using ABI BigDye Date: Themocycler: Experiment title:

Sequencing work sheet for measles using ABI BigDye Date: Thermocycler: Experiment title:

xxxxx

xxxxxx

ANNEX 7

----------------------------------------------------------------------------------------------------------------------------------------------Distributed by: Centers for Disease Control and Prevention 1600 Clifton Rd NE, Atlanta, GA 30333

Measles RT-PCR and Genotyping Practice Panel (FTA) Description and intended use: • This kit contains a practice panel of FTA filter paper discs. • Four FTA discs that contain lysates of cells infected with wild-type measles virus and one disc contains a lysates of uninfected cells (negative control). • All discs are non-infectious and stable at room temperature. Store at 4C. • They are used to provide an efficient and low cost means to provide positive controls and test panels for standard measles RT-PCR reactions. • RNA should be extracted from the discs by following the procedure described below. • This RNA should be tested with the Measles Genotyping Kit, Version 2.0 that is available from the CDC. • This material is being provided to allow laboratories to practice the RT-PCR and sequencing reactions needed to obtain a genotype for measles virus. Laboratories should test this panel once they have established the RT-PCR and/or sequencing. PCR products should be sequenced by the laboratories that are capable of sequencing or shipped to the appropriate RRL for sequence analysis. • Results (RT-PCR results, genotype assignment, and sequence data) should be reported via e-mail as specified below Contents: • 1 practice panel containing 4 tubes with 1 FTA (6mm) discs spotted with a lysate of MeVinfected cells per Eppendorf tube and 1 tube with 1 FTA disc spotted with uninfected Vero/hSlam cells. Tubes are numbered 1-5. Standard Precautions for RNA: • Always wear gloves when working with DNA and RNA. • Use sterile plastic tubes, filter tips and RNase-free glassware. • Use reagents and pipettors that are dedicated for RNA use only. • Use nuclease-free water. • Store extracted RNA at -70° C whenever possible. • Avoid repeated freeze-thawing RNA.

Storage of FTA discs: FTA discs can be stored at room temperature in an airtight container such as an eppendorf tube for up to two months; however, the discs should be stored at 4C when possible.

Preparation of FTA discs for RNA extraction using Qiagen Purification of Viral RNA kit: Reagents and materials in addition to those needed for Qiagen kit: FTA discs, 1X PBS, forceps Method: 1. Pipet 600 ul of prepared buffer AVL containing carrier RNA into a 1.5ml micro centrifuge tube. 2. Put one 6 mm FTA paper circle into the AVL buffer, add 150 ul 1x PBS. Mix by pulsevortexing for 15 seconds. 3. Incubate at RT for 10 min. 4. Centrifuge at 13000 rpm for 2 min. 5. Remove 600 ul of the liquid to a new tube. 6. Add 600 ul ethanol. Mix by pulse vortexing for 15 seconds. Spin briefly to collect liquid from the lid. 7. Follow the remainder of the standard Qiagen kit protocol for RNA extraction, Reporting: This panel is being distributed as a practice panel for the measles/rubella laboratories in the WHO Western Pacific Region. • Please perform the RT-PCR and sequence analysis and report no later than 1 February, 2011 • For laboratories without sequencing capacity, please forward PCR products to the RRL, Hong Kong no later than 1 February, 2011 • Please send the following: o Results of the RT-PCR analysis (positive or negative) along with an electronic copy of the photo of the agarose gel. o Measles genotype assignment for each positive sample (include phylogenetic tree and indicate which software was used to generate the tree) o Text files containing the final, corrected sequences o Chromatogram files for each sequence run • Please send results by e-mail to: o WHO/WPRO: Youngmee Jee, jeey@wpro.who.int o RRL, HK: Wilina Lim, wl_lim@dh.gov.hk, wllim@pacific.net.hk o CDC: Paul Rota, prota@cdc.gov o WHO/HQ: David Featherstone, featherstoned@who.int

These reagents are for Research Use Only and have no commercial or monetary value. Approved by: PAUL ROTA (11/25/10)

ANNEX 8

----------------------------------------------------------------------------------------------------------------------------------------------Centers for Disease Control and Prevention 1600 Clifton Rd NE, Atlanta, GA 30333

Rubella Virus RT-PCR and Genotyping Practice Samples Description and intended use: • This kit contains two practice sample tubes labeled RUB RNA A and RUB RNA B. • These tubes contain either rubella virus RNA or control which has been dried into the bottom of the tube. • These materials are non-infectious and non toxic. • These materials are stable at 4 C and room temperature for short periods of time. (for example, during travel to your home laboratory). • When you arrive at your home laboratory, store the practice samples at -70 C until ready to use. • Soon (in a few days) after arriving at your home laboratory follow the simple instructions on the tubes to prepare 1 ml of material in each tube (by adding 1 ml of nuclease free water and gently mixing). • Then freeze two 100 ul aliquots from each tube at -70 C in appropriately labeled nuclease free tubes and discard the remainder of the material in laboratory waste used for viral RNAs. • These practice samples are being provided to allow laboratories to practice the diagnostic RT-PCR and sequencing procedures needed to obtain a genotype for a rubella virus. • Laboratories should test the practice samples with the Rubella Diagnostic RT-PCR kit and the Rubella Virus Genotyping Kit. PCR products should be sequenced by the laboratories that are capable of sequencing or shipped to the appropriate RRL for sequence analysis. • Results (Rubella Diagnostic RT-PCR results (pictures of gels) and Rubella Virus Genotyping Kit results (pictures of gels)), genotype assignment(s), and sequence data (including chromatograms/traces) should be reported via e-mail as described below

Standard Precautions for RNA: • Always wear gloves when working with DNA and RNA. • Use sterile plastic tubes, filter tips and RNase-free glassware. • Use reagents and pipettors that are dedicated for RNA use only. • Use nuclease-free water. • Store extracted RNA at -70° C whenever possible. • Avoid repeated freeze-thawing RNA. Reporting: These samples are being distributed for practice for the measles/rubella laboratories in the WHO Western Pacific Region.

• • •

•

Please perform the diagnostic RT-PCR, the rubella virus genotyping kit RT-PCRs and sequence analysis and provide a report no later than 1 February, 2011 For laboratories without sequencing capacity, please forward PCR products to the RRL, Hong Kong no later than 1 February, 2011 Please send the following: o Results of the Diagnostic RT-PCR (an electronic copy of the photo of the agarose gel for samples A and B and positive and negative controls). o Results of the Rubella Virus Genotyping Kit analysis (electronic copy of the photo of the agarose gel of templates produced from negative and positive controls and from any diagnostic RT-PCR positive samples) o Rubella virus genotype assignment for any positive sample (include a phylogenetic tree and indicate which software was used to generate the tree) o Text files containing the final, corrected sequences o Chromatogram files for each sequence run Please send results by e-mail to: o WHO/WPRO: Youngmee Jee, jeey@wpro.who.int o RRL, HK: Wilina Lim, wl_lim@dh.gov.hk, wllim@pacific.net.hk o CDC: Joseph P. Icenogle, jci1@cdc.gov o WHO/HQ: David Featherstone, featherstoned@who.int

Suggested volume of template to use in RT-PCR reactions is 5 ul.

These reagents are for Research Use Only and have no commercial or monetary value. Approved by: JOSEPH P. ICENOGLE (11/25/10)

Informations clés

Organisation Organisation mondiale de la santé (OMS)

Type de document Technical Documents

Date d'adoption 31 décembre 2010

Source Organisation mondiale de la santé