World Health Organization (WHO) · Journal articles

A clinical, epidemiology and virological study of a dengue fever outbreak in Guangzhou, China-2002-2006.

World Health Organization
View original document

The full text is hosted by the publishing organisation. lawenc.com indexes the metadata and links to the official source.

Full text

A clinical, epidemiological and virological study of a dengue fever outbreak in Guangzhou, China – 2002-2006 Fuchun Zhanga , Xiaoping Tanga, Xuchu Hub, Yecheng Lua, Yanqing Chena, Jian Wanga, Wanshan Chena and Haolan Hea a b

Department of Infectious Diseases, Guangzhou No. 8 People’s Hospital, Guangzhou, 510060, China

Department of Parasitology, Zhongshan Medical College of Sun Yat-sen University, Guangzhou, 510060, China

Abstract We analysed the clinical and epidemiological characteristics of dengue fever (DF) during the dengue virus (DENV)-1 outbreak in Guangzhou, China. Clinical and epidemiological data of 1342 patients with DF from May 2002 to November 2006 were analyzed retrospectively. The average age was 34.7±13.2 years. The ratio of male to female was 1.05:1. The peak time of the epidemic lasted from August to October. The most common manifestations included fever (100%), headache (85.9%), myalgia (64.5%), bone soreness (46.6%), fatigue (78.2%), skin rash (65.9%) and positive tourniquet test (51.3%). Leukopenia, thrombocytopenia, elevated alanine aminotransferase (ALT), elevated aspartate aminotransferase (AST) and hypopotassemia were found in 66%, 61.3%, 69%, 85.7% and 28.4% of the patients respectively. Only 2(0.15%) patients fulfilled the WHO case definition criteria for dengue haemorrhagic fever (DHF), the others were all diagnosed as classic DF. However, 64(4.8%) patients had severe clinical manifestations (internal haemorrhage, shock, marked thrombocytopenia, myocarditis, sepsis, pneumonia and encephalopathy). Anti-dengue IgM was detected in 90% of patients. Dengue viruses were isolated using the Aedes albopictus C6/36 cell line and identified as DENV-1 by RT-PCR. A 346bp fragment from RT-PCR product of every isolate was sequenced to compare with published sequences of other DENV-1 viruses. The nucleotide homology were 97%, 97% and 98% compared with those of DENV-1 strains of dengue fever outbreak in Cambodia, in 1997 and 1999 in China, respectively. In conclusion, the epidemic of dengue fever was caused by DENV-1 infection from 2002 to 2006 in Guangzhou. Patients with severe clinical manifestations are few, but in some of them, the diagnosis of DHF may be missed if the WHO classification is strictly applied, especially in adults. Keywords: Dengue fever; DENV-1, Severe dengue; Epidemiological and clinical characteristics.

Introduction Dengue fever (DF) is an acute febrile viral disease frequently presenting with headaches, bone or joint and muscular pains, rash and leukopenia. DF has become one of the most

important emerging public health problems in the tropics and subtropics. In the past 20 years, there has been a dramatic increase in the number of cases and the severity of illness in countries in South-East Asia, the Caribbean and Latin America.[1,2] An estimated 50-100 million

E-mail: zfc8y@yahoo.com.cn Dengue Bulletin – Volume 31, 2007

10

Dengue fever outbreak in Guangzhou, China – 2002-2006

people across the globe contract dengue annually, with about 500 000 persons developing the more severe dengue haemorrhagic fever/ dengue shock syndrome (DHF/DSS) and resulting in about 21 000 deaths.[3] WHO classifies symptomatic dengue virus infection into three categories: undifferentiated fever, classic dengue fever, and DHF. [3] According to WHO criteria, DHF is defined by the presence of fever, a haemorrhagic tendency, thrombocytopenia, and some evidence of plasma leakage. DHF is further subdivided, with most severe cases categorized as DSS, when circulatory failure is present. The WHO classification system has been widely applied in research settings and publications. In recent years, several studies reported difficulties with classification, especially in adults with many severe cases being missed: more than two thirds of all adults with severe dengue manifestations were not classified as having DHF.[4-7] The first dengue case in Guangdong was reported in 1978. Infections with all 4 dengue virus serotypes (DENV-1, 2, 3, and 4) were reported in Guangdong.[8] The first dengue outbreak was caused by DENV-3 in 1980. Since then, increasing larger outbreaks have been documented throughout the 1980s and the 1990s, caused by DENV-1, DENV-2, and DENV4. In this paper, we present a retrospective analysis of 1342 patients to analyse the epidemiological, clinical, laboratory and virological presentations of the dengue infection from 2002 to 2006 in Guangzhou, China.

initially enrolled in this study. Eighteen patients which were imported cases in 2004-2005 were excluded. Thus, 1342 patients (978 in 2002, 54 in 2003, and 310 in 2006) were analysed in Guangzhou where dengue was endemic. In all patients, a detailed history was taken and clinical examination was done at the time of admission and subsequently during the stay at the hospital. The hospital records for all patients were supported by serological and/or virological confirmation. Serology was performed by indirect ELISA, and/or immunochromatographic test (ICT), and dot immunobinding assay (DIBA) for specific IgM.

Virus isolation We collected 85 blood samples within five days after onset (36 samples were obtained in 2002, 18 samples in 2003, and 41 samples in 2006). Virus was isolated by Aedes albopictus mosquito C6/36 cell micromethod. The patient blood serum was diluted with RPMI 1640 containing 2% FBS to an appropriate concentration and inoculated into the C6/36 cells. The C6/36 cells were incubated at 28 °C, 5% CO2 for 21 days. Cultures were monitored for cytopathic effect (CPE) daily under the inverted phase contrast microscope. The inoculated cells were passaged once a week. Those with CPE were judged as positive for dengue virus, while those without CPE after passaging three times were declared negative.[9]

Materials and methods Patients and investigative methods The study was conducted from May 2002 to November 2006 at the Guangzhou No. 8 People’s Hospital. A total of 1360 patients were

RT-PCR, DNA purification and sequencing Viral RNA was extracted from the culture supernatants of infected C6/36 with an improved sodium iodide method. Nucleotides encoding a fragment of the NS2 gene were amplified using RT-PCR. The amplification parameter was as follows: 93° 40s, 55° 45s, 11

Dengue Bulletin – Volume 31, 2007

Dengue fever outbreak in Guangzhou, China – 2002-2006

72° 60s, thirty cycles. The products of RT-PCR were then analysed by 1.5% agarose (including ethidium bromide) electrophoresis. The universal primer sequences were P 5’G A C A T G G G G T A T T G G A T- 3 ’ , P 5 ’ TCCATCCCATACCAGCA-3’, which result in an amplification product of 413bp. DENV-1-type specific primer sequences were D1S 5’G T T G T T C C G C A G A C TA - 3 ’ , D 1 C 5 ’ CATGGTTAGTGGTTTG -3’, and the expected size of the amplification product was 346bp. The DENV and DENV-1, 2, 3, 4-type specific primers were provided by Institute of Military Medicine in Joint-Service Department of Guangzhou Military Region. The bands of predicted size were cut and purified using a Golden Bead Product Purification Kit (Songon, China) according to the manufacturers’ instructions. Purified PCR products were cloned on to pMD18-T Vector (TaKaRa, Japan) and delivered to TaKaRa Biotechnology Co. Ltd. for sequencing.[10]

Result Patients’ characteristics and geographical and time distribution of dengue outbreak During the study period, we observed a total of 1342 patients (687 male and 655 female, male/ female ratio = 1.05:1). The involvement of all age groups, especially an adult predominance, was observed. The mean age of the patients was 34.4±13.1 years and most of them belonged to the 20~29-year age group; less than 15% patients were children (Figure 1). Figure 1: Age groups distribution in 1342 patients with dengue fever 25 20 23.4 20.2 16.2 14.3 8.2 9.8 5.4 5 0 2.5

Percent (%)

15 10

Sequences analysis Sequence homology searches within the GenBank gene database were performed using NCBI BLASTn. In addition, CLUSTALX and TREEVIEW software were used to analyse sequence homology, and constructed its system cladogram. The DENV-1 international and domestic reference strains are as follows: Singapore strain(S275/90), Cambodia strain (Cambodia), West Pacific Ocean strain (WestPac), Thai strain (TH-Sman), Peruvian strain (Peru), Nauru strain (Nauru), Hawaian standard strain (Hawaii), and Guangdong 1995 strain (GD23/95), 1997 strain (GD14/97), 1999 epidemic strain (GD05/99).

0-

10-

20-

30-

40-

50-

60-

70Age groups

Geographical and time distribution of dengue outbreak Dengue fever cases were observed to be distributed in all 12 districts of Guangzhou. There were 872(65%) patients in the predominant outbreak spots where the number of DF cases was above 10. The peak time of the epidemics was from August to October each year. The number of cases in September reached its maximum, with 587 hospitalized cases, which constituted 43.7% of the total cases.

Statistics analyses All data were analysed using the SPSS10.0 software package. 12

Dengue Bulletin – Volume 31, 2007

Dengue fever outbreak in Guangzhou, China – 2002-2006

Clinical and laboratory feature Of the 1342 DF patients observed from the onset of acute fever, a majority of the cases had the typical signs and symptoms of DF, that included fever (100%), headache (85.9%), myalgia (64.5%), bone soreness (46.6%), fatigue (78.2%), skin rash (65.9%), lymphadenectasis (11.5%), splenohepatomegalia (8.4%), petechia (24.6%), positive tourniquet test (51.3%), internal haemorrhage (3.7%) and pleural effusion (0.22%), as shown in Figure 2. According to the WHO criteria, the diagnosis of DHF requires the presence of all 4 manifestations, i.e. fever, platelet count less than 100 000 cells/mm 3, haemorrhagic tendency, and evidence of capillary leakage (i.e. haematocrit increase for more than 20% from baseline, pleural effusion, ascites, or hypoproteinemia); the additional presence of

hypotension or narrow pulse pressure along with clinical signs of shock designates DSS.[3] On the basis of strict WHO criteria, only 2(0.15%) patients had DHF. However, we found that 64(4.8%) cases had severe clinical manifestations, including 50(3.7%) cases who had internal haemorrhage consisting of gastrointestinal tract bleeding (n=34) and/or hypermenorrhea or ecchymosis, as well as rare complications such as myocarditis (n=9), encephalopathy (n=5), shock (n=12), sepsis (n=9), and pneumonia (n=4). Four of the 12 patients with shock did not manifest bleeding signs. As shown in the Table, most patients had either a low WBC or platelet count during the acute phase of illness. 224(16.7%) patients had marked thrombocytopenia with a platelet count <50 000 cells/mm, the lowest platelet count was 4500 cells/mm in this case series. Among

Figure 2: Clinical presentation in 1342 patients with dengue fever

pleural effusion internal haemorrhage retro-orbital pain, cough splenohepatomegalia diarrhoea lymphadenectasis petechiae nausea and vomiting bone pain positive tourniquet test myalgia skin rash fatigue headache fever 0 200 400 600 800 1000 1200 1400 1600

The number of patients of every clinical presentation

Dengue Bulletin – Volume 31, 2007

13

Dengue fever outbreak in Guangzhou, China – 2002-2006

Table: Laboratory parameters in 1342 patients with dengue fever Item White blood cell count <×109/L 4~10×109/L >×109/L Blood platelets count <100×109/L <50×109/L ALT elevation 40~200 U/L >200 U/L AST elevation 40~200 U/L >200 U/L CK elevation LDH elevation Hypopotassemia (<3.6 umol/L) Total bilirubin elevation BUN elevation (>7.1 umol/L) Cases (%) 886 (66.0) 376 (28.0) 80 (6.0) 828 (61.3) 224 (16.7) 926 (69.0) 782 (89.3) 144 (10.7) 1150 (85.7) 992 (88.2) 158 (11.8) 404 (30.1) 611 (45.5) 276 (28.4) 72 (5.4) 15 (1.1)

those patients tested, over two thirds of them had increased liver enzyme levels, 10.7% and 11.8% of the patients had a 5-fold increase in ALT and AST levels respectively. Hypopotassemia were found in 276 (28.4%) patients.

Diagnosis of dengue virus infection and identification of DENV-isolated strains and sequence analysis In the serological analysis, 1208(90%) patients were positive for IgM antibody while 467(34.8%) were positive for anti-dengue IgG. Forty-four virus isolations (51.7%) were made from the blood samples of 85 cases which were inoculated in C6/36 cells. RTPCR amplification from the supernatants of the infected C6/36 cells samples was performed using universal primers, which

Figure 3: Agarose gel analysis of the cDNA products from RT-PCR samples isolated from the supernatants of the infected C6/36 cells. The expected size of the amplification product was 346bp with DENV-1 type specific primers.

1

2

3

4

5

2000bp 1000bp 750bp 500bp 250bp 100bp

Lane 1: Sample 1 Lane 2: DL 2000 marker (GeneRuler) Lane 3: Sample 2 Lane 4: Sample 3 Lane 5: Sample 4

346bp

14

Dengue Bulletin – Volume 31, 2007

Dengue fever outbreak in Guangzhou, China – 2002-2006

yielded the 413bp fragment, which was then used for DENV identification and sequencing. All the results were found to be confirmed DENV-1 positive by DENV-1-specific primer and amplified fragment was 346bp located on DENV-1 gene group’s NS2a~NS2b site, see Figure 3. The results confirmed that all

dengue viruses belonged to the DENV-1 virus. The nucleotide homology of Guangdong epidemic strain in 2003 were 97%ÿ97% and 98% when compared with that of DENV-1 strain of dengue fever outbreak in Cambodia, in 1997 and 1999 in Guangdong respectively (see Figure 4).

Figure 4: Sequence comparison of four DENV-1 isolated strains from Guangdong and Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia GD29/2003 GD14/97 GD05/99 Cambodia : : : : : : : : : : : : : : : : : : : : : : : : : : : : GTTGTTCCGCAGACTAACATCCAGAGAAGTTCTTCTTCTAACAATTGGATTGAGTC .....................T.................T................ A..A............................C. A..A............................C....................... a..a.................................................... TAGTGGCATCTGTGGAGTTACCAAATTCCTTGGAGGAGCTGGGGGATGGACTTGCA .............................C.......................... ........................................................ ........................................................ ATGGGCATCATGATTTTAAAATTATTGACTGACTTTCAATCACATTAGTTGTGGGC ........T............ ........T.............................G...T..C..C....... .................G...T..C..C....... .............................................C.......... ........t....................................c..c....... TACCTTGCTGTCCTTGACATTTATCAAAACAACGTTTTCCTTGCACTATG TACCTTGCTGTCCTTGACATTTATCAAAACAACGTTTTCCTTGCACTATGCATGGA CATGGA ........................................................ ........................................................ ........................................................ AGACAA AGACAATAGCTATGGTACTGTCAATTGTATCTCTCTTCCCCTTATGCCTGTCCACG TAGCTATGGTACTGTCAATTGTATCTCTCTTCCCCTTATGCCTGTCCACG .......G................................................ ........................................................ .......g................................................ ACCTCCCAAAAAACAACATGGCTTCCGGTGCTGTTGGGATCTCTTGGATGCAAACC ................................A...................... ................................A....................... .......................... ........................................................ ................................a................... ................................a....................... ACTAACCATG .......... .......... .......... :346 :346 :346 :346 :56 :56 :56 :56 :112 :112 :112 :112 :168 :168 :168 :168 :224 :224 :224 :224 :280 :280 :280 :280 :336 :336 :336 :336

Dengue Bulletin – Volume 31, 2007

15

Dengue fever outbreak in Guangzhou, China – 2002-2006

Discussion From May 2002 to November 2006, Guangzhou experienced a comparatively large-scale dengue fever outbreak. The case specimens collected at different times over four years were analysed by virus isolation, RT-PCR gene identification and sequencing, confirming that this epidemic was caused by DENV-1. The nucleotide homology of the Guangdong epidemic strain in 2003 were 97%, 97%, and 98% compared with those of DENV-1 strain of dengue fever outbreak in Cambodia, in 1997 and 1999 in China, respectively, and these strains belonged to the identical gene type. The initial cases were imported during the epidemic period and subsequently disseminated locally. Although four serotypes had been involved in several episodes of the comparatively large-scale DENV-1 outbreaks since 1995, [7,8] DENV-1 was the most predominant serotype in Guangdong. DF, as a mosquito-borne infection, would be expected to spread rapidly in populous areas, so the presence of a large proportion of patients in downtown is consistent with the experience elsewhere of dengue infection as an urban phenomenon.[11,12] In our study, 65% of 1342 cases presented in the main outbreak spots in downtown Guangzhou. This DENV-1 epidemic occurred in the rainy seasons from August to October when the abundant rainfall and the temperature favoured high rates of mosquito’s reproduction. Rainfall is considered to be a risk factor for dengue outbreak, especially in urban districts with poor sanitary environment, providing optimal breeding sites for mosquitoes.[13] The main mosquito vector for dengue viruses is Ae. albopictus in Guangdong, which breeds primarily in relatively clean, stagnant domestic water containers during the rainy season. Our data showed that there was no obvious difference in the patients’ gender distribution. 16

All age groups were affected, but over 80% of them were adults. Children aged 0~10 years comprised only 8.2% of the sample. In our study, the patients showed most of the typical clinical features of dengue fever, with only 2(0.15%) patients developing DHF according to the WHO criteria. The incidence of DHF was much lower in this study, compared with the reported 2%~6% in populations in the areas where dengue is endemic.[14,15] In an in-vitro experiment, DENV1 was isolated from samples of DF patients in 2002. DENV-1 is not as virulent as the other types of DENV and DENV-1 infection seems to have mild clinical presentations.[16,17] In the present study, a few unusual clinical observations and complications such as fulminant hepatitis, myocarditis, encephalopathy, and ophthalmic disease were observed.[18-23] We found that 64(4.8%) of cases had severe clinical manifestations including internal haemorrhage like gastrointestinal tract bleeding and/or hypermenorrhea or ecchymosis, as well as rare complications such as myocarditis, encephalopathy, shock, sepsis, and pneumonia. 16.7% of the patients had marked thrombocytopenia with a platelet count <50 000 cells/mm. More than 10% of the patients had a 5-fold increased liver enzymes. Our result is consistent with other reports.[12,18] In recent years, the validity of the WHO classification scheme to define severe dengue disease has been found to be inconsistent. Several studies have found that the WHO classification is difficult to apply, with many severe adult cases being missed.[4-6] Because, according to the WHO criteria, haemorrhagic manifestations without capillary leakage do not constitute DHF, the DSS refers to a condition in which shock is present in addition to all four DHF-defining conditions. The WHO classification is mainly based on studies of children in South-east Asia in the 1960s and Dengue Bulletin – Volume 31, 2007

Dengue fever outbreak in Guangzhou, China – 2002-2006

may therefore not be applicable to predominantly adult subjects. Shock and plasma leakage appear to be more common in children, whereas internal haemorrhage is a more frequent manifestation in adults. In addition, the DHF/DSS classification excludes severe dengue disease associated with “unusual manifestations”. Therefore, a new definition for severe dengue is urgently needed.[24] A large multicentre study should be performed to establish a more robust dengue classification scheme for use by clinicians, epidemiologists and scientists involved in dengue pathogenesis research.[6] In brief, the DF epidemic in Guangzhou from 2002 to 2006 was caused by DENV-1. Most cases had the typical clinical manifestation References [1] Gubler DJ. Dengue and dengue haemorrhagic fever: its history and resurgence as a global public health problem. In: Gubler DJ, Kuno G, editors. Dengue and dengue haemorrhagic fever. New York: CAB International; 1997. p.1-23. [2] Gubler DJ. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev. 1998 Jul; 11(3): 48096. [3] World Health Organization. Dengue haemorrhagic fever: diagnosis, treatment, prevention and control. 2 nd edn. Geneva; WHO, 1997. [4] Balmaseda A, Hammond SN, Pérez MA, Cuadra R, Solano S, Rocha J, Idiaquez W, Harris E. Short report: assessment of the World Health Organization scheme for classification of dengue severity in Nicaragua. Am J Trop Med Hyg. 2005 Dec; 73(6): 1059-62. [5] Phuong CX, Nhan NT, Kneen R, Thuy PT, van Thien C, Nga NT, Thuy TT, Solomon T, Stepniewska K, Wills B; Dong Nai Study Group. Clinical diagnosis and assessment of severity of confirmed dengue infections in Vietnamese children: is the World Health Dengue Bulletin – Volume 31, 2007

of dengue fever and were diagnosed as typical DF. But in some patients, the diagnosis of DHF may be missed if the WHO classification is strictly applied, especially in adults. A new definition for severe dengue may be needed.

Acknowledgements We are grateful to the CDC of Guangzhou and the CDC of Guangdong province for their continuing epidemiological survey and virological laboratory support. This work was partially supported by grants from the Foundation of Guangzhou Municipal Science and Technology Bureau. We thank Alfredo Garzino-Demo for critically reading this manuscript.

Organization classification system helpful? Am J Trop Med Hyg 2004 Feb;70(2):172-9. [6] Deen JL, Harris E, Wills B, Balmaseda A, Hammond SN, Rocha C, Dung NM, Hung NT, Hien TT, Farrar JJ. The WHO dengue classification and case definitions: time for a reassessment. Lancet. 2006 Jul 8; 368(9530): 170-3. [7] Luo H, He J, Zheng K, Li L, Jiang L. [Analysis on the epidemiologic features of Dengue fever in Guangdong province, 1990-2000]. Zhonghua Liu Xing Bing Xue Za Zhi. 2002 Dec; 23(6): 427-30. Chinese. [8] Zhang FC, Chen YQ, Lu YC, Wang J, Chen WS, Hong WX. [Analysis on clinical and epidemiological characteristics of 1032 patients with Dengue fever in Guangzhou]. Zhonghua Liu Xing Bing Xue Za Zhi. 2005 Jun; 26(6): 421-3. Chinese. [9] Gubler DJ, Kuno G, Sather GE, Velez M, Oliver A. Mosquito cell cultures and specific monoclonal antibodies in surveillance for dengue viruses. Am J Trop Med Hyg. 1984 Jan; 33(1): 158-65. 17

Dengue fever outbreak in Guangzhou, China – 2002-2006

[10] Deubel V, Laille M, Hugnot JP , Chungue E, Guesdon JL, Drouet MT, Bassot S, Chevrier D. Identification of dengue sequences by genomic amplification: rapid diagnosis of dengue virus serotypes in peripheral blood. J Virol Methods. 1990 Oct; 30(1): 41-54. [11] Kuno G. Factors influencing the transmission of dengue viruses. In: Gubler DJ, Kuno G, editors. Dengue and dengue haemorrhagic fever. New York: CAB International; 1997. p. 6188. [12] Brown TU, Babb K, Nimrod M, Carrington CVF, Salas RA, Monteil MA. A retrospective study of the 1996 DENV-1 epidemic in Trinidad: demographic and clinical features. Dengue Bulletin. 2004; 28: 7-19. [13] Focks DA, Chadee DD. Pupal survey: an epidemiologically significant surveillance method for Aedes aegypti: an example using data from Trinidad. Am J Trop Med Hyg. 1997 Feb; 56(2): 159-67. [14] Guzmán MG, Kouri G, Valdes L, Bravo J, Alvarez M, Vazques S, Delgado I, Halstead SB. Epidemiologic studies on Dengue in Santiago de Cuba, 1997. Am J Epidemiol. 2000 Nov 1; 152(9): 793-9; discussion 804. [15] Shepard DS, Suaya JA, Halstead SB, Nathan MB, Gubler DJ, Mahoney RT, Wang DN, Meltzer MI. Cost-effectiveness of a pediatric dengue vaccine. Vaccine. 2004 Mar 12;22(910):1275-80. [16] Zhang J, Jian R, Wan YJ, Peng T, An J. Identification and phylogenetic analysis of DENV-1 virus isolated in Guangzhou, China, in 2002. Dengue Bulletin. 2004; 28: 135-144. [17] Kalayanarooj S, Nimmannitya S. Clinical and laboratory presentations of dengue patients with different serotypes. Dengue Bulletin. 2000; 24:53-59.

[18] Wichmann O, Gascon J, Schunk M, Puente S, Siikamaki H, Gjørup I, Lopez-Velez R, Clerinx J, Peyerl-Hoffmann G, Sundøy A, Genton B, Kern P , Calleri G, de Górgolas M, Mühlberger N, Jelinek T; European Network on Surveillance of Imported Infectious Diseases. Severe dengue virus infection in travelers: risk factors and laboratory indicators. J Infect Dis. 2007 Apr 15; 195(8): 1089-96. [19] Sumarmo, Wulur H, Jahja E, Gubler DJ, Sutomenggolo TS, Saroso JS. Encephalopathy associated with dengue infection. Lancet. 1978 Feb 25; 1(8061): 449-50. [20] Seet RC, Lim EC, Wilder-Smith EP. Acute transverse myelitis following dengue virus infection. J Clin Virol. 2006 Mar; 35(3): 3102. [21] Misra UK, Kalita J, Syam UK, Dhole TN. Neurological manifestations of dengue virus infection. J Neurol Sci. 2006 May 15; 244(12): 117-22. [22] Poovorawan Y, Hutagalung Y, Chongsrisawat V, Boudville I, Bock HL. Dengue virus infection: a major cause of acute hepatic failure in Thai children. Ann Trop Paediatr. 2006 Mar; 26(1): 17-23. [23] Chan DP, Teoh SC, Tan CS, Nah GK, Rajagopalan R, Prabhakaragupta MK, Chee CK, Lim TH, Goh KY; The Eye Institute DengueRelated Ophthalmic Complications Workgroup. Ophthalmic complications of dengue. Emerg Infect Dis. 2006 Feb; 12(2): 285-9. [24] Rigau-Pérez JG. Severe dengue: the need for new case definitions. Lancet Infect Dis. 2006 May; 6(5): 297-302.

18

Dengue Bulletin – Volume 31, 2007

Key facts
Document type Journal articles
Adoption date
Source World Health Organization